Skip to main content

Full text of "Bulletin of the British Ornithologists' Club"

See other formats


mm 




British Ornithologists' Club 




THE NATURAL 
HISTORY MUSEUM 

1 5 MAR 2010 



PRESENTED 
TRING LIBRARY 



Volume 130 No. 1 
March 2010 



MEETINGS are normally held in the ground floor of the Sherfield Building of Imperial College, South 
Kensington, London, SW7. This suite is now called the Tower Rooms and meetings will normally take place 
in Section C with the entrance opposite the Queen's Tower in the main quadrangle . The nearest Tube station 
is at South Kensington; a map of the area will be sent to members, on request. (Limited car parking facilities 
can be reserved [at a special reduced charge of £5.00], on prior application to the Hon. Secretary.) 

The cash bar is open from 6.15 pm, and a buffet supper, of two courses followed bv coffee, is served at 
7.00 pm. (A vegetarian menu can be arranged if ordered at the time of booking.) Informal talks are given on 
completion, commencing at about 8.00 pm. 

Dinner charges are £22.50 per person. 

FORTHCOMING MEETINGS 

See also BOC website: http://www.boc-online.org 

PLEASE NOTE THE MINOR CHANGE TO OUR REGULAR VENUE (see above). Section C of the 
renamed TOWER ROOMS is to the east of the previous venue of the Ante-room which no longer exists; 
this is nearer to the main entrance off Exhibition Road but still part of the Sherfield Building. 



16 March — Dr Julian Hume — Birds of the Comoros Islands 

Dr Hume is a Research Associate of the Natural History Museum, Tring, and is currently working on fossil 
birds of the south-west Indian Ocean 

Applications to Hon. Secretary (address below) by 2 March 2010 



27 April — Annual General Meeting at 6.00 pm followed by a Club Social Evening. 

There will be no booked speaker but members are invited to bring along one or two slides, a short PowerPoint 
presentation or a specimen (!) of a bird or ornithological subject of topical interest and to speak for not 
more than 5-10 minutes about it. The aim will be to generate discussion and to facilitate the exchange of 
information between members. 

Applications to Hon. Secretary (address below) by 13 April, including subjects to be raised and any special facilities 
(e.g. laptop computer) required. 



22 June — Dr Lincoln Fishpool — BirdLife International's Important Bird Area programme: a global perspective 
Dr Fishpool coordinates technical aspects of BirdLife's Important Bird Areas (IBA) programme. His talk will 
present a summary of the global programme through which sites critical for bird conservation worldwide are 
identified, documented and their protection sought. The talk will highlight recent developments, including 
the standardised methods by which sites are monitored, the uses to which resulting data are put, progress 
in identifying marine IBAs and how IBA methodology is contributing to the expansion of the approach to 
non-avian taxa: Key Biodiversity Areas. 

Applications to Hon. Secretary (address below) by 8 June 2010 



Overseas Members visiting Britain are especially welcome at these meetings, and the Hon. Secretarv would 
be very pleased to hear from anyone who can offer to talk to the Club giving as much advance notice as 
possible — please contact: S. A. H. (Tony) Statham, Ashlyns Lodge, Chesham Road, Berkhamsted, Herts. HP4 
2ST, UK. Tel. +44 (0) 1442 876 995 (or e-mail: boc.sec@bou.org.uk). 



BOC Office 

P.O. Box 417, Peterborough PE7 3FX, UK 
E-mail: boc.office@bou.org.uk. Website: www.boc-online.org 
Tel. & Fax: +44 (0) 1733 844 820. 



Club Announcements 



Bulletin of the 

BRITISH ORNITHOteefg^CLUB 



THE NATURAL Bfflt 
HISTORY MUSEUM 

1 5 MAR 2010 

PRESENTED 



.O.C. 2010 130(1) 



Vol. 130 No. 1 



Published 14 March 2010 



CLUB ANNOUNCEMENTS 

Committee was saddened to learn of the death of the following members: P. Tate — member since 1956 (Hon. 
Life Member since 2006, Hon. Treasurer 1962-74) and Cdr. F. S. Ward, RN— member since 1996 

Members are reminded that subscriptions were due for renewal on 1 January 2010 and are again respectfully 
requested to check that any Standing Orders are correctly lodged with their banks. Subscriptions are £20 p.a. 
regardless of whether the subscriber is a member of the BOU or not. 

ANNUAL GENERAL MEETING 

The Annual General Meeting of the British Ornithologists' Club will be held in the Tower Rooms, Section A, 
Sherfield Building, Imperial College, London SW7 at 6.00 pm on Tuesday 27 April 2009. 

AGENDA 

1. Minutes of the 2009 Annual General Meeting (see Bull. Brit. Orn. CI. 129: 66-67). 

2. Chairman's report. 

3. Trustees Annual Report and Accounts for 2009 (both to be distributed at the meeting). 

4. The Bulletin. Editor's report — Mr G. M. Kirwan. 

5. Publications report — Revd. T. W. Gladwin, Chairman JPC. 

6. Election of Officers. The Committee proposes that: 

i) Mr S. A. H. Statham be re-elected as Hon. Secretary 

ii) Mr D. J. Montier be re-elected as Hon. Treasurer 

No changes to the committee are proposed, as all other members are eligible to serve at least one 
more year in office. 

Ex-officio members (in continuation): Revd. T. W. Gladwin (Chairman Joint Publications 
Committee), Mr S. P. Dudley (Administration Manager), and Mr G. M. Kirwan (Hon. Editor) 

7. Any other business, of which advance notice has been given. 



The 957th meeting of the Club was held on Tuesday 6 October 2009 in the Rector's Residence, Imperial 
College, 170 Queens Gate, London. Fifteen members and six guests were present. 

Members attending were: Miss H. BAKER (Chairman), D. R. CALDER, F. M. GAUNTLETT, A. GIBBS, D. 
GRIFFIN, K. HERON JONES, R. H. KETTLE, R. R. LANGLEY, D. J. MONTIER, R. C. PRICE, Dr R. P. PRYS- 
JONES, P. J. SELLAR, S. A. H. STATHAM, C. W. R. STOREY and P. J. WILKINSON 

Guests attending were: Mrs J. CALDER, Dr D. DAWSON, Mrs M. H. GAUNTLETT, Prof. D. GOODE 
(Speaker), Mrs J. HERON JONES and Mrs M. MONTIER. 

After dinner, Professor David Goode gave an illuminating talk on Habitat change and its impact on species 
including avifauna, with predictions for London's natural history in 2058. Progress in nature conservation over 
the last 30 years was reviewed, along with some of the more notable changes in London's natural history, to 
provide a basis for predictions for the next 50 years. Major factors responsible for changes in bird populations 
were summarised. Whilst London has a robust planning framework for nature conservation, which should 
ensure the protection of important habitats, climate change is expected to have significant impacts. Some 
current changes in the distribution of species resulting from climate change were discussed, using birds and 
dragonflies as examples. 

Looking ahead, the danger of making firm predictions was recognised, but introduced species and 
climate change are likely to be the most significant factors. Current predictions for London's climate were 
summarised, which suggest that a northward movement of species from continental Europe colonising the 
UK will be enhanced by the heat island effect of the capital. Using predictions in the Climatic atlas of European 
breeding birds (Huntley et al. 2008), together with knowledge of London's habitats, an assessment was made of 
those species likely to be lost, and conversely those species currently rare or absent which are predicted to be 



Club Announcements 



2 



Bull. B.O.C. 2010 130(1) 



breeding by late in the 21st century. It seems that 30 bird species could become established as new breeders. 
The results have been published in full in The London Naturalist 88 (2009). 



REVIEW 

Buckley, P. A., Massiah, E. B., Hurt, M. B., Buckley, F. B. & Hurt, H. F. 2009. The birds of Barbados: an annotated 
checklist. BOU Checklist No. 24. British Ornithologists' Union & British Ornithologists' Club, Peterborough. 
295 pages, several maps and 78 colour plates. UK£40.00. 

The latest of the BOU's Checklists, which covers the most oceanic of the Lesser Antilles, builds on the 
tradition of island avifaunas, especially West Indian ones, that has come to characterise the series. With 
honourable exceptions (Borneo being one), islands are often relatively species-poor (Barbados boasts just 263, 
of which two were added during the proof stage) which might suggest that such works would be easier to 
compile, but the germs of the present work date from the 1970s, if not earlier! 

In comparison to most previous Checklists with insular subjects, Barbados is notably (but given its 
geographic location unsurprisingly) depauperate in endemics. Just one taxon, Barbados Bullfinch Loxigilla 
barbadensis, is currently recognised at species level and that but recently (following work by two authors of 
the present work in these pages; Bull. Brit. Orn. CI. 124: 108-123). Just 30 species are listed as breeders (18 of 
them landbirds). However, Barbados has other attractions for the birdwatcher; as the authors state, '[it] is the 
Fair Isle of the Caribbean', and thus a veritable paradise for the modern-day migrant and vagrant hunter. Not 
only is the island on the main southbound migration route for many North American-breeding shorebirds, 
but rarities from just about every compass point have appeared on Barbados over the years. Despite the 
relative lack of observer coverage, as one of the many useful appendices notes the island can boast 39 'first' 
records for the West Indies, 14 'firsts' for the AOU Check-list area and a staggering 11 'firsts' for the Western 
Hemisphere. Of these totals, significant percentages are also 'unique' records (i.e. the species concerned have 
occurred nowhere else in the different regions). Old World vagrants are a speciality and some have even 
started to nest (or appear likely to do so in the future) on the island, a phenomenon not confined to Barbados 
as it seems that Squacco Heron Ardeola ralloides will soon be confirmed to breed on the Brazilian island of 
Fernando de Noronha (Silva e Silva & Olmos, 2006, Rev. Bras. Orn. 14: 470^474). Perhaps surprisingly, this 
species has yet to be found on Barbados, but it is listed as a potential addition to the avifauna in another 
appendix. 

Following a typical suite of introductory sections, of which those on 'research agenda' (mainly 
taxonomic), 'enigmatic historical taxa' and 'unsupported species' perhaps draw the eye most, we are into the 
species accounts. These commence with world range, thence West Indies status and distribution, followed 
by a summation of the situation on Barbados, and close with a series of 'optional' sections on breeding, 
comments, and specimens, of which 'comments' is that most frequently employed. And, indeed these are 
frequently a mine of thought-provoking remarks, with especial foci on taxonomy and vagrancy. That for 
Caribbean Coot Fulica caribaea is just one of many good examples. The species accounts ' raise plenty of 
questions for those interested in surroundings regions too: where do all those Ruff Philomachus pugnax that 
pass through Barbados end up? Records in South America are almost nil. I'd have liked to have seen more 
references used to illuminate the section covering general West Indian status. Although the authors provide 
background to how this information was compiled (p. 60), quite a lot of 'grey literature' has been researched, 
which it would have been helpful to specify for at least some particular facts. Other complaints are 'picky': 
I noticed few 'typos', though I would expect the writers and editors of a Checklist to know that the English 
name of Pterodroma arminjoniana is spelt Trindade (just like the island on which it breeds). The photographic 
section arguably overdoes the number of habitat and landscape shots, whilst some of the vagrant photos are 
sufficiently 'documentary' that they add rather little in such a work as this. 

Collectors of the series will not be disappointed and students of West Indian ornithology, in particular, 
should consider this work a 'must'. Those fascinated by vagrants and perhaps seeking a 'new' destination to 
pioneer will also be well advised to take a look at this book. The price might seem high, but is by and large 
compatible with the cost of avifaunas of a similar nature produced by commercial publishers. 

Guy M. Kirwan 



Niels Krabbe & Robert S. Ridgely 



3 



Bull. B.O.C. 2010 130(1) 



A new subspecies of Amazilia Hummingbird Amazilia 
amazilia from southern Ecuador 

by Niels Krabbe & Robert S. Ridgely 

Received 15 January 2008; final revision accepted 14 September 2009 

Summary. — A new subspecies of Amazilia Hummingbird Amazilia amazilia is 
described from the Ecuadorian Andes. It appears to be closest related to A. a. 
dlticola from southern Loja and adjacent parts of Zamora-Chinchipe provinces in 
southern Ecuador. 

The Amazilia Hummingbird Amazilia amazilia inhabits arid and semi-arid parts of 
western Peru and Ecuador. The five described subspecies differ mensurally and in the 
coloration of the bill, underparts, rump and tail. Weller (2000) described in detail the 
distinctive features and variation of these taxa, and suggested that the form alticola is better 
ranked as a full (biological) species. Based upon a preview of Weller's study, Schuchmann 
(1999) followed this, whereas Ridgely & Greenfield (2001) adhered to the more traditional 
classification, which is the course followed here and by Remsen et al. (2009). 

During field work in southern Ecuador in the 1990s, expeditions by the Academy of 
Natural Sciences of Philadelphia collected specimens (Ridgely & Greenfield 2001) that 
suggested the existence of geographical variation within the range ascribed to alticola by 
Weller (2000). Birds from the northern end of the range differ consistently from birds in the 
south. This variation was mentioned briefly in Ridgely & Greenfield (2001), but no formal 
description was published. 

Gould (1860) described the form alticola from a single specimen presented to him 
by Jules Bourcier. The specimen was purportedly taken in the Tuna district of Peru 7 , 
but because alticola has never been documented in Peru, the specimen is unquestionably 
mislabeled. The type description includes two characters suggestive that the type represents 
birds from the southern end of the range ascribed to alticola by Weller (2000). These are: 'bill 
black at the tip, the remainder white or flesh colour', and 'four outer ones [rectrices], on 
each side, washed on their outer edges with bronzy green'. Both characters, however, do 
vary somewhat in both populations. On the most distinctive difference between the two 
populations, the colour of the upper belly, Gould described the type of alticola as having 
'flanks rich bright buff. Northern birds have the buff confined to a small area on the flanks, 
whereas in southern birds the buff is much more extensive, meeting or nearly meeting on 
the upper belly in most specimens, but occasionally with a somewhat wider white area on 
the middle of the belly. Gould's wording is thus not entirely clear, but an examination by 
Mark Adams of the type revealed that its uppertail-coverts are washed greenish bronze, 
and its flanks and sides are decidedly more extensively rich buff (rufous) than in birds from 
the northern end of the range ascribed to alticola. We thus consider it beyond doubt that 
the name alticola applies to the southern population. Birds from the rio Jubones drainage 
in northern Loja and southern Azuay provinces differ consistently to warrant subspecific 
recognition as a distinct taxon. We name this new form: 

Amazilia amazilia azuay subsp. nov. 

Holotype. — Museo Ecuatoriano de Ciencias Naturales, Quito (MECN) uncatalogued, 
collector's no. NK1-4.3.02; adult male collected by N. Krabbe on a semi-humid bushy slope 



Niels Krabbe & Robert S. Ridgely 



4 



Bull. B.O.C. 2010 130(1) 



in the Yunguilla Valley, Azuay Province, Ecuador, at 03°14'S, 79°17'W, elevation 1,650 m, on 
4 March 2002. Tissue sample deposited at Zoological Museum, University of Copenhagen 
(ZMUC 128002). Label data.— Body mass 7.4 g. Irides blackish, upper mandible reddish 
pink on basal 5 mm on top and basal 3 mm on sides, rest blackish; lower mandible reddish 
pink with blackish tip (5 mm); feet blackish; testes 2.0 x 1.5 mm (inactive). Mensural data 
for the holotype and paratypes appear in Table 1. 

Paratypes. — Four additional specimens (all in MECN, uncatalogued) were taken along 
with the holotype in the Yunguilla Valley on 4 and 6 March 2002: collector's no. NK3- 
4.3.02 (male), NK2-6.3.02 (male), NK1-6.3.02 (immature male) and NK4-4.3.02 (female). 
Tissue from the paratypes is deposited at ZMUC (128004, 128007, 128006 and 128005, 
respectively). 

Diagnosis. — Differs from Amazilia a. alticola by having a nearly pure white belly, the 
rufous on the sides being restricted to a small area on the lower flanks, by having more 
extensively and paler rufous in the tail and uppertail-coverts, and, apparently, by having 
the pink at the base of the upper mandible on average more limited in extent. 

Description of holotype. — Colour names and numbers follow Smithe (1975). Crown 
Leaf Green (146), cheeks, back and wing-coverts between Shamrock Green (162B) and 
Peacock Green (162C), with a slight bronzy sheen, which is more pronounced on lower 
back and some feathers of rump, rest of rump, uppertail-coverts and most of tail Kingfisher 
Rufous (240); central pair of rectrices washed bronze-green on terminal half, next pair 
with similar wash on edges of terminal half, outer three pairs wholly rufous; greater 
primary-coverts dusky with slight greenish tinge, remiges dusky; underparts white, chin 
and throat with sparse golden green discs; neck- and breast-sides, and lesser underwing- 
coverts of secondaries golden-green, this colour extending as a few discs towards the 
centre of the lower breast, upper belly with very faint buffy wash; median underwing- 
coverts of secondaries, flanks and lateral undertail-coverts between Salmon Color (6) and 
Orange-Rufous (132C); greater underwing-coverts of secondaries, all underwing-coverts of 
primaries, and underside of remiges dusky. 

Variation in the series. — The five specimens (three adult males, one immature male, 
one adult female) taken at the type locality (Fig. 2) on 4 and 6 March 2002 vary principally 
in the amount of bronzy green in the rectrices. The fifth (outer) and fourth rectrices are 
entirely rufous in four specimens, whereas they have a faint and narrow bronzy green 
fringe and spot near the tip of the outer web in the fifth specimen. The third rectrix is all 
rufous in two specimens, but in the other three has a 0.5-1.0 mm-wide edge of bronzy 
green on the terminal 12-14 mm of the outer web. The second and first (central) rectrices 
vary more greatly and are not alike in any two specimens. On the second the green ranges 
from covering only a 3-mm tip and tapering anteriorly along the edges of both webs to 14 
mm from tip, to covering the entire outer web and the terminal 10 mm of the inner web. 
The first rectrix is yet darker, with rufous showing only on the basal portion of the feather, 
in the darkest specimen only as a dark rufous wash along the shaft, in the palest, as rufous 
covering half of each web to 13 mm from tip. 

The rump and uppertail-coverts also vary. Most specimens have entirely rufous 
uppertail-coverts, but in one there is a wash of greenish bronze on the longest. The rump 
feathers are generally greenish bronze with narrow rufous fringes, but some of the lateral 
ones are entirely rufous in some specimens. Four specimens have c.5 mm of pink at the base 
of the upper mandible, whereas the immature male (by the size of its testes), has only a faint 
reddish wash to the base of the culmen and has the basal 2 mm of the sides of the upper 
mandible buff. The immature does not differ from the adults in plumage. 



Niels Krabbe & Robert S. Ridgely 



5 



Bull. B.O.C. 2010 130(1) 




Figure 1. Eight specimens of 
Amazilia amazilia alticola (including 
somealticola / dumeriliimtergrades) 
(top) and eight specimens of 
Amazilia amazilia azuay (bottom), 
held at the American Museum of 
Natural History, New York (Niels 
Krabbe) 

Figure 2. The topotypical series 
of Amazilia amazilia azuay, the 
holotype furthest left, held at the 
Museo Ecuatoriano de Ciencias 
Naturales, Quito (Niels Krabbe) 

Figure 3. Type specimen of 
Amazilia amazilia alticola, held at 
The Natural History Museum, 
Tring (BMNH 1888.7.25.139) (Mark 
P. Adams / © The Natural History 
Museum, Tring) 



Comparison of A. a. azuay with A. a. alticola. — Specimens of A. a. azuay differ 
consistently from A. a. alticola in their pale bellies. Variation is considerable in the amount of 
rufous on the belly in alticola; in some specimens the rufous of the sides only meets or nearly 
meets on the upper belly, whereas in others it extends to cover the entire belly. Even in the 
palest specimens, the rufous is decidedly brighter and more extensive than in azuay (Fig. 1). 
Like azuay, alticola varies in the amount of greenish bronze in the tail, and the extremes of 
the two come close in this respect. As a general rule, however, the greenish bronze in the 
tail of alticola is more extensive than in azuay, and the rufous in the tail somewhat darker. 
The uppertail-coverts of alticola are greenish bronze, the lateral ones occasionally rufous, 
but then darker rufous than in azuay, which has entirely rufous uppertail-coverts in most 
specimens. The amount of pink at the base of the upper mandible appears to average more 
extensive in alticola, but variation in this character is pronounced. None of the type series of 



Niels Krabbe & Robert S. Ridgely 



6 



Bull. B.O.C. 2010 130(1) 



azuay or of birds observed in the field had more than c.5 mm of pink. Our field observations 
of alticola indicate that this form frequently has as much as 13-15 mm of pink, but that it 
occasionally shows as little as azuay. 

Distribution, habitat and conservation. — Amazilia a. azuay appears to be confined 
to the no Jubones drainage in Azuay and immediately adjacent Loja provinces, south- 
central Ecuador, at 1,000 to c.2,500 m (2,920 m?) (Weller 2000; pers. obs.). Like alticola, azuay 
inhabits arid to semi-humid scrub, including heavily disturbed areas and gardens. It is 
fairly common and tolerates a large degree of disturbance, giving no cause for concern for 
its survival. 

Etymology. — We name this taxon after the province of Azuay, where the type series 
was taken, and where the majority of the population occurs. 

Discussion 

The great variation in the amount of rufous on the underparts of alticola specimens 
(Figs. 1 and 3) suggests broad intergradation with the coastal form dumerilii. Similarly, 
variation is great in the amount of greenish bronze in the tail of alticola (Chapman 1926, 
Weller 2000). Both these authors reported an increase in the amount of white on the 
underparts in dumerilii specimens from the coast to specimens from the submontane parts 
of south-west Ecuador. Chapman considered the submontane population along with alticola 
to represent intergradation between dumerilii and leucophoea of north-west Peru. Weller, 
on the other hand, considered the submontane birds a geographic variant of dumerilii, 
and believed that these birds were specifically distinct from alticola. He reported mensural 
differences (mainly tail length) between dumerilii and birds he considered to be true alticola. 
He did not, however, give separate measurements of lowland and submontane populations 
of dumerilii, and it is not quite clear how he distinguished submontane birds from alticola 
other than by the length of the central rectrices. He also reported vocal differences between 
the two, but gave no sample size of the number of recordings examined. In our limited 
vocal material of azuay, alticola and coastal populations of dumerilii (nine, one and six 
recordings, respectively), almost every individual is different. We have similarly noted a 
large repertoire in vocalisations of another species of Amazilia (Rufous-tailed Hummingbird 
A. tzacatl). Other species of hummingbirds have been reported to have surprisinglv large 
repertoires as well as local dialects (e.g. Gaunt 1996, Gonzalez & Ornelas 2005), so we do 
not consider the vocal differences reported by Weller (2000) sufficientlv substantiated to 
support treating alticola as a full species. On present evidence, we cannot rule out that birds 
from the submontane region are intermediates between dumerilii and alticola in a broad zone 
of intergradation and that azuay forms the end of such a cline. Great variation in alticola and 
dumerilii specimens from a broad zone of intergradation, rather than a dominance of parental 
types (see Johnson et al. 1999, Helbig et al 2002, Patten & Unitt 2002), would support alticola 
being worthy of no more than subspecific rank. In this respect, there would be a stronger 
case for ranking azuay as a full species, as it appears to be geographicallv isolated under 
present climatic conditions. Its range is separated from that of alticola bv the Cordilleras de 
Chilla, Tioloma and Cordoncillo, between the Jubones, Catamavo and Zamora drainages. 
The crests of these mountains exhibit more humid conditions than preferred by azuay, and 
no pass lies below the known upper altitudinal limit of this form. Owing to the humid 
conditions in El Oro and the Pacific slope where the rio Jubones cuts through the Andes, it 
also seems unlikely that azuay comes into contact with coastal dumerilii. Because azuay and 
alticola differ less from each other than do some other subspecies of A. amazilia, however, 
we suggest that azuay is best afforded subspecific rank. 



Niels Krabbe & Robert S. Ridgely 



7 



Bull. B.O.C. 2010 130(1) 



TABLE 1 

Measurements (in mm) of the type series of Amazilia Hummingbird Amazilia amazilia 
azuay. Compare with measurements of other forms given by Weller (2000). 



Collector's no. 


Sex 


Bill 


Wing 


Rectrix 1 (central) 


Rectrix 5 (outer) 


NK1-4.3.02 


male (type) 


21.5 


64.2 


32.8 


35.2 


NK3-^.3.02 


Male 


20.1 


63.2 


31.8 


35.2 


NK2-6.3.02 


Male 


21.1 


60.2 


31.7 


34.5 


NK1-6.3.02 


Immature male 


22.6 


57.1 


29.8 


32.2 


NK4-4.3.02 


female 


c.22 


58.0 


33.3 


34.2 



Acknowledgements 

We are indebted to The Natural History Museum, Tring, curator Mark P. Adams for loan of specimens and 
for photographs of the holotype of alticola; to Paul Sweet, American Museum of Natural History, New York, 
for permission to examine specimens; and to J. Fjeldsa, F. G. Stiles and an anonymous reviewer for useful 
comments on the manuscript, as well as to G. M. Kirwan for additional editorial comments. 



References: 

Chapman, F. M. 1926. The distribution of bird-life in Ecuador. Bull. Amer. Mus. Nat. Hist. 60. 
Gaunt, S. L. L. 1996. Song displays, song dialects, and lek mating systems in hummingbirds. /. Acoustic. Soc. 
Amer. 99: 2532-2574. 

Gonzalez, C. & Ornelas, J. F. 2005. Song structure and microgeographic variation in Wedge-tailed Sabrewings 

{Campylopterus curvipennis) in Veracruz, Mexico. Auk 122: 593-607. 
Helbig, A. J., Knox, A. G., Parkin, D. T., Sangster, G. & Collinson, M. 2002. Guidelines for assigning species 

rank. Ibis 144: 518-525. 

Johnson, N. K., Remsen, J. V. & Cicero, C. 1999. Resolution of the debate over species concepts in ornithology: 
a new comprehensive biologic species concept. Pp. 1470-1482 in Adams, N. J. & Slotow, R. H. (eds.) 
Proc. Intern. Orn. Congr., Durban. BirdLife South Africa, Johannesburg. 

Patten, M. A. & Unitt, P. 2002. Diagnosability versus mean differences of Sage Sparrow subspecies. Auk 119: 
26-35. 

Remsen, J. V., Cadena, C. D., Jaramillo, A., Nores, M., Pacheco, J. F., Robbins, M. B., Schulenberg, T. S., Stiles, 
F. G., Stotz, D. F. & Zimmer, K. J. 2009. A classification of the bird species of South America, www. 
museum.lsu.edu/ -Remsen/ SACCBaseline.html 

Ridgely, R. S. & Greenfield, P. J. 2001. The birds of Ecuador. Cornell Univ. Press, Ithaca, NY. 

Schuchmann, K.-L. 1999. Family Trochilidae (hummingbirds). Pp. 468-680 in del Hoyo, J., Elliott, A. & 
Sargatal, J. (eds.) Handbook of the birds of the world, vol. 5. Lynx Edicions, Barcelona. 

Smithe, F. B. 1975. Naturalist's color guide. New York: Amer. Mus. Nat. Hist. 

Weller, A.-A. 2000. Biogeography, geographic variation and habitat preference in the Amazilia Hummingbird, 
Amazilia amazilia Lesson (Aves: Trochilidae), with notes on the status of Amazilia alticola Gould. /. Orn. 
141: 93-101. 

Addresses: Niels Krabbe, Zoological Museum, University of Copenhagen, Universitetsparken 15, DK-2100, 
Copenhagen 0, Denmark, e-mail: nkkrabbe@snm.ku.dk. Robert S. Ridgely, P.O. Box 58, North 
Sandwich, NH 03259, USA, e-mail: rridgely@earthlink.net. 

APPENDIX 

Specimens examined: 

A. a. azuay: Yunguilla Valley: 5 males, 1 female (including the holotype); Guishapa, Ona: 1 female; Giron: 1 
female. Ten old specimens labelled 'Loja' and 'Ecuador' also appear to belong here. 

A. a. alticola or A. a. alticola / dumerilii intergrades: Casanga: 1 male, 1 female; Rio Zamora: 1 unsexed; Zamora: 
2 males; Rio Pindo: 1 unsexed; 'Loja' 1 male, 2 unsexed; Guainche: 1 male, 3 unsexed; Lunama: 2 males, 1 
female; Portovelo: 2 males, 3 unsexed. 



© British Ornithologists' Club 2010 



Stefan Abrahamczyk & Michael Kessler 



8 



Bull. B.O.C. 2010 130(1) 



Ecological and distributional notes on hummingbirds from 

Bolivian lowland forests 

by Stefan Abrahamczyk & Michael Kessler 

Received 28 April 2009 

Summary. — Little is known about the distribution, ecology and behaviour 
of hummingbirds in the Andean foothills of Bolivia, where many lowland 
hummingbird species reach their south-western distributional limits. In November 
2007-October 2008, we surveyed hummingbirds at six sites along a 660-km 
transect, from tropical Amazonian humid forest to subtropical spiny forest of 
the Gran Chaco. In total, we found 21 hummingbird species. For ten of these, we 
provide new information on latitudinal and elevational movements, feeding or 
breeding behaviour. In particular, we provide evidence for seasonal movements of 
five species, including such widespread taxa as White-chinned Sapphire Hylocharis 
cyanus and Fork-tailed Woodnymph Thahirania furcata, which are considered 
sedentary throughout most of their ranges, but which appear to undergo seasonal 
movements at their range limits in Bolivia. 

Little is known concerning the distribution, ecology, and behaviour of hummingbirds 
in the Andean foothills of Bolivia, where many lowland hummingbird species reach 
their south-west distributional limits (Schuchmann 1999). Between November 2007 and 
October 2008, SA surveyed hummingbirds at six sites along a 660-km transect from tropical 
Amazonian humid forest to subtropical spiny forest of the Gran Chaco during the rainy 
and dry seasons. From north to south, our study was conducted at Villa Tunari, dpto. 
Cochabamba (16°57'S, 65°24'W; 400 m), Sacta, dpto. Cochabamba (17°06'S, 64°47'W; 204 
m), Buena Vista, dpto. Santa Cruz (17°30'S, 63°38'W; 424 m), Santa Cruz, dpto. Santa 
Cruz (17°46'S, 63°04'W; 397 m), Rio Seco, dpto. Santa Cruz (18°42'S, 63°11'W; 434 m), 
and Corbalan, dpto. Tarija (21°36 , S, 62°27'W; 268 m). Along this transect, mean annual 
precipitation decreases, from 6,258 mm at Villa Tunari to 410 mm at Corbalan, whilst 
seasonality in temperature and precipitation increases (Kessler et al. 2007). The survey 
sites consisted of primary and occasionally slightly disturbed forest. Each locality was 
visited twice for 16 days, once during the dry season (May-October) and once during the 
rainy season (November-April). Hummingbird species, their activity and the plant species 
visited were noted. Additionally, hummingbird observations were made en route to and 
from the study sites. Because hummingbirds are difficult to count, species abundance was 
grouped by three categories: 1-3 per visit (uncommon), 4-9 per visit (common), and >10 per 
visit (very common). Species identifications were made by SA using Erize et al. (2006). 

In total, we found 21 hummingbird species (Table 1). For ten of these, we provide new 
information on latitudinal and elevational movements, feeding or breeding behaviour. 
In particular, we provide evidence for seasonal movements by five species, including 
the widespread White-chinned Sapphire Hylocharis cyanus and Fork-tailed Woodnymph 
Thahirania furcata, which are considered sedentary throughout most of their ranges 
(Schuchmann 1999), but which appear to undergo seasonal movements at their range limits 
in Bolivia. 



Stefan Abrahamczyk & Michael Kessler 



9 



Bull. B.O.C. 2010 130(1) 



TABLE 1 

Hummingbird diversity and abundance of the study sites during the rainy season (R) and dry season (D); 
1 = uncommon, 2 = common, 3 = very common. 



White-bellied Hummingbird Amazilia chinogaster 
Glittering-throated Emerald Amazilia fimbriata 
Black-throated Mango Anthracothorax nigricollis 
Grey-breasted Sabrewing Campylopterus largipennis 
White-bellied Woodstar Chaetocerus mulsantii 
Glittering-bellied Emerald Chlorostilbon aureoventris 
Collared Inca Coeligena toraiiata 
White-necked Jacobin Florisuga mellivora 
Rufous-breasted Hermit Glaucis hirsutus 
Violet-fronted Brilliant Heliodoxa leadbeateri 
Blue-tufted Starthroat Heliomaster furcifer 
Gilded Sapphire Hylocharis chrysura 
White-chinned Sapphire Hylocharis cyanus 
Rufus-crested Coquette Lophornis delattrei 
White-bearded Hermit Phaethomis hispidus 
Great-billed Hermit Phaethomis malaris 
Reddish Hermit Phaethomis ruber 
White-browed Hermit Phaethomis stuarti 
Buff-bellied Hermit Phaethomis subochraceus 
Fork-tailed Woodnymph Thalurania furcata 
Pale-tailed Barthroat Threnetes leucurus 



<A 



u u 



n as 

CO CD 



13 3 1 



3 3 

1 

1 



a B 3 



CO CO CO > > 



2 



1 1 

1 1 

1 

1 1 

3 3 3 2 

1 2 2 2 

1 

1 

3 2 2 2 

2 2 2 2 

2 2 
2 2 3 3 

3 1 3 3 1 3 2 3 

1 



GREY-BREASTED SABREWING Campylopterus largipennis 

C. largipennis was very common at Sacta and Buena Vista during the rainy season in 
November and December 2007, when Heliconia episcopalis (Heliconiaceae), Palicourea 
lasiantha (Rubiaceae) and Erythrochiton fallax (Rutaceae) were flowering en masse, but during 
the dry season in August / September it was not observed at either site. At Villa Tunari, it 
was not recorded in May 2008 but was fairly common in July 2008 when Passiflora coccinea 
(Passifloraceae) was flowering. Similar seasonal shifts in the abundance of C. largipennis 
have been observed in Amacayacu National Park, Colombia, where the species is present 
only during the main flowering period of the common understorey shrub Palicourea crocea 
(Rubiaceae) (Cotton 2007). Apparently, this comparatively large hummingbird conducts 
regional movements and only occurs at a given locality when large numbers of suitable 
flowers are available in the understorey. 

On 18 February 2008, SA observed a single C. largipennis at Rio Seco, c.100 km south of 
the usual south-west range limit (http:/ / www.natureserve.org/infonatura/). This suggests 
that movements might not only be local. 



Stefan Abrahamczyk & Michael Kessler 



10 



Bull. B.O.C. 2010 130(1) 



A nest of C. largipennis was observed at Sacta on 21-24 November 2007. It was located 
in a small tree, c.1.5 m above the ground, in primary tropical rainforest next to a small 
path. It was cup-shaped, constructed of plant fibres, covered with mosses and lichens, and 
contained two white eggs. In Brazil, C. largipennis breeds in June (Schuchmann 1999). Next 
to the nest SA observed Campylopterus drinking water dripping from a hole in a tree in 
flight. 

GLITTERING-BELLIED EMERALD Chlorostilbon aureoventris 

This species showed strong seasonal variation in relative abundance at several localities. 
At Corbalan, it was very rare in January 2008 but very common in late May 2008 when 
it mostly fed on Tripodanthus acutifolius, a hemiparasitic Loranthaceae that was flowering 
in large numbers. At Rio Seco, C. aureoventris was not observed during the rainy season 
(February 2008), but was common during the dry season in June 2008, when Anisacanthus 
boliviensis (Acanthaceae) was flowering. In the city of Santa Cruz, C. aureoventris visited 
some parks during the end of the wet season in April when Chorisia insignis (Malvaceae) 
was blooming in large numbers. Thereafter it was not observed again. 

Breeding of C. aureoventris was observed in Corbalan during the early dry season at the 
end of May 2008. SA found a nest constructed of plant fibres attached to a piece of metal 
under the roof of the research station, c.2 m above ground. The year before, a similar site 
in an adjacent building was used for nesting (pers. comm. of the local ranger). In Brazil, C. 
aureoventris breeds in September-November (Oniki & Antunes 1998). 

COLLARED INCA Coeligena torquata 

SA observed a male feeding on flowers of Calathea sp. (Maranthaceae) at Sacta on 17 
November 2007. C. torquata is a typical Andean species, which normally occurs from 1,500 
m and higher (Schuchmann 1999, Hennessey et al. 2003). During the following night, a front 
of low air pressure arrived from the south, which reduced temperatures by c.lO°C. Possibly, 
the downslope movement of this C. torquata was related to the cold front, as hummingbirds 
are well known to move elevationally in response to adverse weather (Hobson et al. 2003). 

VIOLET-FRONTED BRILLIANT Heliodoxa leadbeateri 

A female was observed on 20 December 2007 feeding on Erythr o chiton fallax (Rutaceae) at 
Buena Vista (424 m). Normally, this species occurs above 800 m in Bolivia (Hennessev et 
al 2003). 

GILDED SAPPHIRE Hylocharis chrysura 

Very common during the late wet and early dry seasons (April-July 2008) in the city and 
Botanical Garden of Santa Cruz. At the end of the dry season (September-October 2008) 
it was not observed in the city and was much less common in the Botanical Garden, even 
though suitable flowers were abundant in city gardens. This is indicative of some regional 
movements, which also are known from Brazil (Schuchmann 1999). In city gardens, H. 
chrysura often fed on Malvaviscus arbor eus (Malvaceae) by laterally piercing the flowers. 

WHITE-CHINNED SAPPHIRE Hylocharis cyanus 

During the dry season in September 2008, this species was observed several times at Sacta, 
feeding on Lantana sp. (Verbenaceae) and Leonotis leonurus (Lamiaceae). During the wet 
season, it was not recorded at Sacta. Additionally, it was seen once during the wet season 
(February 2008) at Rio Seco. These observations suggest that H. cyanus undertakes regional 
movements, which were previously unknown for this species (Hennessev et al. 2003). 



Stefan Abrahamczyk & Michael Kessler 



11 



Bull. B.O.C. 2010 130(1) 



RUFOUS-CRESTED COQUETTE Lophornis delattrei 

A male was seen several times feeding on Lantana sp. (Verbenaceae) at Sacta in September 
2008. This uncommon species otherwise is known in Bolivia only from records above 300 
m elevation (Hennessey et al. 2003). 

WHITE-BROWED HERMIT Phaethornis stuarti 

This little-known species, one of the smallest hermits (Schuchmann 1999), was only found 
at Buena Vista, where no seasonal changes in its abundance were detected. P. stuarti was 
an inconspicuous species that did not vocalise much, often stayed in dense vegetation, and 
usually flew at <1.5 m above the ground. SA observed it feeding on Erythrochiton fallax 
(Rutaceae) and Heliconia subulata (Heliconiaceae) at heights of up to 1.5 m. During the 
dry season it was repeatedly seen taking insects from spider webs. This could be a sign of 
breeding activity, as Poulin et al. (1992) and Cotton (2007) found that breeding periods in 
many hummingbirds are related to peaks in arthropod availability during the dry season. 

BUFF-BELLIED HERMIT Phaethornis subochraceus 

This little-known species of restricted distribution (http://www.natureserve.org/ 
infonatura/) was very common at Buena Vista in December 2007 and September 2008, and 
uncommon in the Botanical Garden in Santa Cruz in April and October 2008. It showed 
no obvious changes in abundance between seasons. P. subochraceus fed on a wide variety 
of plant species, among them Amphilophium crucigerum (Bignoniaceae), Erythrochiton 
fallax (Rutaceae), Heliconia subulata (Heliconiaceae), Juanulloa sp. (Solanaceae), Marsdenia 
sp. (Apocynaceae) and Passiflora coccinea (Passifloraceae). Usually, it perched low in the 
herb and shrub layer, but SA also observed the species feeding on epiphytes in the lower 
canopy, 6 m above ground. During the dry season few flowers were available at Santa 
Cruz, a possible reason for the low density of P. subochraceus at this site. At this season, 
P. subochraceus was observed collecting insects from the vegetation on several occasions. 
Young (1971) reported that Long-billed Hermit P. longirostris is mostly insectivorous during 
the dry season in Costa Rica, and the same might be true for P. subochraceus in Bolivia. 
At Buena Vista, P. subochraceus vocalised both in the dry and rainy seasons, but more 
noticeably in the latter season when two leks of 4-5 individuals each were found. At Santa 
Cruz, P. subochraceus only vocalised during the rainy season, but no leks were observed. 
Although these observations are unsystematic, they suggest that P. subochraceus breeds in 
the wet season. 

FORK-TAILED WOODNYMPH Thalurania furcata 

Probably the most widespread hummingbird species in South America (Schuchmann 1999), 
T. furcata was recorded at all study sites, including Corbalan in dpto. Tarija, from which 
department the species had not previously been reported (Hennessey et al. 2003). Here, it 
showed seasonal changes in abundance, being uncommon in the dry season in May 2008 
but very common during the wet season in January 2008. At this time, Stetsonia coryne, a 
large cactus tree was mass flowering, and T. furcata took nectar by laterally piercing the 
flowers. Interestingly, all individuals observed at Corbalan were in immature or female 
plumage. Possibly this area represents a poor-quality habitat for the species, where due to 
competition only those individuals unable to occupy high-quality habitats occur. Similar 
observations were reported by Erwald & Rohwer (1980) for immatures of both sexes of 
Rufous Hummingbird Selasphorus rufus. 



Stefan Abrahamczyk & Michael Kessler 



12 



Bull. B.O.C. 2010 130(1) 



Acknowledgements 

We thank Yuvinka Gareca, Caroli Hamel, Sebastian K. Herzog, Steffen Reichle, Vanessa Sandoval and 
Julian Q. Vidoz for their support and advice during the field work. Additionally, we are grateful to the 
Botanical Garden in Santa Cruz, the University of Cochabamba, Prometa, the municipal governments of Villa 
Tunari and Ri'o Seco and Robin Clarke Gemuseus for permission to work on their land, and to the National 
Herbarium at La Paz as well as the Direccion General de Biodiversidad for supporting our study. Funding 
was provided by the Konrad-Adenauer-Stiftung and the Deutsche Forschungsgemeinschaft. 

References: 

Cotton, P. A. 2007. Seasonal resource tracking by Amazonian hummingbirds. Ibis 149: 135-142. 
Erize, F., Rodriguez Mata, J. R. & Rumboll, M. 2006. Birds of South America: non-passerines. Princeton Univ. 
Press. 

Ewald, P. W. & Rohwer, S. 1980. Age, coloration and dominance in non-breeding hummingbirds: a test of the 

asymmetry hypothesis. Behav. Ecol. & Sociobiol 7: 273-279. 
Hennessey, A. B., Herzog, S. K. & Sagot, F. 2003. Lista anotada de las aves de Bolivia. Second edn. Asociacion 

Armoma, Santa Cruz de la Sierra. 
Hobson, K. A., Wassenaar, L. L, Mila, B., Lovette, I., Dingle, C. & Smith, T. B. 2003. Stable isotopes as 

indicators of altitudinal distributions and movements in an Ecuadorian hummingbird community. 

Oecologia 136: 302-308. 

Kessler, M., Bohner, J. & Kluge, J. 2007. Modelling tree height to assess climatic conditions in the Bolivian 

Andes. Ecol. Model. 207: 223-233. 
Oniki, Y. & Antunes, A. Z. 1998. On two nests of the Glittering-bellied Emerald Chlorostilbon aureoventris 

(Trochilidae). Om. Neotrop. 9: 71-76. 
Poulin, B., Lefebvre, G. & McNeil, R. 1992. Tropical avian phenology in relation to abundance and exploitation 

of food resources. Ecology 73: 2295-2309. 
Schuchmann, K.-L. 1999. Family Trochilidae (hummingbirds). Pp. 468-680 in del Hoyo, J., Elliott, A. & 

Sargatal, J. (eds.) Handbook of the birds of the world, vol. 5. Lynx Edicions, Barcelona. 
Young, A. M. 1971. Foraging for insects by a tropical hummingbird. Condor 73: 36-45. 

Address: Institute for Systematic Botany, Zollikerstr. 107, 8008 Zurich, Switzerland, e-mails: stefan. 
abrahamczyk@systbot.uzh.ch, michael.kessler@systbot.uzh.ch 



© British Ornithologists' Club 2010 



Thomas M. Donegan & Jorge Enrique Avendano 13 



Bull. B.O.C. 2010 130(1) 



A new subspecies of mountain tanager in the 
Anisognathus lacrymosus complex from the 
Yariguies Mountains of Colombia 

by Thomas M. Donegan & Jorge Enrique Avendano 

Received 7 May 2009 

t Summary. — A new subspecies of Anisognathus lacrymosus is described from 
Serrama de los Yariguies in the East Andes of Colombia. The new taxon differs 
in a combination of plumage characters, including a darker back and crown, 
from the geographically proximate subspecies A.l. tamae, A.l. pallididorsalis and 
A.I. olivaceiceps of the East and Central Andes, as well as, on average, having a 
longer tail than other East Andes populations. The darker plumage of the new 
subspecies resembles that of A.l. intensus of the West Andes (which also occurs 
in more humid habitats), presenting a 'leap-frog' pattern of geographic variation. 
The new subspecies is restricted to paramo and stunted Andean ridgetop habitats, 
apparently being endemic to the Yariguies massif. Analyses of biometrics, plumage 
and voice support species rank for A. (lacrymosus) melanogenys of the Santa Marta 
Mountains, as previously suggested by some authors. Subspecies A.l. melanops, A.l. 
pallididorsalis, A.l. yariguierum and A.l. lacrymosus represent phylogenetic species 
based on plumage, but a greater vocal sample is required to further analyse the 
rank of these and other populations. 

Limits in the Thraupidae (tanagers) have recently been revised (e.g. Burns 1998, Remsen 
et al. 2009) and the family is now considered to be largely restricted to the Neotropics. Many 
species are brightly coloured and relatively easy to observe, factors which have led to the 
group being better studied than many other Neotropical bird families (e.g. Isler & Isler 
1999). 

The mountain tanager genus Anisognathus comprises two well-defined groups that 
have previously been treated in separate genera. 'Core' Anisognathus comprises Lachrymose 
(Lacrimose) Mountain Tanager A. lacrymosus, Scarlet-bellied Mountain Tanager A. igniventris 
and Santa Marta (Black-cheeked) Mountain Tanager A. melanogenys. In Colombia, these 
three species generally occur at higher elevations and in lower forest strata than congeners 
in primary habitats. Blue-winged Mountain Tanager A. somptuosus and Black-chinned 
Mountain Tanager A. notabilis are more robust birds with stronger flight and were 
previously treated as part of the genus Compsocoma (e.g. Hellmayr 1936, Zimmer 1944) but 
were lumped (with little justification) into Anisognathus by Meyer de Schauensee (1966). 
We treat Compsocoma as a subgenus of Anisognathus herein. Anisognathus is restricted to 
montane South America (Isler & Isler 1999) and has been considered related to various other 
montane tanager genera such as Bangsia, Buthraupis, Chlorornis, Dubusia and Delothraupis 
(Burns & Naoki 2004, Bleiweiss 2008). 

Eight subspecies of A. lacrymosus are currently recognised, from Venezuela south to 
Bolivia (Dickinson 2003). These subspecies vary, among other characters, in: the shade of 
yellow-orange on the underparts; the shade of blue-grey on the crown, back, rump and 
flight feathers; facial plumage coloration; and the location, size and shape of yellow 'tear' 
marks on the head. Santa Marta Mountain Tanager A. melanogenys has sometimes been 
treated as conspecific with A. lacrymosus, as discussed further under 'Species limits'. 



Thomas M. Donegan & Jorge Enrique Avendano 14 



Bull. B.O.C. 2010 130(1) 



Here, we describe a new subspecies of A. lacrymosus recently discovered in the Yariguies 
Mountains of Colombia (Donegan et al. 2007) and discuss geographical variation in the 
species in the northern Andes. Species limits and English names herein follow Salaman et 
al. (2009), with alternative names used by Remsen et al. (2009) also mentioned. 

Methods 

Field work. — Between January 2003 and January 2006, we and others studied eight 
primary forest sites at 150-3,200 m on both slopes of Serrarria de los Yariguies, an isolated 
western spur of Colombia's East Andes in dpto. Santander. The Yariguies Mountains are 
isolated from the rest of the East Andes to the north and east by the dry Sogamoso and 
Suarez valleys, and to a lesser extent to the south by depressions associated with the rios 
Horta, Quirola and Opon, and their tributaries, at least above the 2,500 m contour (Donegan 
et al. 2007). 

Study sites were subject to 4-6 days' field work using mist-netting (up co 220 m of mist- 
nets) and observations including sound-recording and playback. The highest-elevation site 
studied on the west slope (Lepipuerto, on the upper no Chimera, El Carmen / Simacota 
municipality, 06°27 / 29 // N, 73°27 / 27 // W; 2,900 m) was accessed by helicopter in January 
2005. Here, TMD mist-netted and photographed two individuals of A. lacn/mosus and 
made various observations and sound-recordings. At another paramo site on the east slope 
of the massif studied six months later (Filo Pamplona, Galan municipality; 06 C 38'18"N, 
73°24 / 32 // W; 3,200 m), we mist-netted 11 individuals, made additional observations, and 
took photographs and blood samples (deposited at Universidad de los Andes). Because 
distribution maps in the major field guides for the region (Hiltv & Brown 1986, Ridgelv 
& Tudor 1989) showed A. lacrymosus to be widespread in Colombia's Eastern Andes, no 
special attention was paid to the species at the time. 

On comparing our photographs with other texts (Fjeldsa & Krabbe 1990, Isler & Isler 
1999) and with specimens, it became apparent that the range of A. lacrymosus in the Eastern 
Andes is less widespread than sometimes stated and that the Yariguies population showed 
plumage differences from all other Colombian populations, revealing an undescribed 
subspecies to be involved (Donegan et al. 2007, 2008). JEA collected specimens of the new 
subspecies at Alto Cantagallos, Finca Santo Domingo, San Vicente de Chucuri municipality, 
dpto. Santander on the west slope of the Yariguies massif (06°48'49"N, 73°21'53"W; 2,450 m) 
on 9-13 November 2006 and at Filo Pamplona (details above) on 20-25 June 2008. In 
addition, we undertook joint field work at San Pedro de los Milagxos, Antioquia, to collate 
additional data on A. I. olivaceiceps in January 2007. JEA also visited the Perija Mountains to 
study A.l. pallididorsalis in July 2008 and TMD visited the Santa Marta Mountains to study 
A. melanogenys in January 2009 (see Appendix 1 for locality details). 

Museum studies. — We or colleagues working with Project Biomap or at the Phelps 
collection (Caracas) examined museum specimens or photographs of specimens of A. 
lacrymosus and A. melauogem/s in the institutions detailed in Appendix 1. We personally 
inspected or obtained photographs of all known East Andes and 'Bogota' or 'Colombia' 
specimens. Soft-part colours and plumage descriptions were taken using codes in 
Munsell Color (1977, 2000) with blue and yellow hues from Smithe (1975). The following 
measurements were taken: wing-chord, tail length (to nearest 1 mm), tarsus length, oilmen 
from skull to tip of upper mandible (to nearest 0.5 mm) and mass (g). Data from unsexed 
or juvenile birds, or those moulting measured feathers were excluded. Biometric data are 
presented in Appendix 2. 

Plumage diagnosis and statistical tests for biometrics. — Subspecies limits were assessed 
following Donegan & Avendano (2008) and Donegan (2008), using the following statistical 
approaches: 



Thomas M. Donegan & Jorge Enrique Avendano 15 



Bull. B.O.C. 2010 130(1) 



LEVEL 1: for biometrics, statistically significant differences at p<0.05 using an unequal 
variance (Welch's) £-test. A Bonferroni correction was applied for biometric data (five 
variables), to produce p<0.01. This test was not applied to assess plumage differences. 
The Level 1 calculation assesses statistical significance, but tolerates considerable overlap. 
Further calculations, described below, were undertaken to measure inter-population 
differences in the context of various species and subspecies concepts. In the formulae 
used below, x 1 and s are the sample mean and sample standard deviation of Population 
1; x and s 2 refer to the same parameters in Population 2; and the t value uses one-sided 
confidence intervals at the percentage specified for the lower degree of freedom of the two 
populations for the relevant variable, with t 1 referring to Population 1 and t 2 referring to 
Population 2. 

LEVEL 2: a '50% / 97.5%' test, following Hubbs & Perlmutter's (1942) now little-used 
subspecies concept, which is passed if sample means are two standard deviations or more 
apart, here defined as the sample mean of Population 1 falling outside the range of 97.5% of 
Population 2, controlling for sample size: 

| (x -x 2 ) | > (s 1 (^ 1@ 97 50/o ) + s 2 (t 2@ 975% ))/2. This test was not applied to assess plumage 
differences. 

LEVEL 3: the traditional '75% / 99%' test for subspecies (Amadon 1949, Patten & Unitt 
2002), modified to control for sample size: 

|(x f J 2 )| > Sl (f 1@99% ) + s 2 (f 2@75% )and 1(1,-3^)1 > ^ 2@99% ) + @75% ) 

For plumage differences, this test was deemed satisfied for populations which are 
distinctive in plumage but which showed intergradation with geographically proximate 
populations. 

LEVEL 4: for biometrics, diagnosability based on recorded values (first part of Isler et 
al.'s 1998 test and essentially equivalent to Cracraft's (1983) phylogenetic species concept). 
For phenotypic differences, Level 4 diagnosability was deemed to be satisfied for assumed 
allopatric populations that showed diagnosable differences based on available samples. 

LEVEL 5: for biometrics, so-called '95% / 95%' diagnosability (i.e. 97.5% / 97.5%, 
given that the lower 2.5% of each population is also outside the range of each population). 
This occurs when sample means are four standard deviations apart, controlling for sample 
size, and is the second part of Isler et al.'s (1998) diagnosability test and also essentially 
equivalent to Cracraft's (1983) phylogenetic species concept: 

|(x r x 2 )| >s i (t 1@975% ) + s 2 (t 2@975% ) 

For determining subspecies rank, Isler et al. (2006, 2007) suggested a 'full diagnosability 
for one character' test to diagnose subspecies of Thamnophilidae (Level 4/5 for at least 
one variable: essentially a phylogenetic species with small differences). The traditional test 
in ornithology for diagnosing subspecies is the Level 3 '99% / 75%' test. Stiles & Caycedo 
(2002) ranked allopatric populations with statistically significant means for different 
variables (Level 1) subspecifically. Where allopatric populations meet Levels 1, 3 and 4/5 
for at least one character (i.e. satisfy all subspecies definitions), we proposed the description 
of new subspecies. Synonymy of subspecies was proposed only if allopatric populations 
failed to achieve any level of diagnosability (i.e. do not pass any subspecific definitions). 
Other putative subspecies are discussed but not described. This approach might produce 
inconsistency, because historically recognised but dubious taxa maintain their status, but 
similarly differentiated undescribed populations continue to lack nomenclatural status. 
However, this approach results in high thresholds for both new taxa and synonymy and 
permits maintenance of current taxonomic treatments for other populations pending 
molecular or other studies. 



Thomas M. Donegan & Jorge Enrique Avendano 16 



Bull. B.O.C. 2010 130(1) 



Vocalisations. — Sound-recordings were made using a Sony MiniDisc and Vivanco 
EM35 microphone, and have been deposited at the British Library (London), Banco de 
Sonidos Animales of Instituto Alexander von Humboldt (Villa de Leyva, Colombia), and 
at www.xeno-canto.org (XC). Due to the small number of recordings available for many 
populations, especially A.l. tamae, only subjective comparisons with vocalisations of other 
Anisognathus taxa were made. 

Distribution modelling. — Data on localities for A. lacrymosus in Colombia were obtained 
from DATAVES, Fundacion ProAves, Instituto Alexander von Humboldt and other sources 
(see Appendix 1). Locality data were geo-referenced for Colombian and Venezuelan 
localities using specimen data, publications in which records are found, data from observers, 
Paynter (1982, 1997) and other sources. All specimen, sound-recording, photographic and 
sight record localities were plotted, and models of potential distribution were constructed 
by J. Velasquez using MAXENT 3.0 (Phillips et at. 2006) based on climate data obtained from 
Worldclim (Hijmans et al. 2005). For most specimen localities, data were only available to 
the nearest minute. Minute accuracy was therefore used as a standard for geo-referencing 
all localities. This is considered a reasonable approach to ensure consistency within the 
dataset and in light of other constraints of such modelling, including the lack of actual (as 
opposed to modelled) climatic data for much of the northern Andes and the Yarigufes range 
in particular. Each species and subspecies was analysed separately, with the exception of 
A.l. olivaceiceps, A.l. palpebrosus and A.l. caerulescens, which are continuously distributed 
and were therefore analysed together. This approach resulted in analyses of the potential 
distributions of certain subspecies being based upon few localities. However, the modelling 
approach used herein is considered good for taxa with 20 or more localities and reasonable 
for taxa with c.5-20 localities (following Pearson et al. 2007). For taxa with fewer localities, the 
analysis is presented subject to caveats. The predicted ranges of each subspecies were then 
converted to presence-absence maps using a 20th percentile training presence threshold, 
which is the probability at which 20% of the training presence records are omitted. This 
threshold, although arbitrary, was chosen to avoid bias by outlying records or records geo- 
referenced inaccurately. Finally, predicted ranges for any subspecies or subspecies-group 
falling outside of regions continuous with known localities were excluded. The model was 
not refined to consider potentially suitable (e.g. non-modified) habitats. 

Description 

The population of Anisognathus lacrymosus occurring in Serrama de los Yarigufes 
is diagnosably distinct in plumage from all other subspecies. A new taxon that is a 
phylogenetic species (Cracraft 1983) or subspecies (Isler et al. 1998), in the sense of the tests 
set out above is clearly involved. We propose that it be named: 

Anisognathus lacrymosus yarignierum subsp. nov. 
Yarigufes Mountain Tanager 

Holotype. — Instituto de Ciencias Naturales, Universidad Nacional, Bogota, Colombia 
(ICN 36902). Adult male collected by Jorge Enrique Avendano on 22 June 2008 (original 
number JEA-650) in paramo at Filo Pamplona above Finca La Aurora, municipality of Galan, 
dpto. Santander, Colombia (coordinates above) on the east slope of the Yarigufes massif, 
just below the main ridgeline. Skeleton with muscle and other soft tissue preserved in 70% 
ethanol deposited at Laboratorio de Biologia Evolutiva de Vertebrados, Universidad de 
los Andes. Tissue samples have been deposited at the Banco de Tejidos of Universidad de 
los Andes (UniAndes-BT 700) and Banco de Tejidos of Instituto Alexander von Humboldt, 
Palmira, Colombia (IAVH-BT). The holotype is shown in Figs. l(i), 2(iv) and 3(i). 



Thomas M. Donegan & Jorge Enrique Avendano 17 



Bull. B.O.C. 2010 130(1) 



Allotype and paratypes. — The type series is shown in Fig. 3. All were collected by 
Jorge Enrique Avendano. The first is designated as an allotype, the others as paratypes. 
ICN 36903 / UniAndes-BT 701: (allotype) adult female captured at the type locality with 
the holotype and probably its mate (skull 100% ossified, follicular ovary 7.7 x 3.5 mm with 
largest follicle 0.5 mm, some subcutaneous fat in neck, furculum and flanks, 37 g, wing, tail 
and body moult); previously captured on 13 July 2005 at 13.30 h, and banded with ProAves 
ring no. C02784 (still on the specimen's leg). ICN 36911 / UniAndes-BT 702: immature male 
collected at the type locality on 23 June 2008 (skull ossification <50%, both testes yellowish, 
left testis 2.4 x 1.5, right testis 2.0 x 1.3, abundant subcutaneous fat in throat, neck, furculum, 
breast and dorsal regions, 38 g, wing and tail moult). ICN 36918 / UniAndes-BT 703: 
immature male collected at the type locality on 25 June 2008 (skull 30% ossified, left testis 
yellowish 1.7 x 1.5, right testis blackish 2.0 x 1.5, some subcutaneous fat in neck, furculum, 
flanks and back, 37 g, wing, tail and body moult). ICN 36920 / UniAndes-BT 704: juvenile 
female collected at the type locality on 26 June 2008 (skull 0% ossified, smooth ovary 3.0 x 
2.7, abundant subcutaneous fat in throat, furculum and flanks, 32 g, negligible body moult). 
ICN 36176 / UniAndes-BT 546: adult female collected at Alto Cantagallos, San Vicente de 
Chucuri municipality on the west slope of Serrama de los Yarigufes (coordinates above) on 
13 November 2006 (skull 50% ossified, follicular ovary 6.2 x 3.2 with largest follicle 1.7 mm, 
some subcutaneous fat in neck and furculum, 35 g, wing and body moult). Tissue samples 
of the allotype and paratypes have also been deposited at IAVH-BT. 

Diagnosis. — AX. yariguierum is clearly a member of the genus Anisognathus and the A. 
lacrymosus species-group on the basis of its plumage (e.g. Fig. 2), vocalisations (e.g. Figs. 
5-6) and biometrics. It differs from AX. tamae of the East Andes, AX. pallididorsalis of the 
Perija Mountains and AX. olivaceiceps of the northern Central Andes in its darker and bluer 
crown, darker mantle, darker blue rump and shoulder, and darker face with less strong 
yellowish tones. It differs further from AX. tamae and AX. pallididorsalis in its darker tail and 
less extensive blue markings on the rectrices. The new subspecies differs from AX. melanops 
of the Venezuelan Andes in having darker upperparts. The head and mantle of the new 
subspecies are closer to AX. intensus, which occurs in the southern West Andes of Colombia. 
However, AX. yariguierum differs from the latter subspecies in its more bluish crown, face, 
nape and mantle. Compared to AX. palpebrosus of Ecuador and southernmost Colombia, 
and the southern races AX. caerulescens and AX. lacrymosus, it has a bluer crown, darker 
back, darker blue rump, darker yellow underparts, and darker blue primary remiges. It 
can be separated from A. melanogenys by the presence of a yellow 'tear' on the nape, the 
darker blue crown and blue (not greenish) back, tail and wing, and shorter bill. It lacks the 
red underparts of Scarlet-bellied Mountain Tanager A. igniventris and has less extensive 
black feathering on the upper breast. Members of the subgenus Compsocoma do not closely 
resemble AX. yariguierum. 

Description of the holotype. — Crown dark bluish (73, Indigo). Sides of head and 
moustachial region dark, with faint yellowish tinge (5YR 2.5/2). Elongated, tear-shaped 
spots below eye and below and behind ear-coverts dark yellow (18, Orange Yellow). Mantle 
dark grey with hint of blue (Gley 2, 3/5 PB but bluish). Rump and shoulder feathers tipped 
blue (between 70, Smalt Blue and 71, Campanula) with unexposed dusky bases resulting in 
overall blue coloration over this region. Tail dusky (10YR 2/1) with outer remiges faintly 
tipped blue (as flight feathers). Outer remiges of alula and all wing-coverts tipped blue (as 
rump) otherwise dusky (10YR 2/1). Primaries, secondaries and tertials dusky (10YR 2/1) 
with outer remiges, except the outermost primary, tipped light blue (66, Sky Blue, slightly 
darker on tertials). Underparts orange-yellow (closest to 18, Orange Yellow, but darker), 
feathers being dusky (10YR 2/1) at base, with darker feathering exposed only slightly on 



Thomas M. Donegan & Jorge Enrique Avendano 18 



Bull. B.O.C. 2010 130(1) 




Thomas M. Donegan & Jorge Enrique Avendano 19 



Bull. B.O.C. 2010 130(1) 



flanks and tibia. Irides dark brown, bill black, tarsi, feet and nails black-brown, soles dark 
ochre. Flattened wing (after collection) 92.2 mm, tail 77.3 mm, tarsus 26.0 mm, culmen to 
skull 16.4 mm, bill depth (at nostrils) 6.2 mm, bill width (rictus) 11.6, mass 35 g. Fairly 
extensive subcutaneous fat in dorsal, furculum and neck regions. Body moult restricted to a 
few feathers in crown, nape, throat, breast, belly and uppertail-coverts, wing moult broadly 
symmetrical with emergent ninth and eighth primaries on both wings, second to fourth and 
sixth secondaries on left wing and third, fourth and seventh secondaries on right wing. Tail 
moult also broadly symmetrical with emergent second and fourth rectrices from outermost 
on the left side and third and fourth rectrices on the right side. Stomach contents included 
digested plant material and seeds. Skull 100% ossified. Left testis: 5.0 x 2.5 mm; right testis 
4.4 x 2.2 mm. 

Variation. — All specimens are essentially identical to the holotype with the following 
exceptions. Compared to the other specimens, ICN 36920 (a juvenile female) is dorsally 
duller and more yellowish ventrally. ICN 36176 has more orange underparts compared to 
the rest (midway between 17, Spectrum Orange and 18, Orange Yellow), resembling A.l. 
intensus even more closely (Fig. 3). Differences between this specimen and the rest of the 
type series are more notable in photographs than when compared visually. The variation 
in underparts coloration could represent either individual or geographical variation within 
A.l. yariguierum. The darker breasted specimen was taken 23 km north of the type locality. 
Birds photographed and released from the southernmost site (Lepipuerto), which like 
the darker bird were collected on a west-facing slope, are similar in plumage (including 
underparts coloration) to Filo Pamplona specimens. A juvenile mist-netted and released at 
Filo Pamplona had a yellowish gape. See Appendix 2 for variation in biometrics. 

Distribution. — Fig. 4 shows the localities at which A.l. yariguierum has been recorded 
and the range of A. lacrymosus in the northern Andes. A.l. yariguierum has been found to 
date only in Serrama de los Yarigmes, where it is confined to the highest-elevation paramos 
and subpdramos. Paramo habitats of the Yarigmes Mountains have no connectivity with such 
habitats elsewhere in the East Andes (Fig. 4) . Other recently described taxa including Scytalopus 
griseicollis gilesi (Donegan & Avendano 2008), Grallaricula nana hallsi (Donegan 2008) and the 
butterfly ldioneurula donegani (Huertas & Arias 2007) are also apparently endemic to such 

Legends to figures on opposite page 

Figure. 1 (top). From left to right and top to bottom (i) Holotype of Anisognathus lacrymosus yariguierum (J. 
E. Avendano); (ii) A.l. tamae, Alto Pesebre, Tama National Park, Herran, Norte de Santander, East Andes, 
Colombia (A. M. Cuervo); (iii) A.l. pallididorsalis, vereda Sabana Rubia, Manaure, Cesar, Perija, Colombia (J. 
E. Avendano); (iv) A.l. melanops, Dinira National Park, Lara, Merida, Venezuela (J. E. Miranda T.); (v) A.l. 
olivaceiceps, vereda La Lana, San Pedro de los Milagros, Antioquia, Central Andes, Colombia (T. M. Donegan 
/ B. Huertas / J. E. Avendano); (vi) A.l. olivaceiceps, West Andes population, Reserva Natural de Aves Colibri 
del Sol, Urrao, Antioquia (A. Quevedo / ProAves); (vii) A.l. palpebrosus, Reservas de Aves Comunitarias, 
Roncesvalles, Tolima (A. Quevedo /ProAves); (viii) A.l intensus, Munchique National Park, El Tambo, 
Cauca, West Andes, Colombia (Juan Pablo Lopez); (ix) A. melanogenys, Reserva Natural de Aves El Dorado, 
Santa Marta, Magdalena, Colombia (C. Olicaregui / ProAves) 

Figure 2 (lower left). Colombian subspecies of A. lacrymosus, from left to right: (i) A.l palpebrosus ICN 2816 
(La Cocha, Nariho, southern Colombian Andes, collected 2 February 1950 by J. I. Borrero); (ii) A.l. intensus 
ICN 25790 (Farallones de Cali (Alto Pato), Valle del Cauca, Western Andes, collected 29 July 1980 by H. 
Romero-Z et al), (iii) A.l. olivaceiceps ICN 35001 (Alto Ventanas, Jardin, Antioquia, Central Andes, collected 
25 February 2004 by G. Suarez), (iv) A.l yariguierum ICN 36902 (holotype), (v) A.l. tamae ICN 18191 (Paramo 
de Tama, Toledo, Norte de Santander, Eastern Andes, collected 15 August 1968 by P. Bernal) and (vi) A.l 
pallididorsalis ICN 36781 (vereda El Cinco, Manaure, Cesar, Perija, collected 12 July 2008 by J. E. Avendano) 
(J. E. Avendano) 

Figure 3 (lower right). Ventral and dorsal views of the A.l. yariguierum type series. From left to right: (i) ICN 
36902 (holotype), (ii) ICN 36918 (paratype); (iii) ICN 36903 (allotype); (iv) ICN 36911 (paratype); (v) ICN 
36920 (paratype); (vi) ICN 36176 (paratype) (T. M. Donegan) 



Thomas M Donegan & Jorge Enrique Avendano 20 



Bull. B.O.C. 2010 130(1) 



habitats in Yarigmes, 
and possess essentially 
identical distributions 
to A.l. yariguierum (see 
maps in references cited 
above). 

Our own rainfall 
readings taken in the field 
and data in Worldclim 
(Hijmans et ah 2005) 
reveal higher levels of 
precipitation for sites 
where A.l. yariguierum is 
predicted to be present in 
Serrarua de los Yarigmes 
than the average for sites 
of similar elevation in 
the East Andes (mean 
1,400 vs. 1,900 mm/p.a.: 
Donegan & Avendano 
2008). 

Geographically 
proximate A.l. tamae is 
found elsewhere in the 
East Andes but is rare 
in collections, with few 
recent observations and 
is little known in life. 
Its absence from many 
localities in the East 
Andes and the small 
number of specimens 
and recent observations 



Species 

a Records 
HH A. I. 3 ssp. 
1 1 A. I. intensus 
I 1 A. I. melanops 
| A. I. pallididorsalis 
| A. I. tamae 
A. I. yariguierum 
i A. melanogenys 




Figure 4. Potential distribution map showing records and modelled 
potential distribution of A. lacrymosus subspecies and A. melanogenys in the 
Colombian Andes. 



are surprising given 
that A.l. olivaceiceps / 

palpebrosus of the Central Andes is so widespread and common. 

Elsewhere in Colombia, A. lacrymosus is also found in paramos, in shrubby, voung 
regrowth in montane forest and at forest borders at lower elevations. A. somptuosus occurs 
in Serrama de los Yarigmes and elsewhere throughout the Colombian Andes at lower 
elevations in montane and premontane forest. In the Central Andes, A. somptuosus and A. 
lacrymosus are sympatric in secondary forest, but appear to segregate according to habitat 
use, with the former found more frequently in higher forest strata and the latter generally 
in lower forest strata or in stunted vegetation. Both species occur at forest borders. 

Vocalisations. — Several sound-recordings were made at Lepipuerto (e.g. Figs. 5A, 
5B, 5F, 6A, 6B). These have been deposited at the British Library, London, and Instituto 
Alexander von Humboldt in Colombia and at www.xeno-canto.org nos. XC3729 1-37303 
and XC37310. A. lacrymosus taxa possess a varied repertoire of calls and songs. Unlike 
suboscines (e.g. Kroodsma 1984), oscine vocalisations are not innate and may have a 
learned component (i.e. they might be affected by environmental factors). As a result, 



Thomas M. Donegan & Jorge Enrique Avendano 21 



Bull. B.O.C. 2010 130(1) 



Figure 5 (top). Sonograms of songs of (A) A.l. 
yariguierum, Lepipuerto, Serrama de los Yarigmes (T. 
M. Donegan: XC 37295), with calls below c.7.5 kHz 
of Golden-fronted Whitestart Myioborus ornatus; (B) 
As previous (XC 37291); (C) A.l. palpebrosus, Neira, 
La Cristalina, upper no Tapias, Caldas (A. M. Lopez 
in Alvarez et al. 2007), with calls below 8 kHz of 
Myioborus ornatus; (D) A.l. caerulescens, Tapichalaca, 
Zamora-Chinchipe, Ecuador (N. Krabbe in Krabbe 
& Nilsson 2003), with calls below 6 kHz probably 
of Yellow-breasted Brush Finch Atlapetes latinuchus. 
Sonograms of: (E) A.l. olivaceiceps contact call, 
Antioquia, Colombia (Alvarez et al. 2007); (F) A.l. 
yariguierum contact call, Lepipuerto, Serrama de 
los Yarigmes (T. M. Donegan XC 37310); (G) A.l. 
caerulescens dawn song, Cajanuma, Loja, Ecuador 
(P. Coopmans in Krabbe et al. 2001); (H) A.l. 
palpebrosus, Pasto, Narino, Colombia (O. Laverde: 
XC 17800); (I) A. melanogenys flight call, then call, 
Reserva Natural de Aves El Dorado, Magdalena, 
Colombia (T. M. Donegan: XC 37290). 

Figure 6 (bottom). Sonograms of calls of (A) A.l. 
yariguierum, Lepipuerto, Serrama de los Yarigmes, 
Santander, Colombia (T. M. Donegan: XC 37298); 
(B) As previous (XC 37299); (C) A.l. melanops, 
Guaracamal National Park, Trujillo, Merida, 
Venezuela (Boesman 1999); (D) A.l. pallididorsalis, El 
Cinco, Manaure, Cesar, Colombia (J. E. Avendano); 
(E) A.l. palpebrosus, rio Blanco, Manizales, Caldas (M. 
Alvarez in Alvarez et al. 2007); (F) A. melanogenys, 
Reserva Natural de Aves El Dorado, Magdalena, 
Colombia (Krabbe 2008a). 



voice has been little-used to assess species 
limits in oscines, and tanagers in particular, 
although there are some recent studies (see 
e.g. Cadena et al. 2007) and vocalisations 
must possess some innate component as 
otherwise species would not have different 
voices. Anisognathus lacrymosas, like many 
oscines, has a variable repertoire (Figs. 
4-5). 



A 


hi 








■ 


y 


41 ' i j ! 




11 


1 








A 


,B 






: ! ( 

* 

.c 1 


D 




1 

IE 


i i • / 1» " 

F 





The song of A.l. yariguierum consists of a 2-8 seconds-long, rapidly delivered series 
of sharp, high-pitched notes, upstrokes and up-down strokes, at c. 7.5-10.5 kHz (Figs. 
5A-5B). Similar songs are given by A.l. olivaceiceps, A.l. palpebrosus and possibly some other 
subspecies (Fig. 5). A.l. yariguierum appears to show more deep downstrokes within phrases 
than that shown on recordings of some other taxa. It is unknown whether differences in 
note shape reflect individual or geographical variation. 

The calls of A.l. yariguierum (Figs. 6A-6B) comprise a series of repeated high-pitched, 
short whistles snip with long gaps between them. Each whistle appears on the sonogram 
as a short, rising, broken, upstroke at c.5-11 kHz and is c.0. 1-0.2 seconds-long. Calls are 
repeated at irregular intervals and vary in note shape. Similar calls of A.l. palpebrosus (Fig. 
6E) appear less broken in note shape, whilst available recordings of this call in A.l. melanops 
(Fig. 6C) and A.l. pallididorsalis (Fig. 6D) show variations in note shape (e.g. suip-iu in A.l. 
melanops). 



Thomas M. Donegan & Jorge Enrique Avendano 22 



Bull. B.O.C. 2010 L30| 1 ) 



We also recorded a contact call of .4./. yariguierum (Fig. 5F), consisting of a soft single 
note of at c.8-9 kHz, similar to a recorded call of A.l. oliraceiceps (Fig. 5E). 

Intriguinglv, songs of several subspecies of A. lacrymosus (including A.l. yariguierum) 
are delivered simultaneously with the song of nearbv individuals of Golden-fronted 
Whitestart Myioborus ornatus, Atlapetes brush finches and other species that use lower 
acoustic frequencies (Figs. 5 A, 5C, 5D). 

Biometrics. — A.l. yariguierum is not diagnosable beyond Level 2 in biometrics from any 
.4. lacrymosus taxa, with overlap noted for all variables (Appendix 2). However, based on 
specimen data, the new subspecies has, on average, a longer tail compared to ,4./. melanops 
(Levels 1 and 2), A.l. tamae (Level 1), .4./. caerulescens (Levels 1 and 2) and .4./. lacrymosus 
(Levels 1 and 2). Based on data from live birds, it further appears to have an on average 
shorter tail than A.l. oliraceiceps (Level 1) and .4./. palpeborus (Levels 1 and 2). The other 
Colombian populations (.4./. pallididorsalis and .4./. intensus) also showed small differences 
in tail length from A.l. yariguierum, but did not meet the requirements of our Level 1 test 
based on specimen data (0.01<p<0.05 in each instance) and no data from live birds were 
available. ,4./. yariguierum mav also have, on average, a longer tarsus than ,4./. pallididorsalis 
(specimen data: Levels 1 and 2) and ,4./. palepbrosus (data from live birds: Level 1) and a 
longer culmen compared to .4./. tamae (specimen data: Level 2), .4./. pallididorsalis (specimen 
data: Levels 1 and 2), .4./. olivaceiceps (data from live birds: Level 1) and .4./. palpebrosus (data 
from live birds: Level 1), although observed differences in these two measurements are verv 
small. 

Ecology. — .4./. yariguierum has been recorded onlv in pristine primary paramo and 
ridgetop habitats 2-30 km from settlements. Such sites are subject to very high levels of 
precipitation, with torrential rain lasting several hours each day of field work and frequent 
ground-level cloud cover. The new taxon is absent from taller montane or other forest at 
lower elevations. Birds are often quite visible. In July 2008 and June 2005, small flocks were 
observed and individuals with gape lines mist-netted. In contrast, onlv pairs were seen in 
January 2005. Such behaviour is consistent with nesting in March-April, as is apparently 
the case for various other species in the Yariguies region. Ossification and gape line data 
indicate that adult plumage is attained verv rapidly. Xo specimens of any A. lacrymosus 
races with distinct juvenile or immature plumages were found in collections. We observed 
A.l. yariguierum following mixed-species flocks of Streaked Tuftedcheek Psendocolaptes 
boissonneautii, Golden-fronted Whitestart Myioborus ornatus, Golden-crowned Tanager 
Tridosornis ruftvertex and Common Bush Tanager Chlorospingus ophthalmicus. A. lacrymosus 
was also observed joining flocks at forest borders in San Pedro de los Milagros (Antioquia: 
olivaceiceps), Manaure (Cesar: pallididorsalis) and Surata (Santander: tamae). 

Conservation. — ,4./. i/ariguierum is endemic to the Colombian East Andes EBA (038: 
Stattersfield et al. 1998). It qualifies for IUCN Category D2 Vulnerable status due to its Area 
of Occupancy being less than 100 knr and being known from fewer than five localities. The 
new subspecies is rather common in paramo and ridgetop habitat. Following our work and 
with the impetus of the Ministerio de Medio Ambiente, Corporacion Autonoma Regional 
de Santander (CAS), various mayoralties of the region and NGOs, the Serrania de los 
Yariguies National Park was declared in May 2005. The protected area covers all paramo 
habitats of the range and should assist in conserving A.l. yariguierum and other threatened 
species (see Donegan & Huertas 2005, Huertas & Donegan 2006). This description does not 
affect the current IUCN status of A. lacrymosus as Low Risk. 

Etymology. — The subspecific name, yariguierum, to be treated as a noun declined in 
the genitive plural, which need not agree in gender with the generic name in combination 
under Art. 31.2.2 of the International Code of Zoological Nomenclature (ICZN 1999). The 



Thomas M. Donegan & Jorge Enrique Avendano 23 



Bull. B.O.C. 2010 130(1) 



name honours the extinct Yarigmes indigenous people and the massif that bears their name, 
to which A.l. yarigiiierum is apparently restricted. Further details are given in Donegan & 
Huertas (2006). 

Use of genus name Anisognathus. — Three genus names for birds in what is currently 
known as Anisognathus were described between the years 1850 and 1852: Anisognathus 
Reichenbach, 1850 / 52; Compsocoma Cabanis, 1850 / 51 and Poecilothraupis Cabanis, 1850 
/ 51. The date of publication of these names and priority appears not have been subject to 
detailed study. Use of the generic name Anisognathus herein follows prevailing treatments 
in modern Neotropical ornithological publications. 

■ Geographic variation in Anisognathus lacrymosus. — A. lacrymosus includes a number 
of morphologically different populations found throughout the tropical Andes. It has 
relatively poor flight for a tanager, making the group excellently suited to studies of 
speciation and biogeography. However, few authors since Zimmer (1944) have studied 
geographical variation in the species. Graves (1985) categorised A. lacrymosus as exhibiting 
'smooth dinar variation, which is an over-simplification and appears true only of some 
populations. In contrast, Krabbe et al. (2006) discussed the intriguing presence of two rather 
different subspecies (A.l. olivaceiceps and A.l. intensus) in the West Andes of Colombia: 
There is indirect evidence that colonisation of the Western Andes in some cases happened 
by jump dispersal across the Cauca Valley rather than through continuous suitable habitat. 
One form of Lacrimose Mountain-Tanager (Anisognathus lacrymosus olivaceiceps) occurs in 
the north ends of both Cordilleras, whereas the form palpebrosus is found further south in 
the Central Andes and the form intensus further south in the Western Andes (to which it is 
endemic).' Field work within the apparent distribution 'gap' between Risaralda and Valle 
in the West Andes is needed to consider further the nature of geographic variation in the 
West Andes. 

Graves (1985), Zimmer (1944) and Ridgely & Greenfield (2001) all describe clinal 
variation in A. lacrymosus from northern Peru through Ecuador to the Central Andes of 
Colombia. Three subspecies occur in this region, from north to south: olivaceiceps (type 
locality: Santa Elena, Antioquia, Colombia), palpebrosus (type locality: Pasto, Narino, 
Colombia) and caerulescens (type locality: Cutervo, Cajamarca, Peru). Our museum work 
leads us to conclude that A.l. olivaceiceps could be recognised under subspecies concepts 
that permit intergradation or admit taxa that are not wholly diagnosable (e.g. Amadon 1949, 
Patten & Unitt 2002). Specimens from both the West Andes and Central Andes of Antioquia 
are consistent in plumage, having a greyer face and paler mantle than specimens from 
further south. There is a region of intergradation between this subspecies and birds treated 
as A.l. palpebrosus in Tolima (e.g. Fig. lv), which themselves differ in plumage saturation 
from Narino specimens. The proposition that A.l. caerulescens represents a valid subspecies 
with respect to A.l. palpebrosus under subspecies concepts based on any of our Levels 2 to 5, 
is not supported. However, our Level 1 test was passed as between populations north and 
south of the southern Tungurahua border in Ecuador (c.01°30'S) for tail length based on 
specimens, and a region of less suitable habitat was predicted in this region by distribution 
modelling, so we do not formally propose synonymy. There are plumage differences 
between individuals from the two type localities, but Zimmer (1944) described in detail a 
gradual shift in a number of these plumage features between these localities, describing it as 
'perfect intergradation'. Only one of these three subspecies (palpebrosus being senior) would 
be recognised under subspecies concepts based on full diagnosability (e.g. Zink 2003). 

In contrast, the northern races A.l. pallididorsalis (Perija), A.l melanops (Merida) and 
A.l. yariguierum (Yarigmes), as well as the southernmost A.l. lacrymosus (Peru, south of the 
Maranon Valley) have allopatric distributions with respect to other A. lacrymosus taxa and 



Thomas M. Donegan & Jorge Enrique Avendaho 24 



Bull. B.O.C. 2010 130(1) 



are diagnosable in plumage from other populations. Thev all represent phvlogenetic species 
(Cracraft 1983) and meet all subspecies definitions considered here. The sole A.l. melanops 
recording available has a higher frequency than equivalent calls in other subspecies (Fig. 
6C) and shows small differences in note shape from other recordings of northern races (Figs. 
5-6). A.l. pallididorsalis further shows differences up to Level 2 in bill length from all other 
races except A.l. tamae and .4. /. lacrymosus. Some of these populations or groups thereof 
might be considered candidates for species rank under some species concepts. However, a 
thorough vocal study (and greater vocal sample) is needed to consider species limits further. 
The taxon to which East Andes populations have been assigned, A.l. tamae, is unknown 
vocally but darker individuals within this subspecies are virtually ^distinguishable from 
paler individuals of .4./. olivaceiceps. The generally greater differentiation in plumage (and, 
apparently, voice) in the north of the species' range and presence of A. melanogenys in the 
Santa Marta Mountains is notable and mav inform hypotheses concerning the group's 
radiation. 

The darker plumage shared by A.l. yariguierum of the East Andes (Yariguies) and A.l. 
intensus of the West Andes, compared to the paler plumage shared bv A.l. tamae of the East 
Andes and A.l. olivaceiceps of the Central Andes are intriguing examples of a 'leap-frog 7 
pattern in geographic variation (Remsen 1984). As the Yariguies Mountains and West Andes 
share higher levels of precipitation than nearby regions where paler subspecies are found, 
darker plumage might be a convergent adaptation, conforming to Gloger's Rule (Zink & 
Remsen 1986). Other possible processes not tested here could explain the pattern observed 
(e.g. common ancestry) although it would be surprising if A.l. intensus and A.L yariguierum 
were sister populations given that various other .4. lacrymosus taxa have geographically 
more proximate distributions. 

Species limits. — A. melanogenys has been treated as a subspecies of A. lacrymosus bv 
some authors (e.g. Hellmayr 1936, Zimmer 1944, Storer 1970, Isler & Isler 1999) or as part of 
a superspecies together with .4. lacrymosus (Sibley & Monroe 1990). Our analyses support 
mamtaining species rank for .4. melanogenys (following, e.g., Meyer de Schauensee 1964, 
1966, Hilty & Brown 1986, Fjeldsa & Krabbe 1990, Ridgely & Tudor 1994, 2009, Dickinson 
2003, Restall et al. 2006, Remsen et at 2009, Salaman et ah 2009). A. melanogenys has a longer 
bill than .4. lacrymosus, with a different, more elongated shape (Fig. 1). This measurement 
is diagnosable to Level 5 from proximate populations, A.l. melanops, A.l. pallididorsalis and 
A.l. tamae (and A.l. lacrymosus), and to Level 2 from other races of A. lacrymosus. The tarsus 
length of A. melanogenys is also diagnosable up to Level 3 from geographically proximate 
.4./. pallididorsalis. In contrast, there are no differences bevond Level 2 for any measurements 
among current A. lacrymosus subspecies. In plumage, the combination of a cerulean blue 
crown and absence of a yellow nuchal 'tear' in A. melanogenys involves differences in both 
pattern and coloration from all A. lacrymosus taxa. A. melanogenys further lacks strong blue 
feathering on its rump and has paler yellow underparts, and greener-blue upperparts and 
remiges compared to A. lacrymosus (Fig. 1). A. melanogenys calls have a consistently different 
note shape compared to A. lacrymosus populations, being delivered faster and appearing as 
virtually a straight line (as opposed to an upstroke or up-down stroke) on sonograms (Figs. 
51, 6F). The Santa Marta Mountains are isolated geographically from the Andes and harbour 
a number of endemic high-elevation birds considered specifically distinct from populations 
in the Andes (e.g. Krabbe 2008b), of which A. melanogenys appears to be an example. In 
contrast, although various allopatric A. lacrymosus taxa constitute phvlogenetic species 
(based on plumage), none are known to occur in sympatry and morphological differences 
between populations do not approach the differentiation shown between A. melanogenys 
and other taxa. As a result, we recommend maintaining species rank for A. melanogenys and 
A. lacrymosus, with no further splits for now, under the Biological Species Concept. 



Thomas M. Donegan & Jorge Enrique Avendano 25 



Bull. B.O.C. 2010 130(1) 



Acknowledgements 

We thank the rest of the EBA Project and YARE Project teams, especially Blanca Huertas and also Elkin 
Briceno, John Arias, Martin Donegan, Cristobal Rios, Laura Rosado and Diana Villanueva, and local 
guides Jose Pinto, Alonso Masias and Hernando Figueroa. Hernando Guevara (Corporation Autonoma 
Regional para la Defensa de la Meseta de Bucaramanga-CDMB), Alvaro Prada Prada, Armando Rodriguez 
and Hector Lamo (CAS), and the mayors of San Vicente de Chucurf, Galan and El Carmen provided the 
necessary permissions for field work (CAS resolution no. 832). Paul Sweet and Peg Hart (AMNH), Robert 
Prys-Jones, Mark Adams and Douglas Russell (BMNH), Enrique Castillo and Fernando Forero (IAVH), 
Jose Gregorio Moreno Patino (UIS), Roque Casallas and Arturo Rodriguez (MLS), F. Gary Stiles (ICN), J. F. 
Voisin & C. Voisin (MNHN), Oscar Murillo (MHNUV), Gladys Reinoso Florez, Yair Molina and Mauricio 
Vejarano (CZUT) and Maria del Pilar Rivas and Fernando Ayerbe (MHNUC) facilitated access to specimens. 
Sylke Frahnert (ZMB), Stephen Rogers (CM), Mary Hennen (FMNH), Nathan Rice (ANSP), Paul Sweet 
and, Peg Hart (AMNH) and James Dean (USNM) provided photographs of specimens. Thanks to Biomap 
Project (especially Juan Carlos Verhelst, Paul Salaman and Andrea Morales) and ProAves (David Caro and 
Lina Marcela Enriquez) for data and to all of the photographers, recordists and observers mentioned in 
Appendix 1. Expeditions to Serrama de los Yariguies received generous financial support from the Royal 
Geographical Society (with Rio Tinto pic), Duke of Edinburgh, Fondo para Action Ambiental, Fundacion 
Omacha, Conservation International Colombia (Becas Iniciativa de Especies Amenazadas — Jorge Ignacio 
"El Mono" Hernandez-Camacho), the Percy Sladen Memorial Fund (Linnean Society) and Fundacion 
ProAves. The YARE Project was supported by the BP Conservation Programme (BirdLife International, 
Conservation International, Flora & Fauna International, Wildlife Conservation Society), Game Conservancy 
Trust, Fundacion ProAves, World Pheasant Association, Universidad Industrial de Santander, Universidad 
de Caldas, Universidad de Tolima, and Gobernacion de Santander. We thank Nate Rice, Robert Bleiweiss 
and Raul Sedano for comments on the manuscript. A Robert Giles scholarship from Fundacion ProAves, 
Beca Proyecto Semilla of Universidad de los Andes and Fondo Colombia Biodiversa of Fundacion Alejandro 
Angel Escobar supported JEA's field work as part of his graduate studies, and Idea Wild and The Explorers 
Club's Exploration Fund assisted with equipment and financial support. Fundacion ProAves supported 
TMD's work in Santa Marta. 

References: 

Alvarez, M., Caro, V., Laverde, O. & Cuervo, A. M. 2007. Gm'a sonora de los Andes colombianos. CDs. Instituto 
Alexander von Humboldt, Bogota & Cornell Lab. of Ornithology, Ithaca, NY. 

Alvarez R., M. & Cordoba C, S. 2002. Guia sonora de las aves del departamento de Caldas, cuencas de los rios Tapias 
y Tareas. Instituto de Investigation de Recursos Biologicos Alexander von Humboldt, Villa de Leyva. 

Amadon, D. 1949. The seventy-five per cent rule for subspecies. Condor 51: 250-258. 

Bleiweiss, R. 2008. Phenotypic integration expressed by carotenoid-bearing plumages of tanager-finches 
Thraupini, Emberizinae) across the avian visible spectrum. Biol. J. Linn. Soc. 93: 89-109. 

Boesman, P. 1999. Birds of Venezuela: photographs, sounds and distributions. CD-ROM. Bird Songs International, 
Westernieland. 

Burns, K. J. 1998. Molecular phylogenetics of the genus Piranga: implications for biogeography and the 

evolution of morphology and behavior. Auk 115: 621-634. 
Burns, K. J. & Naoki, K. 2004 Molecular phylogenetics and biogeography of Neotropical tanagers in the 

genus Tangara. Mol. Phyl. & Evol. 32: 838-854. 
Cadena, C. D., Cordoba C, S., Londono, G. A., Calderon-F., D., Martin, T. E. & Baptiste, M. P. 2007. Nesting 

and singing behavior of Common Bush-Tanagers (Chlorospingus ophthalmicus) in South America. Orn. 

Colombiana 5: 54-63. 

Cracraft, J. 1983. Species concepts and speciation analysis. Current Orn. 1: 159-187. 

Dickinson, E. C. (ed.) 2003. The Howard & Moore complete checklist of the birds of the world. Christopher Helm, 
London. 

Donegan, T. M. 2008. Geographical variation in Slate-crowned Antpitta Grallaricula nana, with two new 

subspecies from Colombia and Venezuela. Bull. Brit. Orn. CI. 128: 150-178. 
Donegan, T. M. & Avendano, J. E. 2008. Notes on tapaculos (Passeriformes: Rhinocryptidae) of the Eastern 

Andes of Colombia and Venezuelan Andes, with a new subspecies of Scytalopus griseicollis from 

Colombia. Orn. Colombiana 6: 24-65. 
Donegan, T. M. & Huertas, B. C. (eds.) 2005. Threatened species of Serrama de los Yariguies: final report. 

Colombian EBA Project Rep. Ser. 5: www.proaves.org. 
Donegan, T. M. & Huertas, B. C. 2006. A new brush-finch in the Atlapetes latinuchus complex from the 

Yariguies Mountains and adjacent Eastern Andes of Colombia. Bull. Brit. Orn. CI. 126: 94-116. 
Donegan, T. M., Avendaho-C, J. E., Briceno-L., E. R. & Huertas, B. 2007. Range extensions, taxonomic and 

ecological notes from Serrama de los Yariguies, Colombia's new national park. Bull. Brit. Orn. CI. 127: 

172-213. 

Donegan, T., Huertas, B., Avendano J., Briceno, E. & Donegan, M. 2008. The first biological explorations of 
Serrama de los Yariguies, Colombia. Neotrop. Birding 3: 38^13. 



Thomas M. Donegan & Jorge Enrique Avendano 26 



Bull. B.O.C. 2010 130(1) 



Fjeldsa, J. & Krabbe, N. 1990. Birds of the high Andes. Zool. Mus., Univ. of Copenhagen & Apollo Books, 
Svendborg. 

Graves, G. R. 1985. Evolutionary correlates of speciation and intraspecific variation in plumage in Andean 

forest birds. Auk 102: 556-579. 
Helbig, A. J., Knox, A. G., Parkin, D. T., Sangster, G. & Collinson, M. 2002. Guidelines for assigning species 

rank. Ibis 144: 518-525. 

Hellmayr, C. E. 1936. Catalogue of birds of the Americas, pt. IX. Field Mus. Nat. Hist. Publ., Zool Ser. 13(9). 
Hilty, S. L. 2003. Birds of Venezuela. Princeton Univ. Press. 

Hilty, S. L. & Brown, W. L. 1986. A guide to the birds of Colombia. Princeton Univ. Press. 

Hijmans, R. J., Cameron, S. E., Parra, J. L., Jones, P. G. & Jarvis, A. 2005. Very high resolution interpolated 

climate surfaces for global land areas. Intern. J. Climatology 25: 1965-1978. 
Hubbs, C. L. & Perlmutter, A. 1942. Biometric comparison of several samples with particular reference to 

racial investigations. Amer. Naturalist 76: 582-592. 
Huertas, B. C. & Arias, J. J. 2007. A new butterfly species from the Colombian Andes and a review of the 

taxonomy of the genera Idioneurula Strand, 1932 and Tamania Pyrcz, 1995 (Lepidoptera: Nymphalidae: 

Satyrinae). Zootaxa 1652: 27-40. 
Huertas, B. C. & Donegan, T. M. (eds.) 2006. Proyecto YARE: investigacion y evaluation de especies 

amenazadas de la Serrarua de los Yariguies, Santander, Colombia. Informe Preliminar Etapa 1. 

Colombian EBA Project Rep. Ser. 7: www.proaves.org. 
International Commission on Zoological Nomenclature (ICZN). 1999. International code of zoological 

nomenclature. Fourth edn. The International Trust for Zoological Nomenclature, c/o The Natural 

History Museum, London. 

Isler, M. L., Isler, P. R. & Whitney, B. M. 1998. Use of vocalizations to establish species limits in antbirds 

(Passeriformes; Thamnophilidae). Auk 115: 577-590. 
Isler, M. L., Isler, P. R. & Whitney, B. M. 2006. Species limits in antbirds (Thamnophilidae): the Warbling 

Antbird (Hypocnemis cantator) complex. Auk 124: 11-28. 
Isler, M. L., Isler, P. R. & Whitney, B. M. 2007. Species limits in the " Schistocichla" complex of Percnostola 

antbirds (Passeriformes: Thamnophilidae). Wilson J. Orn. 119: 53-70. 
Isler, M. L. & Isler, P. R. 1999. Tanagers. Christopher Helm, London. 

Krabbe, N. 2008a. Birds of the Sierra Nevada de Santa Marta, Colombia. CDs. John V. Moore Nature Recordings, 
San Jose, CA. 

Krabbe, N. 2008b. Vocal evidence for restitution of species rank to a Santa Marta endemic: Automolus 
rufipectus Bangs (Furnariidae), with comments on its generic affinities. Bull. Brit. Orn. CI. 128: 219-227. 

Krabbe, N. & Nilsson, J. 2003. Birds of Ecuador: sounds and photographs. DVD-ROM. Bird Songs International, 
Westernieland. 

Krabbe, N., Moore, J. V., Coopmans, P., Lysinger, M. & Ridgely, R. S. 2001. Birds of the Ecuadorian highlands: 

the upper montane and paramo zones of Ecuador. CDs. John V. Moore Nature Recordings, San Jose, CA. 
Krabbe, N., Florez, P., Suarez, G., Castano, J., Arango, J. D. & Duque, A. 2006. The birds of Paramo Frontino, 

West Andes of Colombia. Orn. Colombiana 4: 39-50. 
Kroodsma, D. E. 1984. Songs of the Alder Flycatcher (Empidonax alnorum) and Willow Flycatcher (Empidonax 

traillii) are innate. Auk, 101: 13-24. 
Meyer de Schauensee, R. 1964. The birds of Colombia and adjacent areas of South and Central America. Acad. Nat. 

Sci., Philadelphia. 

Meyer de Schauensee, R. 1966. The species of birds of South America and their distribution. Livingston Publishing, 
Narberth, PA. 

Moore, J. V. & Lysinger, M. 1997. The birds of Cabanas San Isidro, Ecuador. Cassettes. John V. Moore Nature 

Recordings, San Jose, CA. 
Munsell Color. 1977. Munsell® color charts for plant tissues. GretagMacbeth LLC, New York. 
Munsell Color. 2000. Munsell® soil color charts. GretagMacbeth LLC, New York. 

Patten, M. A. & Unitt, P. 2002. Diagnosability versus mean differences of Sage Sparrows subspecies. Auk 
119: 26-35. 

Paynter, R. A. 1982. Ornithological gazetteer of Venezuela. Mus. Comp. Zool, Cambridge, MA. 

Paynter, R. A. 1997. Ornithological gazetteer of Colombia. Second edn. Mus. Comp. Zool., Cambridge, MA. 

Pearson, R. G., Raxworthy, C. J., Nakamura, M. & Peterson, A. T. 2007. Predicting species distributions from 

small numbers of occurrence records: a test case using cryptic geckos in Madagascar. /. Biogeogr. 34: 

102-117. 

Phillips, S. J., Anderson, R. P. & Schapire, R. E. 2006. Maximum entropy modelling of species geographic 

distributions. Ecol. Modelling 190: 231-259. 
Remsen, J. V. 1984. High incidence of "leap-frog" pattern of geographic variation in Andean birds: 

implications for the speciation process. Science 224: 171-173. 
Remsen, J. V., Cadena, C. D., Jaramillo, A., Nores, M., Pacheco, J. F., Robbins, M. B., Schulenberg, T. S., Stiles 

F. G., Stotz, D. F. & Zimmer, K. J. 2009. A classification of the bird species of South America (version 15 

July 2009). www.museum.lsu.edu/~Remsen/SACCBaseline.html 



Thomas M. Donegan & Jorge Enrique Avendano 27 



Bull. B.O.C. 2010 130(1) 



Restall, R., Rodner, C. & Lentino, M. 2006. Birds of northern South America. Christopher Helm, London 
Ridgely, R. S. & Tudor, G. 1989. The birds of South America, vol. 1. Oxford Univ. Press. 
Ridgely, R. S. & Tudor, G. 2009. The birds of South America, passerines. Christopher Helm, London. 
Ridgely, R. S. & Greenfield, P. J. 2001. The birds of Ecuador. Cornell Univ. Press, Ithaca, NY. 
Salaman, P., Donegan, T. & Caro, D. 2009. Listado de aves de Colombia 2009. Conserv. Colombiana 8: 1-86. 
Sibley, C. G. & Monroe, B. L. 1990. Distribution and taxonomy of birds of the world. Yale Univ. Press, New 
Haven, CT. 

Smithe, F. B. 1975 Naturalists' color guide. Amer. Mus. Nat. Hist., New York. 

Stattersfield, A. J., Crosby, M. J., Long, A. J. & Wege, D. C. 1998. Endemic Bird Areas of the world: priorities for 

biodiversity conservation. BirdLife International, Cambridge, UK. 
Stiles, F. G. & Caycedo, P. 2002. A new subspecies of Apolinar's Wren (Cistothorus apolinari, Aves: 

Troglodytidae), an endangered Colombian endemic. Caldasia 24: 191-199. 
Storer, R. W. 1970. Subfamily Thraupinae. Pp. 246-408 in Paynter, R. A. (ed.) Check-list of birds of the world, 

vol. 13. Mus. Comp. Zool., Cambridge, MA. 
Strewe, R. & Navarro, C. 2004. The threatened birds of the rio Frio Valley, Sierra Nevada de Santa Marta, 

Colombia. Cotinga 22: 47-55. 
Zimmer, J. T. 1944. Studies of Peruvian birds. No. XL VIII: the genera Iridosornis, Delothraupis, Anisognathus, 

Buthraupis, Compsocoma, Dubusia and Thraupis. Amer. Mus. Novit. 1262. 
Zink, R. M. 2003. The role of subspecies in obscuring avian biological diversity and misleading conservation 

policy. Proc. Roy. Soc. Eond. B 27: 561-564. 
Zink, R. M. & Remsen, J. V. 1986. Evolutionary processes and patterns of geographic variation in birds. 

Current Orn. 4: 1-69. 

Addresses: Thomas Donegan, Fundacion Pro Aves, 33 Blenheim Road, Caversham, Reading RG4 7RT, UK, 
e-mails: tdonegan@proaves.org / thomasdonegan@yahoo.co.uk. Jorge E. Avendano, Departamento de 
Ciencias Biologicas, Universidad de los Andes, A.A. 4976, Bogota, Colombia, e-mails: je.avendan0955@ 
uniandes.edu.co / jorgeavec@gmail.com 

APPENDIX 1: Materials examined 

Specimen data are organised alphabetically by museum, then in number order by specimen number. Other 
data are organised from south to north. Elevations are only presented when given on specimen labels and, if 
given in feet, have been converted to metres. Assignment of specimens or observations to subspecies in the 
Central Andes is based upon arbitrary segregation between (i) Central Andean populations of A. I. palpebrosus 
and A.l. olivaceiceps near the Caldas-Antioquia border (c.05°30'-06°00'N), where there is a gap in records; and 
(ii) between A.l. palpebrosus and A.l. caerulescens at the latitude of the southern Tungurahua border (c.01°30'S) 
in central Ecuador. 

Specimens 

The following museum codes are used in this section. Museums marked * were visited by the authors, 
with other specimen data from Biomap, which were confirmed with photographs in instances noted below. 
AMNH* = American Museum of Natural History, New York, USA. ANSP = Academy of Natural Sciences, 
Philadelphia, USA. BMNH* = Natural History Museum, Tring, UK. CM = Carnegie Museum of Natural 
History, Pittsburgh, USA. CMUC = Centro de Museos, Universidad de Caldas, Manizales, Colombia. COP = 
Coleccion Ornitologica Phelps, Caracas, Venezuela. CZUT* = Coleccion Zoologico, Universidad de Tolima. 
FMNH = Field Museum of Natural History, Chicago, USA. FVZ = Western Foundation of Vertebrate 
Zoology, Caramillo, USA. IAVH* = Instituto Alexander von Humboldt, Villa de Leyva, Colombia. ICN* = 
Instituto de Ciencias Naturales, Universidad Nacional, Bogota, Colombia. INCIVA = Instituto Vallecaucano 
de Investigaciones, Cali, Colombia. LACM = Los Angeles County Museum of Natural History, Los Angeles, 
USA. LSU = Museum of Natural Science, Louisiana State University, Baton Rouge, USA. MCSJ = Museo 
Colegio San Jose, Universidad de la Salle, Medellih, Colombia. MHNNL = Museum d'Histoire Naturelle 
de Neuchatel, Neuchatel, Switzerland. MLS* = Museo de la Universidad de la Salle, Bogota, Colombia. 
MNHN* = Museum Nationale d'Histoire Naturelle, Paris, France. MHNG = Museum d'Histoire Naturelle de 
Geneve, Geneva, Switzerland. MHNUV* = Museo de Historia Natural, Universidad de Valle, Cali, Colombia. 
MHNUC* = Museo de Historia Natural, Universidad del Cauca, Popayan, Colombia. MVZ = Museum of 
Vertebrate Zoology, University of California, Berkeley, USA. UMMZ = Museum of Zoology, University 
of Michigan, Ann Arbor, USA. SMF = Forschungsinstitut und Naturmuseum Senckenberg, Frankfurt, 
Germany. USNM = Smithsonian Institution, National Museum of Natural History, Washington, USA. YPM = 
Peabody Museum of Natural History, Yale University, USA. ZMB = Museum fur Naturkunde der Humboldt 
Universitat, Berlin, Germany. ZSM = Zoologische Staatssammlung, Miinchen, Germany. 

A. melanogenys SANTA MARTA, COLOMBIA: AMNH 72429, 72481-85 (El Lfbano, Magdalena, 11°10'N, 
74°00'W), 72479-80, 72486-88 (San Lorenzo, Magdalena, 11°10'N, 74°07'W); BMNH 1885.6.7.29 (Templado, 



Thomas M. Donegan & Jorge Enrique Avendano 28 



Bull. B.O.C. 2010 130(1) 



Valledupar, Cesar, 1,981 m, 10°33'N, 73°29'W), 1885.6.7.30-31 ('nr. San Sebastian' [de Rabago, Valledupar, 
Cesar], 10°34'N, 73°36'W); CM 29072 (San Lorenzo, as above, photograph); ICN 2168-69, 23466-72, 23474, 
23476-78, 23480-83 (San Lorenzo, as above), 23484 (Cuchilla Cebolleta, Cienaga, Magdalena, 10°55'N, 
73°55'W); MNHN 6406 / CG1932 / 1340 ('Santa Marta'). Biomap: ANSP 63234-38, 184423 (San Miguel, 
Dibulla, La Guajira, 10°58'N, 73°29'W); CM 8820, 8826 (El Lfbano, as above), 37800-02, 37919, 37942, 37959- 
60, 37971, 37984-85, 42541, 102869-70 (San Lorenzo, as above), 38642-45, 38662, 39659 ('Santa Marta'"), 45042 
(Alto de Chirua, Riohacha, La Guajira, 10°56'N, 73°22'W), 45072-73, 45084 (no Macotama, Dibulla, La Guajira, 
10°55'N, 73°30'W); FMNH 72773-74 (San Lorenzo, as above); LSU 90464-65 (San Lorenzo, as above); MCZ 
106392-93, 106395-99, 106401-05, 106407-09 (Macotama, as above); SMF 59900 (San Lorenzo, as above), 72484 
(El Lfbano, as above); USNM 170370-01 (Macotama, as above), 346926, 388186-87 (Chenducua, Valledupar, 
Cesar, 10°47'N, 73°25'W), 375135, 388197-202, 388204-05 ('Santa Marta'), 384373-80, 388184-85 (San Jose, 
Valledupar, Cesar, 10°45'N, 73°24'W), 388181-83 (no Guatapurf, Valledupar, Cesar, 10°53'N, 73°32'W), 
388188 (Cerro el Mamon, Valledupar, Cesar, 10°37'N, 73°33'W), 388191-96 (Chinchicua, Puerto Bello, Cesar, 
10°26'N, 73°43'W), 388296, 388207-10 (Siminchucua, Aracataca, Magdalena, 10°40'N, 73°38'W). 

A.l. pallididorsalis SERRANIA DE PERIjA, VENEZUELA: AMNH 55591 (Cerro Tetari, Zulia, Perija, 10°02'N, 
73°02'W, 2,900 m); COP 55586-602 (Cerro Tetari, as above, all paratypes), 55603-10 (Cerro Pejochaina, Zulia, 
summit and east slope, 09°57'N, 72°58'W, 2,000-2,300 m, all paratypes), 58118 (Pie Cerro, Zulia, 10°00'N, 
72°50'W, 2,350 m), 58119-20 (Campamento Avispa, Zulia, 10°10'N, 72°48'W, 2,175 m), 73026-37 ('Camp 
Frontera 2', Zulia, 3,000 m, coordinates unknown). COLOMBIA: ICN 36239 (Sabana Rubia, Manaure, Balcon 
de Cesar, 10°22'N, 72°55'W); 35859, 36042 (Casa de Hierro, Sabana Rubia, La Paz, Cesar, 10°22'N, 72°54'W, 
3,400 m); 36727, 36781 (Fig. 2vi) (above El Cinco, La Paz, Cesar, 10°22'N 72°57'W, 2,450 m); 36828, 36830-01, 
36835-37, 36846 (Casa de Vidrio, Sabana Rubia, La Paz, Cesar, 10°22'N, 72°54'W, 3,025 m). Biomap: FVZ 
11852-53 (San Alberto, Cesar, 07°45'N, 73°23'W, but presumably higher than this localitv or incorrectly 
labelled); USNM 375136-14, 375146-52 ('Serranfa de Perija', Cesar'/ La Guajira) 

A.l. melanops CORDILLERA DE MERIDA, VENEZUELA: AMNH specimens inspected but no details taken; 
BMNH 85.6.7.28, 1915.3.1.139-16, 1969.52.90 ('Merida'), 1969.39.83-84 (Culata, Merida, 08°45'N, 71°05'W); 
COP 4737 (Vallecito, Merida, 08°39'N, 71°06'W, 2,000 m), 5112-16 (Paramo Misisf, Trujillo, 09°20'N, 70°20 / W / 
2,100 m), 9468-72 (Paramo Zumbador, Tachira, 08°00'N, 72°05'W, 2,500-2,600 m), 14283-91 (Llano Rucio, 
Merida, 09°00'N, 71°05'W, 2,500 m), 14595-97 (El Escorial, Merida, 08°38'N, 71°05'W, 2,800 m), 14699 
(Paramo San Antonio, Merida, 08°40'N, 71°03'W, 3,000 m), 20084-89, 20092-98 (Paramo Cende, TrujiUo, 
09°28'N, 70°05'W, 2,700-2,900 m), 20090-91 (Paramo Jabon, Trujillo, 3,000 m, apparently near Paramo Misisf, 
above, but coordinates unknown), 20279 (El Rincon, Cerro Niquitaz, Trujillo, 09°07'N, 70°30'W, 2,600 m), 
24573-77, 24671-72 (Boca de Monte, Pragonero, Tachira, 08 o 01'N, 71°46'W, 2,300-2,400 m), 45464-79 (El 
Muerto, north slope, Paramo Aricagua, Merida, 08°20'N, 71°11'W, 2,900-3,000 m), 49438-48 (La Honda, 
Santo Domingo, Merida, 2,700 m, coordinates unknown), 64402-09 (Paramo La Negra, Merida, 08°15'N, 
71°40'W, 3,000-3,200 m), 71587 (Los Arangures, 35 km south of Mucuchfes, Merida, 2,890 m, coordinates 
unknown); MNHN 3193-95, one unnumbered ('Merida'). 

A.l. tamae EASTERN CORDILLERA, VENEZUELA: AMNH 11244 (Paramo Tama camp, 07°25'N, 72=26^, 
3,000 m); COP 11241-18 (Paramo Tama camp, as above, 2,000-3,000 m, all paratypes), 61517-21, 62505-15 
(Hacienda La Providencia, rfo Chiquito, Tachira, 07°38'N, 72°12'W, 1,800-2,300 m), 74095-106 (Cumbre 
Cerro Retiro, Rebancha, Tachira, coordinates unknown, 2,800 m). COLOMBIA: AMNH 513795 ('Colombia'); 
CM 60221 (Boca del Monte, Bovaca, possibly c.05°36'N, 72°27'W but not included in analvsis, photograph); 
FMNH 261868-70 (Hacienda la Primavera, Cubara, Boyaca, 07°00'N, 72°20'W) (photograph); ICN 18191 (Fig. 
2v), 18192 (Toledo, Paramo de Tama, Norte de Santander, 07°19'N, 72°28'W); MLS 5794, 6760-64 (Fontibon, 
Pamplona, Norte de Santander, 07°21'N, 72°39'W); USNM 410162 (Pamplona, Norte de Santander, 07°23'N, 
72°39'W) (photograph). 

A.l. olivaceiceps WESTERN CORDILLERA, COLOMBIA: AMNH 134366-70, 134374-76, (Paramillo, Antioquia, 
07°03'N, 75°55'W); BMNH 1921.12.29.48 (Paramillo, as above); ICN 35001 (Fig. 2iii) (Vereda Monserrate, 
Jardfn, Antioquia, 05°37'N, 75°53'W). Biomap: USNM 256357, 436971-75, 436977-78, 436980 (Paramillo, 
as above), 436966 (Hacienda La Ilusion, Urrao, Antioquia, 06°25'N, 76°05'W). CENTRAL CORDILLERA, 
COLOMBIA: AMNH 40703 ('Bogota'); 148083 (Sabanalarga, Antioquia, 06°51'N 75°48'W), 513792 (Santa 
Elena, Antioquia, 06°15'N, 75°35'W), 513793-94 (both 'Medellfn'); ANSP 7375 ('Bogota', photograph); BMNH 
85.6.12.417 ('Bogota'), 1885.6.7.23-25, 1885.6.12.419 (Santa Elena, as above); ICN 34345, 34465 (El Escobero, 
San Sebastian, Envigado, Antioquia, 06°10'N, 75°35'W); ZMB 15879 ('New Granada', photograph); MLS 
4826 (San Pedro, Antioquia, 06°28'N, 75°33'W), 4827 (Yarumal, Marconi, Antioquia, 06°58'N, 75°24'W), 8193 
(El Chaquiro, Santa Rosa, Antioquia, 06°45'N, 75°32'W); MNHN alOl, CG1999.3198 ('Antioquia'). Biomap: 
MCSJ 144 (San Pedro, as above), 284 (Boqueron, Antioquia, 06°17'N, 75°37'W), 480A, 481A, 482 (Santa Elena, 
as above), 2805 (Paramo de Sonson, Antioquia, 05°43'N, 75°15'W), 2928-29, 2931 (Belmira, Paramo Santa 
Ines, Antioquia, 06°48'N, 75°43'W); MHNNL 92.8759, 92.8760A, 92.8760B ('Medellfn'); USNM 427569-77, 
428069, 536578 (Santa Rosa de Osos, Antioquia, 06°39'N, 75°28'W), 428068 ('Antioquia'), 436967-70 (Sonson, 
Antioquia, 05°42'N, 75°18'W). 



Thomas M. Donegan & Jorge Enrique Avendano 29 



Bull. B.O.C. 2010 130(1) 



A.l. palpebrosus COLOMBIA: AMNH 40703 ('Bogota'); 117339-42 (Almaguer, Cauca, 01°55'N, 76°50'W), 
112988 (no Toche, Ibague, Tolima, 04°32'N, 75°25'W) / 112989 (Paramo de Santa Isabel, Risaralda / Tolima 
/ Caldas border, 04°47'N, 75°26'W); 112991, 112993-3002 (Laguneta, Quindfo, 04°34'N, 75°30'W); BMNH 
1885.6.12.418 ('New Grenada'); CZUT 497, 505 (La Cascada, Anzoategui, Tolima); ICN 2810 (San Marcos, 
Cauca, 02°20'N, 76°05'W), 2811-12 (Paletara, Cauca, 02°10'N, 76°26'W), 2813 (Termales, Tolima / Caldas, 
04°58'N, 75°23'W), 2814 (Palermo, San Juan, Huila, 02°53'N, 75°28'W), 2815-16 (Fig. 2i) (La Cocha, Pasto, 
Narino, 01°05'N, 77°09'W), 8502, 8531 (Chorreado, Puerres, Narino, 00°50'N, 77°25'W), 26145, 26150, 26152- 
53, 26157 (Parque NaciOnal Natural (PNN) Nevado del Huila, Paez, Cauca, 03°01'N, 76°00'W), 29230, 29263, 
29268, 29277-78 (La Victoria, Tumaco / Ipiales, Narino, 00°35'N, 77°10'W), 29339 (Llorente, Narino, 00°49'N, 
77°15'W), 20445 (Herbeo, Tolima, 05°05'N, 75°20'W); MHNUC 2440-41, 2445-46, 2449 (La Victoria, as above), 
2442 (Paletara, as above), 2444 (Muluzua, Totoro, Cauca, 02°29'N, 76°18'W); MHNUV 4435-38 (Bosque del 
Oso, 1.5 hours from Hacienda Corinto, Villa Maria, Caldas, coordinates unknown); 4862-63 (Finca Bengala, 3 
km north of Cocora at the end of the Salento-Cocora, Salento, Quindfo, 04°38'N, 75°29'W), 4563-64 (Bosque 
del Alto del Dulce, El Provenir / Bernal, road to Villamarfa, Santa Rosa de Cabal, Risaralda, 04°52'N, 
75°38'W), 4861, 5880-81 (km 33, Carretera Paletara-San Jose de Isnos, 1 km east of Quebrada Bujfas, Huila, 
02°00'N, 76°17'W); USNM 81823-24 ('Colombia', photographs). Biomap: ANSP 7374 (Pasto, Narino, 01°13'N, 
77°17'W), 162197, 162201-02, 162204 (Chorreado or Puerres, as above), 162198-99 (Derrumbe, Narino, pre- 
sumably at higher elevation than this locality, coordinates unknown), 162205-07, 162209-10 (Paramo de 
Guamues, as above), 154485-90, 154492-94, 154496 (Laguneta, as above); CM 26100, 70261-62, 70346, 70412, 
70426 (Zancudo, Manizales, Caldas, 05°05'N, 75°30'W); CMUC 226 (Parque Regional Ucumarf, Risaralda, 
04°39'N, 75°36'W), 341AE (Paramo de Letras, Caldas, 05°10'N, 75°20'W); FMNH 226920-21 (Moscopan, 
Cauca, 02°20'N, 76°05'W), 251435 (El Crucero, Purace, Cauca, 02°20'N, 76°39'W), 255809 (San Rafael, Purace, 
Cauca, 02°25'N, 76°25'W), 288119-22, 288139-40, 288152, 399532-33, 399539-44 (La Victoria, as above); ZSM 
1965.391-93, 1965.522, 1965.525 (Totoro, as above), 1965.523-24 (Santa Leticia, La Plata, Huila, 02°14'N, 
76°10'W); INCIVA 2502 (Reserva Natural (RN) La Planada, Ricaurte / Barbacoas, Narino, 01°15'N, 78°15'W), 
2508, 2510 (Totoro, as above), 2509 (10 km north of Pasto, Narino, 01°14'N, 77°17'W), 2511 (Coconuco, PNN 
Purace, Cuaca, 02°24'N, 76°27'W); LSU 38935-36 (Totoro, as above), 48194, 61902 (El Crucero, as above); 
MHNG 1179.076-078, 1179.080-081 (La Victoria, as above); MVZ 120670 (3 km east of Andalucia, Huila, 
01°54'N, 75°41'W), 140719 (Cordillera de Portachuelo, Putumayo, 01°07'N, 76°52'W), 223291 (no Toche, 
as above); UMMZ 223290 (Paramo de Guamues, Narino, 00°50'N, 77°20'W), 223292 (Laguneta, as above); 
LACM 39723, 39735 (Conocuno, as above), 33247-50, (Totoro, as above), 33251-52 (La Plata, as above); 
USNM 447616-21 (Purace, Cauca, presumably as above); YPM 32195 (Totoro, as above). ECUADOR: AMNH 
specimens inspected but no details taken; BMNH 1847.1.16.15 (no locality data), 1860.11.26.24 ('Quito'), 
1885.6.7.26-27 (Villagomez, San Lucas), 1925.12.24.244, 1925.12.24.278 (Huila), 1938.12.20.121 (Papallacta), 
1940.12.5.183-184 (Cuyuja, Napo / Pastaza), 1969.52.88-89 (below Papallacta). Specimens labelled A.l. caer- 
ulescens ECUADOR: AMNH specimens inspected but no details taken; BMNH 1953.68.412 (Huaico, Loja). 
PERU: AMNH specimens inspected but no details taken; BMNH 1885.6.8.435 (Cutervo). 

A.l. intensus WESTERN CORDILLERA, COLOMBIA: AMNH 110213-24, 110227-30 ('Coastal range', Cauca, 
coordinates unknown but presumably near Munchique), 461665 (Cerro Munchique, Cauca, see below); ICN 
25790 (Fig. 2ii), 25818 (Farallones del Cauca, Valle del Cauca, 03°22'N, 76°45'W), 25864, 30107 (Chargiiayaco, 
Cerro Munchique, El Tambo, Cauca, 02°40'N, 76°57'W); MHNUC 2443 (Chargiiayaco, as above), 3375-77 (La 
Romelia, PNN Munchique, El Tambo, Cauca, 02°27'N, 76°49'W); MHNUV 1048 (rio Cali, Calle, 2,000-2,300 
m, 03°30'N, 76°30'W) 3926, 3929, 3940, 3995, 4005, 4006 (Alto del Buey, Farallones de Cali, as above) 4563-64 
(Bosque de Alto del Dulce-El Porvenir, Santa Rosa de Cabral, Risaralda); MLS 6765-66 (El Tambo, as above). 
Biomap: ANSP 141900, 141902-03, 144630 (Munchique, as above), 141905, 150225 (Gamboa, San Antonio, 
Cauca, 02°37'N, 76°54'W); FMNH 53776-77, 307939 (west of Popayan, Cauca, no details), 226916-17, 
249986-89 (Munchique, as above); LSU 38934 (Munchique, as above); MHNG 1140.017-22, 1167.045, 1216.028 
(Munchique, as above); LACM 29247-57, 37576 (Munchique, as above); USNM 459541-46 (El Tambo, as 
above); YPM 32196-97 (Munchique, as above). 

A.l. lacrymosus PERU: AMNH: all specimens inspected and seven measured but no details taken; BMNH 
1896.10.6.168, 1896.10.6.169 (latter, two specimens, same no.) (Chachapoyas, 2,743 m), 1885.6.12.421 (Higos); 
MNHN 3196, GC1901inl676 (Cumpary, 2,400 m). 



Photographs 

A.l. melanops CORDILLERA DE MERIDA, VENEZUELA: PNN Dinira, Lara, 09°34'N, 70°06'W (J. E. Miranda 
T.: Fig. lvi). 

A.l. yariguierum SERRAMA DE LOS YARIGUIES, COLOMBIA: Lepipuerto (details in text) (Donegan et at 
2007). 

A.l. olivaceiceps WESTERN CORDILLERA, COLOMBIA: Reserva Natural de Aves (RNA) Colibri de 
Sol, Urrao, Antioquia, 06°26'N, 76°05'W, 3,400 m (Krabbe et al. 2006; A. Quevedo / ProAves: Fig. l(iv)). 



Thomas M. Donegan & Jorge Enrique Avendano 30 



Bull. B.O.C. 2010 130(1) 



CENTRAL CORDILLERA, COLOMBIA: La Lana, San Pedro de los Milagros, Antioquia, 06°27'N, 75°36'W, 
2,645 m (T. M. Donegan / J. E. Avendano / B. Huertas: Fig. liii). 

A.l. palpebrosus COLOMBIA: Reservas de Aves Comunitarias, Roncesvalles, Tolima, 04°00'N, 75°40'W (A. 
Quevedo / ProAves: Fig. lv); RNA Loro Coroniazul y El Mirador, Genova, Quindfo, 04°08'N / 75°44'W, 
3,200 m (A. Quevedo / ProAves). 

A.l. intensus WESTERN CORDILLERA, COLOMBIA: RNA Mirabilis-Swarovski, Cauca, 02°31'N, 76°59'W, 
2,400 m (J. P. Lopez Ordonez / ProAves: Fig. lvii). 



Sound-recordings 

A. melanogenys SANTA MARTA, COLOMBIA: RN El Dorado, San Lorenzo, Magdalena, 11°06-09'N, 
74°03-06'W, 1,450-2,700 m (Krabbe 2008a: Fig. 6F; C. Hesse recording: XC 10194; T. M. Donegan recording: 
XC 37290). 

A.l. pallididorsalis SERRANIA DE PERIjA, COLOMBIA: above El Cinco, vereda El Cinco, Manaure, Cesar, 
10°21'N 72°56'W, 2,450 m (J. E. Avendano: Fig. 6D). 

A.l. melanops CORDILLERA DE MERIDA, VENEZUELA: Parque Nacional (PN) Guaracamal, Trujillo, 
09°10'N, 70°11'W (Boesman 1999: Fig. 6C). 

A.l. yariguierum SERRANIA DE LOS YARIGUIES, COLOMBIA: Lepipuerto (details in text). 

A.l. olivaceiceps CENTRAL CORDILLERA, COLOMBIA: Bello, San Felix, Serrama Las Baldias, Antioquia, 
06°01'N, 75°35'W (Alvarez et at. 2007: Fig. 5F). 

A.l. palpebrosus COLOMBIA: San Juan de Pasto, Daza, Narino, 01°16'N, 76°15'W, 2,800 m (O. Laverde: XC 
12748-49: Figs. 5G, 5H); rio Blanco, Caldas, 05°05'N, 75°21'W (Alvarez et al. 2007: Fig. 6E); Neira, vereda la 
Cristalina, headwaters of the rio Tapias, Caldas, supposedly 05°34'N 74°53'W but probably further west 
and at higher elevation (Alvarez & Cordoba 2002, Alvarez et al. 2007: Fig. 5C). ECUADOR: Cordillera de 
Guacamayos, Napo, 00°37'S, 77°50'W, 2,300 m (Krabbe et al. 2001; Krabbe & Nilsson 2003); Cabanas San 
Isidro, Napo (00°35'S, 77°53'W, 2,100 m) (Moore & Lysinger 1997); Guango Lodge, Napo, 00°23'S, 78°36'W, 
2,800 m (S. Olmstead: XC: 177719); 1 km below Oyacachi, Napo, 00°13'S, 78°04'W, 3,150 m (Krabbe & Nilsson 
2003); El Chorillo, Santa Barbara-La Bonita Road, Sucumbfos, 00°36'N, 77°31'W, 2,650 m (Krabbe & Nilsson 
2003). 

A.l. caerulescens ECUADOR: Reserva Tapichalaca, Zamora-Chinchipe, 04°29'S, 79°09'W and 04°30'N, 
79°08'W, 2,500-2,830 m (Krabbe & Nilsson 2003: Fig. 5D; A. Spencer: XC 17470); Cerro Toledo, east slope, 
Zamora-Chinchipe, 04°23'S 79°06'W, 3,150 m (Krabbe et al. 2001; Krabbe & Nilsson 2003); PN Podocarpus, 
Cajanuma, Loja, 04°06'S 79°09'W and 04°07'S, 79°10'W, 2,750-2,800 m, (Krabbe et al. 2001: Fig. 5G; C. Vogt: 
XC 16408); Gualaceo-Limon road, Morona-Santiago, 03°02'S, 78°35'W (Krabbe et al. 2001). 

A.l. lacnjmosus PERU: Bosque Unchog, Huanuco, 09°41'S, 76°07'W, 3,250 m (C. Hesse: XC 10778, 10779). 



Mist-net data 

A. melanogenys SANTA MARTA, COLOMBIA: RNA El Dorado (details above) (E. Rodriguez, D. Velasco, C. 
Olaciregui et al. / ProAves). 

A.l. yariguierum SERRANIA DE LOS YARIGUIES, COLOMBIA: The following individuals were photo- 
graphed and ringed with ProAves rings, but are not assigned as types: Lepipuerto captures (2): ProAves ring 
nos. C02480 and C02481, each captured on 9 January 2005 at 07.00 h; Filo Pamplona captures (ten in addition 
to the recaptured para type, all with blood samples taken and deposited at Uni Andes): C02767 captured on 
11 July 2005 at 17.00 h (recaptured on 13 July 2005 at 07.30 h); C02769 captured on 12 July 2005 at 07.00 h; 
C02770-73 and C02775, all captured on 12 July 2005 at 16.30-17.30 h; C02779 captured on 13 July 2005 at 06.30 
h (recaptured on 14 July 2005 at 07.00 h); C02789 captured on 13 July 2005 at 18.30 h; C02791 captured on 14 
July 2005 at 07.00 h. For localities, see text. 

A.l. olivaceiceps WESTERN CORDILLERA, COLOMBIA: RNA Loro Orejiamarillo, lardm, Antioquia, four 
localities: 05°32'N, 75°48'W, 2,700 m; 05°33'N, 75°48'W, 2,700 m; 05°36'N, 75°51'W, 1,600 m; 05°46'N, 
75°58'W, 1,600 m (G. Suarez et al.: ProAves); Paramo Frontino, Antioquia, two localities: 06°26'N, 76°05'W, 
3,500 m; 06°25'N, 76°04'W, 2,800 m (D. Caranton et al.: ProAves). 

A.l. palpebrosus COLOMBIA: Reservas Comunitarias de Roncesvalles, Tolima, 04°00'N, 75°40'W, 1,500-3,500 
m (D. Vesasco et al.: ProAves); RNA Loro Coroniazul y El Mirador, Mirador, Genova, Quindfo, details above 
(D. Ramirez, F. Guzman et al.: ProAves); vereda El Paramo, Marulanda, Caldas, 05°17'N, 75°16'W, 2,800 m 
(A Quevedo: ProAves); RN Ibanasca, Tolima, 04°38'N, 75°19'W, 2,900-3,600 m (D. Bejarno / A. Gonzalez: 
ProAves); vereda Las Sabinas, Manizales, Caldas (coordinates unknown) (A. Quevedo: ProAves). 



Thomas M. Donegan & Jorge Enrique Avendano 31 



Bull. B.O.C. 2010 130(1) 



Observations 

Note: localities mentioned in previous sections are not repeated here. 

A. melanogenys SANTA MARTA, COLOMBIA: rio Frio, Cienaga, Magdalena, 10°54'N, 73°53'W, 1,500- 
2,900 m (Strewe & Navarro 2004). 

A.l. pallididorsalis SERRANIA DE PERIJA, COLOMBIA: Cerro Pintado, Cesar, 10°28'N, 72°55'W, 1,500- 
3,200 m (P. Salaman: ProAves; IAVH). 

A.l. yariguierum SERRANIA DE LOS YARIGUIES, COLOMBIA: Cerro Las Tetas, Camino del Lenguerke, San 
Vicente de Chucurf, Santander, 06°51'N, 73°21'W (J. C. Luna: ProAves). 

A.l. tamae EASTERN CORDILLERA, COLOMBIA: Quetame, Cundinamarca, 04°18'N, 73°52'W (P. Salaman: 
ProAves); El Alto del Tigre, El Calvario, Meta, 04°22'N, 73°40'W (F. G. Stiles); Loma La Aurora, Bogota, 
Cundinamarca, 04°47'N, 74°01'W (P. Salaman: ProAves); Santuario de Fauna y Flora Igiiaque, Boyaca, 
05°40'N, 73°27'W (J. Zuluaga); Paramo de Monsalve, Santander (07°24'N, 72°56'W, 2950 m) (Avendano 
2006). 

A.l. olivaceiceps WESTERN CORDILLERA, COLOMBIA: PNN Tatama, Pueblo Rico, Risaralda, 05°09'N, 
76°02'W (DATAVES). CENTRAL CORDILLERA, COLOMBIA: Paramos del Sur de Antioquia, Antioquia, 
05°38'N, 75°12'W, 800-3,200 m (IAVH); Carretera Caldas-Agelopolis, Angelopolis, Antioquia, 06°05'N, 
75°39'W, 1,800-2,600 m (P. Restrepo: DATAVES); quebrada El Viao, Cocorna, Antioquia, 06°01'N, 75°27'W, 
1,880-1,950 m (DATAVES); Retire, Antioquia, 06°04'N, 75°30'W, 1,600 m (various observers: DATAVES); 
Alto del Escobero / San Sebastian, Retiro, Antioquia, 06°03'N, 75°'35'W (many observers: DATAVES); 
Corregimiento San Cristobal, Medellm, Antioquia, 06°04'N, 75°30'W (M. J. Pena: DATAVES); Cuenca 
Quebrada, Santa Elena, Medellm, Antioquia, coordinates as above (G. J. Castano: DATAVES); Area de 
Reserva Forestal Protectora, La Romera, Sabaneta, Antioquia, 06°07'N, 75°36'W (P. Pulgarm: DATAVES); 
Envigado, Antioquia, 06°09'N, 75°36'W (R. Velez de Bedout: DATAVES); La Estrella, Antioquia, 06 o 09'N, 
75°39'W (A. M. Castano: DATAVES); Las Antenas, San Felix, Medellm, Antioquia, 06°20'N 75°39'W (many 
observers: DATAVES); Paramo de Belmira, Belmira, Antioquia, 06°30'N, 75°45'W (T. Cuadros: DATAVES). 

A.l. palpebrosus COLOMBIA: Ipiales, Narino, 00°50'N, 77°37'W (P. Salaman: ProAves); laguna de la Cocha, 
Pasto, Narino, 01°07'N, 77°16'W (F. G. Stiles: DATAVES; IAVH); Reserva la Rejoya, Colon, Putumayo, 
01°08'N, 76°56'W, 2,660 m (DATAVES); Pasto-Mocoa road, Narino, coordinates not known (P. Salaman: 
ProAves); Coconuco; Daza, Pasto, Narino 2,800 m, 01°17'N, 77°15'W (C. Downing); Serrania de las Minas, 
Huila, 02°10'N, 76°11'W, 2,100-2,700 m (IAVH); Reserva Natural Privada Meremberg, La Plata, Huila, 
02°23'N, 76°23'W, 2,200-2,400 m (P. Salaman: ProAves; P. Florez: DATAVES); PNN Purace, Cauca, 02°22'N, 
76°30'W, 2,600-2,800 m (P. Florez & F. Piedrahita: DATAVES); Pilimbala-San Nicolas road, PNN Purace, 
Cauca, coordinates unknown (P. Salaman: ProAves); cuenca del rio Hereje, Tolima, 03°18'N, 76°00'W, 
3,280-3,760 m (IAVH); Coconuco-San Agustm road, PNN Purace, Cauca, coordinates unknown (P. Salaman: 
ProAves); Reserva Natural Semillas de Agua, Tolima, 04°14'N, 75°33'W, 3,100-3,800 m (IAVH); Reserva 
Natural Privada Semillas de Agua, Cajamarca, Tolima, 04°27'N, 75°26'W (Querubin Rodriguez Pinilla: 
DATAVES); canon del rio Combeima, Tolima, 04°32'N, 75°18'W, 1,700-2,800 m (IAVH); cuenca del rio Toche, 
Tolima, 04°36'N, 75°24'W, 1,500-3,500 m (IAVH); valle del Cocora, Salento, Quindfo, 04°37'N, 75°27'W (J. 
C. Saenz & J. Ramirez: DATAVES); Acaime, RN Alto Quindfo, Salento, Quindfo, 04°37'N, 75°28'W, 2,500- 
3,500 m (various observers: DATAVES / ProAves); Serrania de los Paraguas, Quindio, 300-2,700 m (IAVH); 
Estacion Altamira, Reserva Natural Privada Narvaco, Salento, Quindfo, 04°38'N, 75°29'W (F. G. Stiles: 
DATAVES); PNN Ucumarf, Pereira, Risaralda, 04°38'N, 75°35'W (many observers: DATAVES); La Montana, 
Reserva Natural Narcavo, Salento, Quindio, 04°38'N, 75°28'W, 2,700 m (D. Duque Montoya / F. G. Stiles: 
DATAVES); lagunas Bombona and Vancouver, Tolima, 04°39'N, 75°13'W, 3,010-4,000 m (IAVH); La Pastora, 
Ucumarf, Risaralda, 2,600-2,800 m, 04°42'N, 75°30'W (C. Downing); Finca Paraguay, Santa Isabel, Tolima, 
04°45'N, 75°17'W, 3,280-3,760 m (IAVH); Bosques del Oriente de Risaralda, Risaralda, 04°47'N, 75°32'W, 
1,800-3,800 m (IAVH); Termales del Ruiz, Villamarfa, Caldas, 04°58'N, 75°23'W, 2,800-3,000 m (L. Arango: 
DATAVES); rio Blanco, Manizales, Caldas, 05°04'N, 75°32'W, 2,500 m (many observers: DATAVES, ProAves, 
IAVH); Marulanda, Caldas, 05°17'N, 75°16'W (L. Rosselli: DATAVES); Pacora, Caldas, 05°32'N, 75°26'W 
(D. Piedrahita Thiriez: DATAVES). ECUADOR: Additional localities for this and A.l. caerulescens listed in 
Zimmer (1944) and Ridgely & Greenfield (2001). 

A.l. intensus WESTERN CORDILLERA, COLOMBIA: El Tigrillo, Munchique, Cauca (J. Sandoval: ProAves); 
Reserva Natural Tambito, 20 de Julio, Cauca, 02°31'N, 76°59'W, 2,300 m (J. Sandoval: ProAves); Bosque de 
San Antonio, km 18, east slope of West Andes, Cali, Valle del Cauca, 03°30'N, 76°38'W (C. M. Wagner). 



Thomas M. Donegan & Jorge Enrique Avendano 32 



Bull. B.O.C. 2010 130(1) 



APPENDIX 2: Biometrics of Anisognathus taxa 

The data below are taken from specimens, or live individuals, by the authors, or other researchers, using the 
same methodology. For all taxa, data are presented in the form mean ± standard deviation (n = sample 
number), with all measurements in mm, except mass (g). / = no data available. 

Taxon Wing-chord Tail (mm) Tarsus (mm) Bill (to skull) Mass (g) 

(mm) (mm) 



A. melanogenys (Santa Marta, 
Colombia) specimens 


oo.Z ± o.4 

(81.0-94.0) 

(n=12) 


/ j.o ± Z.o 

(69.0-78.0) 
(,,=12) 


07 a , 1 n 
Z/.4 ± l.U 

(26.0-29.0) 
(,,=12) 


10.D ± U.D 

(18.0-19.5) 
(,i=ll) 


/ 


A. melanogenys (Santa Marta, 
Colombia) live birds 


87 j_ 0 Q 
o/.D ± A.y 

(84.0-97.0) 
(n=20) 


/ 
/ 


/ 


/ 
/ 


4U.D ± o.U 

(33.8-44.7) 
(,i=19) 


A. lacyyinosus pallididoYsalis 
(Perija, Colombia / Venezuela) 
specimens 


on T , T c 

oy.J ± o.D 

(85.0-93.0) 
(n=4) 


7H O 1 O /I 
/(J.J ± 0.4 

(67.0-75.0) 
(n=4) 


Z4.o ± U.D 

(24.0-25.0) 
(n=4) 


1/1 i4.ni; 

14. j ± U.D 

(14.0-15.0) 
(11=4) 


10 n 
oZ.U 

(n=l) 


A.l. melanops (Merida, Venezuela) 
specimens 


o/.y ± z.o 

(84.0-92.0) 

(h=16) 


/U.O ± Z./ 

(66.0-75.0) 
(,,=15) 


oir 7 4. fl Q 

(24.5-28.0) 
(n=15) 


1 1; q j. n ^ 
iD.y ± U.D 

(15.0-16.5) 
(n=16) 


/ 
/ 


A.l. yuriguicvufn (Yarigufes, 
Colombia) live birds 


yj.i ± 4.0 

(86.0-101.0) 
("=13) 


71 o . T Q 
/4.Z ± Z.O 

(70.0-80.0) 
(,,=13) 


9£ 1 -1-1 1 
ZO.l ±1.1 

(24.0-28.3) 
(,,=13) 


1 a 1 4-1 n 
10. 1 ± l.U 

(14.1-17.0) 

(,i=12) 


7CQ4. 1 Q 

0D.7 ± V.y 

(32.5^0.3) 
(n=13) 


A.l. yaviguieruni (Yariguies, 
Colombia) specimens 


yZ.v ± 4.D 

(86.3-99.0) 
(n=6) 


78 O 4. T O 

/O.o ± Z.o 

(74.1-81.4) 
(n=6) 


7/. n 4. n a 
Zu.U ± U.4 

(24.1-26.5) 

M) 


It)./ ± U.D 

(14.5-17.4) 

(n=6) 


jj.o ±Z.4 

(32.0-38.0) 
(n=6) 


A.l. tamae (East Andes, Colombia 
/ Venezuela) specimens 


00.1 ± 4.Z 

(82.0-94.0) 
(»=10) 


7f| 7 4. T Q 

/U./ ± 0.7 

(63.0-78.0) 

(,i=10) 


7c 7 4. 1 n 
ZD.Z ± l.U 

(23.5-26.0) 
(n=7) 


1: 1 4. n 

1D.O ± U.O 

(14.5-16.5) 
(,,=10) 


/ 
/ 


A.l. olivaceiceps (Central Andes, 
Colombia) live birds 


yv.y ± j.j 

(79.0-98.0) 
(n=199) 


78 Q 4. T ^ 

/o.y ± Z.o 

(73.0-84.1) 
(,,=146) 


Zu.U ± U.7 

(23.5-30.6) 
(,i=149) 


100,1 c 
LO.J ± l.D 

(14.0-21.5) 
(,i=147) 


77 /i -1- 7 ,1 
0/.4 ± 0.4 

(22.4-47.5) 

(,i=209) 


A.l. olivaceiceps (Central Andes, 
Colombia) specimens 


QO. 8 -1- 0 7 

yyj.o ± L.l 

(86.0-97.5) 

(n=25) 


7/1 Q 4. 1 7 

/4.o ± J.Z 

(69.0-80.0) 
(n=25) 


7 c 74.(10 
ZD./ ± U.O 

(24.0-27.5) 
("=25) 


lo.o ± v.y 

(14.0-18.1) 

(n=23) 


oZ.D ± 0.4 

(29.0-37.0) 
(n=4) 


A.L palpebrosus (S. Colombia and 
N. Ecuador) live birds 


QO 1 +7(1 
yLA ± J.v 

(79.8-98.0) 
(,,=59) 


01. 0 ± 0.0 

(71.5-89.9) 

(,,=54) 


17 A -1- 1 8 
Z/.O ± l.o 

(24.3-30.4) 
(,,=55) 


1C7 j. 1 0 
1D.Z ± l.Z 

(12.7-17.5) 
(n=54) 


a: 7 , 7 7 
0D.0 ± z.z 

(30.6-40.0) 

(n=57) 


A.l. palpebrosus (S. Colombia and 
N. Ecuador) specimens 


89.0 ± 3.8 

(79.0-99.0) 

(m=68) 


75.0 ± 3.4 

(67.0-84.3) 

(n=67) 


25.4 ± 1.1 

(23.0-30.0) 

(,,=66) 


16.1 ±0.9 

(13.0-18.0) 

(,i=67) 


33.0 ± 2.2 

(30.5-38.0) 

(n=10) 


A.l. caerulescens (S. Ecuador and 
N. Peru) specimens 


87.5 ± 3.1 

(85.0-95.0) 

(n=13) 


70.3 ± 3.5 

(64.0-74.0) 

(,,=12) 


24.8 ± 1.6 

(22.0-27.5) 

(n=12) 


16.1 ± 0.9 

(i4.5-17.2) 

(,,=12) 


/ 


A.l. intensus (West Andes, 
Colombia) specimens 


91.7 ±4.0 

(82.0-100.0) 

(n=36) 


74.1 ± 3.7 

(67.0-81.3) 

(n=36) 


25.5 ± 1.3 

(22.2-27.6) 

(,,=35) 


16.3 ± 0.8 

(15.1-18.1) 

(,i=34) 


37.0 
(n=l) 


A.l. lacrymosus (Peru) specimens 


85.6 ± 3.7 

(77.0-92.0) 

(,,=13) 


69.5 ± 2.8 

(64.5-76.0) 

(,,=13) 


24.8 ±1.0 

(23.5-26.5) 

(,,=13) 


15.5 ± 0.6 

(14.5-16.5) 

(n=13) 


/ 



© British Ornithologists' Club 2010 



Frank E. Rheindt 



33 



Bull. B.O.C. 2010 130(1) 



New biogeographic records for the avifauna of Taliabu 
(Sula Islands, Indonesia), with preliminary documentation 
of two previously undiscovered taxa 

by Frank E. Rheindt 

Received 8 June 2009 

Summary. — The Sula archipelago lies between Sulawesi and the northern Moluccas 
'in Wallacea. The avifauna of the archipelago, including Taliabu, its largest and 
most diverse island, is under-explored, and current understanding is based on just 
one major historic collecting effort and several visits by modern ornithologists. 
There is limited knowledge especially of the highland birds of Taliabu, since only 
one ornithological expedition has reached this area, discovering in the process c.7 
previously unrecorded species potentially meritorious of subspecific recognition. I 
describe the results of a two-week survey of Taliabu, encompassing both lowland 
and highland areas. An update is given on the state of the habitat on Taliabu, which 
has undergone major forest conversion and degradation due to logging, agricultural 
practices and forest fires. I present new elevational information for at least 14 bird 
species, and records of four species previously unrecorded on the island. Two of 
these represent undescribed taxa, one of them probably a new species. Comments 
on the taxonomy of several Taliabu birds are made on the basis of fresh vocal or 
morphological data, indicating that many endemic Sula races merit upgrading to 
species status. Given rapid forest loss on Taliabu, judicious collecting and genetic 
and vocal work on the taxonomy of its birds are urgently required. 

The Sula Islands form a small and isolated Indonesian archipelago between Sulawesi 
and the Banggai Islands to the west and the Moluccan islands of Halmahera, Obi and 
Bum to the east. The Sula group comprises three major islands (Taliabu, Mangole and 
Sanana) and a wealth of smaller islets covering 9,632 km 2 (Fig. 1). At 2,913 km 2 , Taliabu is 
the largest island in the archipelago (Fig. 1), but is also much more remote than the other 

two main islands, still lacking an airport as 
of 2009, and less densely populated than 
Sanana. Ecologically, Taliabu is also the most 
diverse of the archipelago, with mountains 
rising above at least 1,325 m (see Methods 
for further discussion), and the presence 
of a montane forest zone above 800 m. In 
contrast, Mangole rises barely above 800 m, 
and Sanana's highest elevation is c.450 m 
(GoogleEarth satellite imagery). 

Whilst the Sula Islands are politically 
part of the Moluccan province of Maluku 
Utara (=North Maluku), biogeographically 
they constitute a transition zone between the 
Moluccas and Sulawesi. Moluccan influence 
notwithstanding, the Sula Islands' avian 
community is considered to be dominated 



Taliabu 



Mangole 



1250 
1000 
750 
500 
250 
0 



Sanana 



km 

4 0 



126'E 



Figure 1. Map of the Sula Islands, showing the three 
main islands of Taliabu, Mangole and Sanana (=Sula 
Besi). Small inset (lower left) indicates the position of 
the Sula Islands within the Indonesian archipelago. 



Frank E. Rheindt 



34 



Bull. B.O.C. 2010 130(1) 



by Sulawesi elements. Hence, most ornithologists have assigned the Sula Islands to the 
zoogeographic region of Sulawesi, albeit at the status of a subregion (e.g. White & Bruce 
1986, Coates & Bishop 1997). Despite the avifauna! link to Sulawesi in the west and the 
Moluccas in the east, the Sula avifauna is characterised by a sizeable endemic or near- 
endemic element (White & Bruce 1986), much of which is shared with the Banggai Islands 
to the west (ICBP 1992, Sujatnika et til. 1996, Stattersfield et til. 1998). In its initial assessment 
using the distributional and taxonomic knowledge of the day, ICBP (1992) listed nine 
range-restricted bird species exclusive to the Sula and Banggai groups. Consequently, the 
two archipelagos are treated as an Endemic Bird Area (ICBP 1992, Sujatnika et til. 1996, 
Stattersfield et til. 1998). 

The faunal connection between Sula and Banggai has long puzzled zoologists, because 
the geographic position of the Banggai group, just 14 km off Sulawesi, seemingly contradicts 
the obvious faunal ties with the Sula Islands, more than 80 km distant. However, modern 
geologic, palaeoclimatic and bathymetric data go a long way to explain this unusual 
biogeographic link. Hall (2002) showed that the two groups form a tectonic unit that has 
been drifting West towards Sulawesi and has closely approached it only within the last four 
million years. In addition to their common geologic origin, the Sula and Banggai islands 
have also repeatedly been connected during c.20 glacial epochs within the last three million 
years, each lasting c. 10,000-50,000 years. These connections arose when glacial periods 
caused global sea levels to fall by up to 130 m (Lambeck & Chappell 2001, Siddall et til. 2003, 
Thompson & Goldstein 2003, Bintanja et til. 2005, Caputo 2007), exposing shallow areas, 
such as the string of tiny islets that connect the Sula and Banggai archipelagos. On the other 
hand, the narrow strait between Sulawesi and the Banggai Islands has never accommodated 
a landbridge, being characterised by a deep-sea trench of c .400-700 m (Becker et til. 2009). 

Ornithologicallv, the Sula Islands in general, and Taliabu in particular, have been much 
less well explored than most other Indonesian archipelagos of comparable size. Unlike the 
extensive historic collecting that has occurred on Sulawesi and throughout most of the 
Moluccas, the Sula Islands were visited by just a few collectors in the late 19th and early 
20th centuries (White & Bruce 1986), With the most recent such visit, in 1938, by J. }. Menden 
the only significant collecting effort to have been undertaken on Taliabu (White & Bruce 
1986). During a visit to Sanana and Mangole in December 1988, D. Yong (pers. comm.) was 
the first ornithologist to confirm the continued existence of most endemics after the world 
wars. These two islands may not have received any subsequent ornithological attention, as 
all recent visitors confined their activities to the ecologically more diverse island of Taliabu. 
In 1991, P. J. Davidson et al. from the University of East Anglia (UEA), UK, undertook an 
extensive exploratory survey of Taliabu. Thev were probably the first ornithologists to 
visit the highlands above 600 m, where they made several important findings, including 
potential new taxa (Davidson et al. 1991, Davidson & Stones 1993, Davidson et al. 1995, 
Stones et al. 1997). For simplicity, I refer to their original report (Davidson et al. 1991) when 
citing the findings of the UEA expedition. Following this, the lowlands of Taliabu were 
visited in March 1997 by F. Verbelen (pers. comm.) and in 2005 by B. King (in litt. 2006), 
who confirmed many of Davidson et al.'s findings, but did not venture sufficiently high to 
re-encounter the latter's novel records from the Taliabu highlands. 

Apart from their important work in assessing the abundance of the endemic and near- 
endemic birds on Taliabu, Davidson et al.'s (1991) most important contribution was the 
discovery of seven passerines previously unrecorded in the Sula Islands, all of which 
may possibly represent undescribed endemic subspecies . . . ' (Davidson et al. 1991: 37). These 
included new populations of Red-and-black Thrush Zoothera mendeni (formerly considered a 
subspecies of Red-backed Thrush Z. erythronota), Mountain Tailorbird Orthotonus cuculatus, 



Frank E. Rheindt 



35 



Bull. B.O.C. 2010 130(1) 



Island Leaf Warbler Phylloscopus poliocephalus, Mountain White-eye Zosterops montanus, 
Snowy-browed Flycatcher Ficedula hyperythra, Island Verditer Flycatcher Eumyias panayensis 
and Sulawesi Myzomela Myzomela chloroptera (formerly considered a subspecies of Scarlet 
Myzomela M. sanguinolenta). These new biogeographic records suggest that Taliabu merits 
renewed attention from field ornithologists, that additional novelties might await the 
intrepid explorer, and that the taxonomy of many bird species on Taliabu, not only those 
discovered by Davidson et al. (1991), is in urgent need of re-examination. In the future, fresh 
collecting efforts will be prerequisite as a foundation for genetic and morphological work 
into the taxonomic status of the island's birds, and further field studies will be invaluable 
to collect vocal data that might inform taxonomic decisions. 

' The present contribution details the findings of a recent visit to Taliabu in April 2009, 
involving observations, photography and sound-recording of birds. No effort was made 
to collect birds, although the trip was undertaken with a view to facilitate future collecting 
efforts pending acquisition of a permit. I am currently involved in a dialogue with the 
Indonesian government agency, LIPI, with the aim of establishing a joint research project 
that will involve bird collecting. I frequented a wide range of habitats from sea level to 
montane forest. I reached the highlands in the interior of Taliabu at 1,100 m on three 
different occasions, surveying birds at probably the highest elevations ever on Taliabu. 
Survey work broadly aimed to determine species presence, but special efforts were made to 
document endemic taxa and those newly reported by Davidson et al. (1991) photographically 
or bio-acoustically. During the expedition, new elevational records were made for several 
species, whilst others were found on Taliabu for the first time. I also present new data on 
the taxonomy of most of Davidson et al.'s (1991) potential new endemic subspecies, and, 
most significantly, I provide preliminary documentation of two other new taxa that await 
description. 

Study area and methods 

On 4-18 April 2009, I was based in the village of Binadesa (01°43'S, 124°50'E) near 
Jorjoga (01°40'S, 124°48'E) on the central north coast of Taliabu. Birds were surveyed daily 
from morning until evening and — on several occasions — beyond dusk. Secondary forest 
from the coast to c.500 m was surveyed during day trips from Binadesa. On three occasions, 
I ventured into the central highlands of Taliabu along logging tracks to elevations up to 
1,100 m; these trips each lasted 2-4 days. Photographs were taken using a Panasonic Lumix 
DMC-FZ18. Following the loss of better-quality equipment due to technical problems, 
sound-recordings were made using a Sony TCM-200DV cassette recorder with inbuilt 
microphone. Sonograms were prepared using Syrinx 2.6h by John Burt (available at www. 
syrinxpc.com). Elevations were measured using a barometric altimeter that was regularly 
calibrated at sea level. Note that montane camping excursions were conducted in highlands 
up to 1,100 m, from where surrounding elevations could be viewed. At the highest point 
reached, the peaks of the highest hilltops on the island were only slightly higher than 
my elevation, which is compatible with GoogleEarth satellite data that indicate a highest 
elevation of 1,325 m for Taliabu. In contrast, Davidson & Stones (1993), as well as older 
atlas sources, consistently refer to 1,649 m as the highest elevation on Taliabu. This older 
elevational reference is potentially flawed, since it agrees neither with satellite imagery nor 
with my own observations using a calibrated altimeter. 



Frank E. Rheindt 



36 



Bull. B.O.C. 2010 130(1) 



Recent state of habitat on Taliabu 

Taliabu has undergone drastic habitat clearance in the last two decades. Primary 
lowland forest might be gone from the island, and logging companies have invaded the 
highlands up to 1,200 m along dozens of logging roads. The following assessment of 
habitat viability is based on my own observations. Although my field work was restricted 
to the central north of the island, extrapolations for the whole of Taliabu can be made by 
comparing field observations with satellite imagery from GoogleEarth. 

The narrow (4-km-wide) central northern coastal plain in the vicinity of Menanga 
(01°42'S, 124°53 , E) and Jorjoga held remnants of primary forest and extensive connecting 
secondary forest as recently as March 1997 (F. Verbelen pers. comm.). However, during 
the 1990s and the first years of the new millennium, Taliabu lost most of its lowland forest 
through logging by at least two different companies (P. Obrin pers. comm.). Villagers in 
Binadesa and Jorjoga reported that one of these two companies had logged the environs 
of their villages during two different periods each lasting 3-5 years. Several logging roads 
designed for heavy machinery were constructed into the interior highlands, subsequently 
facilitating easy access to villagers for opportunistic additional logging and agricultural 
habitat conversion after the companies' departure from Taliabu. I gained access into the 
highlands along two logging tracks, but satellite imagery indicates the presence of ten such 
tracks in the vicinity of Jorjoga and Menanga alone. 

The coastal plain at Jorjoga and Menanga is now fully converted to coconut palm 
plantations and crop fields. Further inland, most areas below 600 m have been converted 
to orchards and gardens, although small patches of heavily degraded secondary forest 
persist in gullies. Above 600 m, there are few gardens and orchards, but forest along logging 
tracks is heavily degraded, as most of the taller trees in valleys have been removed and 
undergrowth has largely been cleared. Satellite imagery indicates that the ten logging tracks 
ascending south of Menanga and Jorjoga may have accounted for the degradation of >60% 
of montane forest habitat in these watersheds, and habitat degradation over the rest of the 
island is probably comparable, based on satellite images. 

In addition, forest fires have caused large-scale destruction of montane forest above 750 
m. According to villagers, a large fire in the 1980s (probably in 1982-83) was responsible for 
the loss of c.3,000 ha of montane forest (estimated from satellite imagery). The affected area 
covers c.70% of montane forest south of Jorjoga and Menanga, which is now characterised 
by grassy pasture with little bush growth and the presence of many tall old burnt snags. 
That little regrowth is observed in these areas >20 years after the incident indicates that 
some damage might have been permanent or is reinforced periodically through smaller 
fires. During my highland visits/only one small patch (c.100 ha) of dwarf montane forest 
above 1,000 m was found that had neither been affected by fires or logging, and this 
harboured a distinct avifauna undetected elsewhere on the island (see species accounts). 
Although more such habitat may persist elsewhere away from logging tracks, the threats 
posed by logging and fire mean that such habitat may be now very scarce and its specialised 
avian community therefore endangered. 

Discouragingly, government prospectors were present during my stay, investigating 
the potential of the sub-montane and montane zone south of Jorjoga for conversion to 
plantation crops. Any future agricultural conversion would place further strain on the 
island's natural communities. 



Frank E. Rheindt 



37 



Bull. B.O.C. 2010 130(1) 



Species accounts 

The following accounts relate new elevational, distributional, ecological or taxonomic 
information. Other species encountered but not mentioned below are listed in Table 1. 

MEYER'S GOSHAWK Accipiter meyerianus 

Single adults on 7, 9 and 12 April 2009, with a pair on 8 April 2009. Most sightings might 
involve the same two birds, generally at c. 1,000 m, with a sighting at 700 m perhaps being 
an additional individual. Birds were heard briefly giving a courtship vocalisation (ki ki 
ki ki ki) but no sound-recording was obtained. Photographs of two birds were taken at 
1,000 and 700 m, respectively (e.g. Fig. 2). All sightings were of birds perched on exposed 
branches in single tall trees within logged forest. My sightings of this unobtrusive raptor 
were probably made at a fortuitous season when a breeding pair was vocally and visually 
conspicuous. Their size, Accipiter shape and jizz, solid slate-grey upperparts and densely 
but weakly barred underparts, and the distinctive vocalisations, eliminate the possibility 
of a misidentification. These are the first records in the Sula Islands (White & Bruce 1986, 
Coates & Bishop 1997) and the westernmost of a species considered endemic to New 
Guinea and the Moluccas. Its occurrence on Taliabu suggests that the Moluccan element of 
the highland avifauna of the Sula Islands is more pronounced than anticipated. The only 
Accipiter previously assumed to occur on Taliabu is the much smaller Vinous-breasted 
Sparrowhawk A. rhodogaster sulaensis. Given that most Indo-Pacific islands possess 2-3 
resident Accipiter species of different sizes, the occurrence of larger A. meyerianus next to 
smaller A. rhodogaster sulaensis is unsurprising, although one might have expected a second 
Accipiter on Taliabu to be another Sulawesi element (e.g. Spot-tailed Goshawk A. trinotatus). 
Given my records of A. meyerianus on Taliabu, the presumption that A. rhodogaster sulaensis 
constitutes a Sulawesi element must be verified. Pronounced plumage differences exist 
between A. r. rhodogaster of mainland Sulawesi and A. r. sulaensis (Coates & Bishop 1997; 
pers. obs.), and their conspecificity might not withstand phylogenetic scrutiny. 

SULA SCRUBFOWL Megapodius bemsteinii 

Only two brief sightings, of singles flushed at c.50 m and 400 m in dense bamboo undergrowth 
and degraded secondary forest, respectively. Endemic to the Sula and Banggai islands 
(White & Bruce 1986), previous field work had shown the species to occur up to 250 m in 
Taliabu (Davidson et al. 1991), but my record and information from villagers in Binadesa 
indicate that it might reach 200-300 m higher. According to the same villagers M. bemsteinii 
is intensively hunted for its tasty meat and its eggs are taken for human consumption. It 
must now be exceedingly rare on Taliabu given dramatic habitat degradation, hunting and 
egg collecting. An indication of its apparent decline is the scarcity of records during the 
present survey compared with the encounter rates by Davidson et al. (1991) and F. Verbelen 
(pers. comm.). Fishermen from Jorjoga (in north Taliabu) reported that the species has 
declined steeply on its tiny nesting islands off the north coast (e.g. Samada Besar) where it 
was formerly common. Nonetheless, the species' persistence in dense secondary bamboo 
thickets in the vicinity of villages indicates that it might be somewhat resistant to habitat 
destruction. But, given that undisturbed habitat at its preferred elevations has been reduced 
to tiny fragments, there are probably no large populations that could source re-expansions 
in the case of local extinctions of small populations. The situation might be equally dire 
elsewhere, e.g. in eastern Peleng in the Banggai Archipelago, where dramatic declines have 
occurred over the last decade (M. Indrawan pers. comm.). M. bemsteinii is listed as Near 



Frank E. Rheindt 



38 



Bull. B.O.C. 2010 130(1) 



TABLE 1 

Species encountered on Taliabu (excluding seabirds close to shore), but not mentioned in the main text. 



Species 

Great-billed Heron Ardea sumatrana 

Brahminy Kite Haliastur indus 

Sulawesi Serpent Eagle Spilomis rufipectus sulaensis 

Rufous-bellied Eagle Hieraaetus kienerii 

Vinous-breasted Sparrowhawk Accipiter rhodogaster sulaensis 

Spotted Kestrel Falco moluccensis 

Common Sandpiper Actitis hypoleucos 

Emerald Dove Chalcophaps indicus 

Silver-tipped Imperial Pigeon Duciria luctuosa 

Maroon-chinned Fruit Dove Ptilinopus subgularis mangoliensis 

Black-naped Fruit Dove P. melanospila chrysorrhoa 
Grey-cheeked Green Pigeon Treron griseicauda 
Yellow-and-green Lorikeet Trichoglossus flavoviridis flavoviridis 
Golden-mantled Racquet-tail Prioniturus platurus sinerubris 
Moluccan King Parrot Alisterus amboinensis sulaensis 
Black-billed Koel Eudynamys melanorhynchus 
Great Eared Nightjar Eurostopodus macrotis macropterus 
Sulawesi Nightjar Caprimulgus celebensis jungei 

Glossy Swiftlet Collocalia esculenta 

White-throated Needletail Hirundapus caudacutus 

Ruddy Kingfisher Halcyon coromanda sulana 

Collared Kingfisher H. chloris 

Sacred Kingfisher H. sancta 

Variable Dwarf Kingfisher Ceyx lepidus wallacii 

Common Dollarbird Eurystomus orientalis 

Rainbow Bee-eater Merops ornatus 

Grey Wagtail Motacilla cinerea 

Pacific Swallow Hirundo tahitica 

Sula Cicadabird Coracina sula 

Sulawesi Triller Lalage leucopygialis 

Slender-billed Crow Corvus enca mangoli 

Arctic Warbler Phylloscopus borealis 

Henna-tailed Jungle Flycatcher Rhinomyias colonus colonus 

Grey-streaked Flycatcher Muscicapa griseisticta 

Little Pied Flycatcher Ficedula westetmanni 

Common Golden Whistler Pachycephala pectoralis clio 

Ivory-backed Woodswallow Artamus monaehus 

Bare-eyed Myna Streptocitta albertinae 

Moluccan Starling Aplonis mysolensis sulaensis 
Helmeted Myna Basiloruis galeatus 
Brown-throated Sunbird Anthreptes malacensis extremus 
Olive-backed Sunbird Cinm/ris jugularis robustirostris 
Black Sunbird Leptocoma sericea auriceps 
Grey-sided Flowerpecker Dicaeum celebicum sulaense 
Black-faced Munia / onclumi Molucca 



Comment 

One near Jorjoga 

1+1 

Minimum of two adults at 800 m 
One adult at 200 m 



Common to minimum of 400 m 
Up to 200 m 

Common by voice to 1,100 m although shy 
and affording few good views 

Common to 1,100 m 

Common to c.250 m 

Common to 1,100 m 

Up to 1,100 m, common higher up 

A few sightings at 0-700 m 

Not seen, only heard twice 

Common in lowlands 

Brief sighting at 50 m; vocalisations (similar to 
those of nominate race) heard twice 

1+1 

A few sightings to 500 m 

1- 2 at 50 m 
3-4 at sea level 
Several at 0-500 m 

2- 3 at 50 m 

Common 

Common at 0-1,100 m 

Common up to 100 m in degraded habitat 

Common to 150 m in degraded habitat 

Heard and seen in lowlands until 9 April 

A few sightings, mostly in bamboo, to 200 m 

Common to 1,100 m 

c.900-1,100 m 

Common 0-1,100 m 

A few sightings near the coast 

2+1; only in emergent trees in agricultural 

plantations 

Common in the lowlands 

Common and seen daily up to 1,100 m 



Common at 0-1,100 m 



Frank E. Rheindt 



39 



Bull. B.O.C. 2010 130(1) 



Threatened (Birdlife International 2009), but might merit upgrading to Vulnerable or even 
Endangered based on such potentially steep rates of decline throughout its range. 

WHITE-THROATED PIGEON Columba vitiensis halmaheira 

An adult was observed in logged forest at c.900 m and a captive bird held by villagers 
in Binadesa was photographed. The latter had been collected as a chick at an unknown 
location. Although the species was known from Taliabu (White & Bruce 1986, Coates & 
Bishop 1997), there was no previous information on its elevational range. 

SULAWESI BLACK PIGEON Turacoena manadensis 

Common in degraded orchards and secondary forest in the lowlands to 500 m, which 
constitutes a slight extension of its elevational range on Taliabu, as previous records were 
unavailable above c.300 m (Davidson et al. 1991). 

BROWN CUCKOO-DOVE Macropygia amboinensis sedecima 

Represented on the Sula Islands by an endemic subspecies (sedecima), which closely 
resembles Sulawesi M. a. albicapilla (White & Bruce 1986, Coates & Bishop 1997). Common 
to c. 1,1 00 m in a range of forest habitats. Previous records of this subspecies have all been 
from below c.300 m (Davidson et al. 1991), thus my records considerably extend this taxon's 
elevational range. 

GREEN IMPERIAL PIGEON Ducula aenea sulana 

Common to c. 1,000 m in a range of forest habitats. The local taxon D. a. sulana is restricted 
to the Banggai and Sula groups but closely resembles Sulawesi D. a. paulina (White & Bruce 
1986, Coates & Bishop 1997). Davidson et al (1991) recorded it below c.400 m on Taliabu, 
thus my records constitute a considerable elevational extension. 

WHITE-BELLIED IMPERIAL PIGEON Ducula forsteni 

Common from sea level to at least 1,100 m in secondary logged forest to undisturbed 
forest, although it tended to be much commoner in the latter. Above 800 m, the species 
was extremely abundant in the afternoons, with up to 80 seen in flight together. Previous 
records from Taliabu were not made above 200 m (Davidson et al. 1991). My records 
indicate that this pigeon's distribution on Taliabu is centred at higher elevations rather than 
near the coast. 

SULA HANGING PARROT Loriculus sclateri sclateri 

Collar's (2007) treatment of Sula Hanging Parrot L. sclateri as distinct from the Moluccan 
Hanging Parrot L. amabilis is adopted here. Nominate L. s. sclateri is endemic to the Sula 
Islands, whereas L. s. ruber occurs on the Banggai Islands. Previously published records of 
the nominate subspecies range up to c.250 m (Davidson et al. 1991), but I found L. s. sclateri 
common in degraded forest to at least 750 m, indicating a wider elevational range. 

RUSTY-BREASTED CUCKOO Cacomantis sepulcralis (virescens?) 

Seen and heard on several occasions in disturbed forest from near sea level to c. 1,000 
m. Sound-recordings were obtained twice (e.g. Fig. 3). Previous field workers have not 
remarked on the elevational occurrence of this species on Taliabu (Davidson et al. 1991, 
Coates & Bishop 1997). My records suggest a wide elevational distribution on Taliabu. 

The taxonomy of Rusty-breasted Cuckoo C. sepulcralis of South-East Asia and the 
closely related Brush Cuckoo C. variolosus of the Australo-Papuan region is confusing. 



Frank E. Rheindt 



40 



Bull. B.O.C. 2010 130(1) 



White & Bruce (1986) resurrected the original treatment as two species. For a long time 
before — and occasionally afterwards (e.g. Payne 1997, 2005) — they were usually considered 
conspecific, but more recent work indicates that more than two species might be involved 
(e.g. Rheindt & Hutchinson 2007). Most taxa in the C. sepulcralis / variolosus complex possess 
two common vocalisation types: (1) a trisyllabic series repeated at rising frequencies, 
sometimes to the typical feverish pitch of Cacomantis cuckoos; and (2) a series of single call 
notes usually repeated at level frequency. Despite the general uniformity of these two vocal 
types across the complex, there appear to be consistent differences in their delivery among 
named taxa (pers. obs.). One, C. s. aeruginosas from the southern Moluccas (i.e. Bum and 
Seram), frequently utters a very distinct variant of the second call type that is superficially 
dissimilar from other C. sepulcralis vocalisations. This unusual variant was illustrated by 
Rheindt & Hutchinson (2007) as a series of several dozen notes — partially level and partially 
rising — in stark contrast to the usually shorter level call series given by C. variolosus and 
other subspecies of C. sepulcralis. Vocally, C. s. aeruginosus appears more different from the 
remaining taxa of this complex than other subspecies of C. sepulcralis are from C. variolosus. 
However, C. s. aeruginosus on Seram has also been heard giving the typical short and level 
variant of the second call type (pers. obs.; R. O. Hutchinson pers. comm.), although rate of 
delivery might be more rapid than in other subspecies (R. O. Hutchinson pers. comm.). A 
comprehensive bio-acoustic or genetic study of all major taxa, including C. s. aeruginosus, is 
urgently required to clarify their evolutionary history. 

Birds on the Sula Islands were attributed to the southern Moluccan taxon C. s. 
aeruginosus by White & Bruce (1986) and Coates & Bishop (1997). If corroborated, this would 
be an unusual biogeographic pattern in which the Sula population is considered more akin 
to a taxon from the southern Moluccas rather than to neighbouring taxa on Sulawesi or the 
northern Moluccas. However, given the highly unusual voice of C. s. aeruginosus compared 
to Sulawesi C. s. virescens at least, this taxonomic arrangement can be tested in the field. 
Sound-recordings from Taliabu obtained by me constituted short level series' very similar 
in sonographic appearance and delivery timing to those of C. s. virescens (Fig. 3), and very 
unlike the long call series of C. s. aeruginosus (cf. Rheindt & Hutchinson 2007). Additionally, 
F. Verbelen (pers. comm.) obtained identical recordings in March 1997. Although it cannot 
be eliminated that Taliabu birds utter the long call series of C. s. aeruginosus at other seasons, 
the short call series presented in Fig. 3 does not appreciably differ from C. s. virescens. It 
could be argued that the patterns noted here are more parsimoniously explained by the 
affinity of Taliabu birds to C. s. virescens rather than to C. s. aeruginosus, although vocal 
samples from other seasons are desirable. 

White & Bruce (1986) reported wintering Australian C. variolosus on Taliabu, making 
confusion with this taxon a confounding factor. While the short level series uttered by C. 
variolosus is acoustically similar to vocal type 2 in most subspecies of C. sepulcralis (see 
above), they possess a different sonographic signature with tilda-shaped (rather than hook- 
shaped) individual call elements (Fig. 3; see also www.xeno-canto.org/asia). Birds recorded 
on Taliabu do not exhibit the tilda-shaped notes characteristic of C. variolosus, but the hook- 
shaped ones of C. s. virescens (Fig. 3A). Moreover, the present records from as early as 5 
April, and especially F. Verbelen's (pers. comm.) March records, would be unusually early 
for migrant C. variolosus this far north. 

LESSER COUCAL Centropus bengalensis javanensis 

Common in disturbed second growth, especially grassy pastures, from sea level to c.1,000 
m. The species must have become common on Taliabu following widespread anthropogenic 
habitat conversion. Previously recorded only in the lowlands (Davidson et al. 1991), it was 



Frank E. Rheindt 



41 



Bull. B.O.C. 2010 130(1) 



found in grassy pastures in the burnt highlands during my survey. Over large areas of 
montane grasslands it was generally the only bird species detected, indicating that the 
species quickly colonises grassy habitat at any elevation and also supporting the notion 
that montane grasslands on Taliabu are of recent fire-induced origin, with few bird species 
having adapted to them. 

TALIABU MASKED OWL Tyto nigrobrunnea 

Seen twice and photographed (Fig. 4) in dense secondary bamboo thickets near Binadesa at 
c.50 m, and seen in heavily logged forest with no understorey at c.900 m. Its voice — a hissing 
sound typical of the genus — was heard but not sound-recorded at both sites. Previously 
recorded just twice: (1) when the holotype was collected in 1938 and (2) a sight record along 
a logging track in the lowlands by Davidson et al. (1991). T. nigrobrunnea is assumed to be 
forest-dependent and might have declined in recent decades due to habitat destruction 
(Davidson et al. 1991). However, my records suggest it can occupy second growth and 
bamboo thickets in the vicinity of habitation. Villagers at Binadesa know T. nigrobrunnea 
well, and frequently see and hear it nearby. My survey produced three records, despite that 
nocturnal surveys were discontinued following the first sighting, suggesting the species 
would have been recorded more frequently given appropriate effort. The lack of records 
by previous visitors might be attributable to its shy and nocturnal habits, or to seasonal 
vocal inactivity. Considered endemic to Taliabu, future work on Mangole and perhaps 
Sanana should reveal its presence. Given its broad elevational range in disturbed habitat, 
T. nigrobrunnea is probably not threatened. One reason that.T. nigrobrunnea has successfully 
adapted to disturbed habitats could be the absence of an open-country congener. On other 
islands (e.g. Sulawesi) with more than one Tyto species, forest-dependent taxa appear 
unable to colonise disturbed habitats because their open-country congeners have already 
filled that ecological niche. 

SULA SCOPS OWL Otus sulaensis 

I follow a study by King et al. (submitted) in recognising Sula Scops Owl O. sulaensis as a 
species distinct from Moluccan Scops Owl O. magicus and Banggai Scops Owl O. mendeni. 
The rationale for this is the distinct vocalisation of O. sulaensis compared to O. magicus 
and — to a much lesser extent — O. mendeni. During my survey, the species proved common 
from sea level to at least 1,100 m in forest ranging from disturbed to primary. Ecological data 
for O. sulaensis is limited on account of the confused taxonomic history of Otus populations 
on the Sula Islands. Davidson et al. (1991) repeatedly encountered an Otus in forest up to 800 
m, but attributed their sightings to a potentially undescribed taxon, whilst stating that 'O. 
m. sulaensis [was] not recorded by the expedition'. Undoubtedly, they were confused by the 
highly distinct vocalisations of this owl, which do not bear any resemblance to O. magicus. 

UNIFORM SWIFTLET Aerodramus vanikorensis 

Several flocks, from near sea level to over 1,100 m, with the first sighting on 10 April 
2009. These flocks were observed feeding over habitats ranging from palm plantations 
to undisturbed montane forest. Identification was unequivocal, as the birds did not 
exhibit any white or otherwise pale area on the rump. Special consideration was given to 
Moluccan Swiftlet A. infuscatus from the northern Moluccas as a potential confusion risk, 
as its pale rump is not always readily visible. However, my records involved flocks of 
dark-rumped birds seen in very good light from ideal observation points, often feeding 
side-by-side with Glossy Swiftlet Collocalia esculenta. The latter appeared much smaller and 
displayed a contrasting white belly and green to blue gloss unlike the more uniformly drab 



Frank E. Rheindt 



42 



Bull. B.O.C. 2010 130(1) 



A. vanikorensis. On several occasions A. vanikorensis was observed uttering a distinctive 
chattering vocalisation in flight, as I had heard from the species elsewhere. Mine are the first 
observations on the Sula Islands. The species is probably widespread there, but might have 
been overlooked due to difficulties in identification. It has recently been recorded on the 
Banggai Islands (Rheindt et al. submitted), indicating that its Wallacean distribution could 
be much more extensive than generally assumed. 

GREY-RUMPED TREESWFT Hemiprocne longipennis wallacii 

Common in a range of secondary forest and agricultural habitats from sea level to c.800 
m, with large flocks regular at a logging camp at 800 m in heavily logged forest, where the 
species might breed. Davidson et al. (1991) reported it from the lowlands of Taliabu, but the 
species is clearly more extensively distributed over the island. 

RED-BELLIED PITTA Pitta erythrogaster dohertyi 

Only three visual encounters during the survey, but it was commonly heard to at least 600 
m. P. e. dohertyi has adapted to heavily disturbed secondary forest and bamboo thickets, 
albeit at presumably reduced densities, and was often heard in bamboo around Binadesa. 
Previous records from Taliabu were all from below 200 m (Davidson et al. 1991), thus my 
records indicate a wider elevational range. I follow White & Bruce (1986), Coates & Bishop 
(1997) and Erritzoe (2003) in considering P. e. dohertyi from the Sula and Banggai islands as 
a race of Red-bellied Pitta P. erythrogaster, but it has been treated specifically, as Sula Pitta 
P. dohertyi, by Sibley & Monroe (1990), Davidson et al (1991) and Lambert & Woodcock 

Legends to figures on opposite page 

Figure 2. Meyer's Goshawk Accipiter meyerianus, Taliabu, April 2009 ( F. E. Rheindt) 

Figure 3. Sonogram of the calls of Rusty-breasted Cuckoo Cacomantis sepulcralis and Brush Cuckoo C. 
variolosus from various parts of their range. X-axis = time in seconds (0.5 seconds per tick), y-axis = frequency 
in kHz (2 kHz per tick). All three sonograms are at identical scale. A: C. sepulcralis (probably virescens) Taliabu 
(1,000 m), by F.E. Rheindt; B: C. s. virescens Lore Lindu National Park (central Sulawesi), by D. Farrow 
(source: www.xeno-canto.org/asia); C: C. variolosus Roti Island (Nusa Tenggara), by Colin Trainor (source: 
www.xeno-canto.org/ asia). 

Figure 4. Taliabu Masked Owl Tyto nigrobrunnea, Taliabu, April 2009; note the dark suffusion to the facial 
mask (F. E. Rheindt) 

Figure 5. Island Thrush Turdus poliocephalus, at 1,050 m on Taliabu, April 2009; note the uniformly dark head 
and belly that set it apart from neighbouring T. p. deningeri from Seram (which has a pale head) and various 
taxa on Sulawesi (which have reddish belly tones) (F. E. Rheindt) 

Figure 6. Sonograms of vocalisations of Bradypterus bush warblers. X-axis = time in seconds (0.5 seconds 
per tick), y-axis = frequency in kHz (2 kHz per tick). All sonograms are at identical scale. (A) Taliabu' Bush 
Warbler Bradypterus sp. by F. E. Rheindt (April 2009, Taliabu); (B) Benguet Bush Warbler B. seebohmi by R. 
O. Hutchinson (February 2007, Mount Polis, Luzon, Philippines); (C) Russet Bush Warbler B. mandelli by 
D. Farrow (no date, Thailand, source: www.xeno-canto.org/asia); (D) Chestnut-backed Bush Warbler B. c. 
castaneus by P. Noakes (September 2006, Lore Lindu, central Sulawesi; source: www.xeno-canto.org/asia); 
(E) Chestnut-backed Bush Warbler B. c. musculus by R. O. Hutchinson (September 2006, Kobipoto Ridge, 
Seram). Dark areas beiow 5 kHz in sonogram A are mechanical sound pollution from equipment. Note 
that the undescribed Taliabu birds (A) more closely resemble B. mandelli (C) in terms of frequency (centred 
around 6 kHz), and resemble B. mandelli (C) and B. seebohmi (B) in exhibiting a single repeated call element, 
as opposed to the B. castaneus complex (D, E) whose vocalisations involve 2-3 call elements given in rapid 
succession. In acoustic impression, Taliabu birds are most similar but not identical to B. mandelli. 

Figure 7. Undescribed taxon belonging to the Island Leaf Warbler Phylloscopus poliocephalus complex; note the 
all-yellow underparts (including throat). Colours have not been modified using photo-editing software; even 
so, the underparts of this individual appear especially yellow in comparison to most others seen on Taliabu 
during the survey (F. E. Rheindt) 

Figure 8. Mountain White-eye Zosterops montanus, Taliabu, April 2009; note the white or pale grey belly that 
aligns this population with the nominate subspecies (F. E. Rheindt) 

Figure 9. Adult male Sulawesi Myzomela Myzomela chloroptera, laliobu, April 2009; note the lack of apparent 
plumage differences from the populations on Sulawesi (by F. E. Rheindt) 



Frank E. Rheindt 



44 



Bull. B.O.C. 2010 130(1) 



(1996) based on head coloration, other minor plumage details and an allegedly distinctive 
vocalisation. However, Erritzoe (2003) dismissed the plumage differences as insufficient 
given that plumage variation in other P. erythrogaster taxa is considerable. Furthermore, 
studies of the Banggai population of P. e. dohertyi (Rheindt et al. submitted) suggest that the 
vocalisation cited by Lambert & Woodcock (1996) as evidence for elevating P. e. dohertyi to 
species status is a secondary vocalisation used by many P. erythrogaster taxa, and that P. e. 
dohertyi also utters the well-known main vocalisation of the species. Splitting P. e. dohertyi 
therefore appears unwarranted for now. 

SLATY CUCKOOSHRIKE Coracina schistacea 

Endemic to the Banggai and Sula islands, this species was common from near sea level to at 
least 1,100 m, especially in degraded and logged montane forest, but also in disturbed forest 
at lower elevations, often accompanying its endemic congener Sula Cicadabird Coracina 
sula. My records extend the elevational range on Taliabu from that reported by Davidson et 
al. (1991) and demonstrate that the species might be commoner at higher elevations. 

NORTHERN GOLDEN BULBUL Thapsinillas longirostris longirostris 

Common in most degraded and undisturbed habitats from near sea level to at least 1,100 
m. Davidson et al. (1991) recorded it up to 800 m on Taliabu, but they did not ascend any 
higher than this. Photographs and sound-recordings made during my survey should 
assist future workers to elucidate the confused taxonomy of the Golden Bulbul complex. 
I follow Fishpool & Tobias (2005) and Rheindt & Hutchinson (2007) in considering taxa 
from the northern Moluccas, Sangihe, Sula, Banggai and Togian islands as a species, T. 
longirostris, distinct from taxa in the southern Moluccas. The taxon on the Sula Islands is 
T.l. longirostris. Preliminary comparisons of sound-recordings made during various visits 
to northern Wallacea suggest that T. longirostris might comprise several species, given 
consistent differences in their plumage and vocals, akin to the differences shown between 
taxa that comprise Fishpool & Tobias's (2005) Southern Golden Bulbul T. affinis (Rheindt & 
Hutchinson 2007). However, a comprehensive bio-acoustic or genetic analysis of all these 
northern taxa is needed before any further splits can be proposed. 

HAIR-CRESTED DRONGO Dicrurus hottentottus pectoralis 

Common in varied habitats, from disturbed orchards to undisturbed montane forest from 
near sea level to over 1,100 m. Davidson et al. (1991) reported it as common in forest up to 
800 m (the highest elevation these authors attained). In the absence of any recent taxonomic 
revision, I follow traditional taxonomy as proposed by Vaurie (1949) and slightly modified 
by White & Bruce (1986), wherein most Moluccan and Sulawesi drongos are divided into two 
species, Hair-crested Drongo D. hottentottus in the west and Spangled Drongo D. bracteatus 
in the east. However, Rheindt & Hutchinson (2007) suggested that this probably does not 
reflect true species limits and requires fresh analysis using bio-acoustic and / or genetic 
data. More detailed work is especially relevant in respect of the endemic Sula taxon D. h. 
pectoralis, which is considered part of the same species as neighbouring D. h. leucops from 
Sulawesi, despite being much smaller and differing greatly in iris colour and vocalisations 
(Coates & Bishop 1997; pers. obs.). In appearance, D. //. pectoralis appears relatively distinct 
for a drongo and more closely resembles D. bracteatus taxa from the Moluccas than its 
Sulawesi neighbour (Coates & Bishop 1997). Molecular analysis might reveal D. h. pectoralis 
to represent a genetically distinct lineage that merits treatment at species level. 



Frank E. Rheindt 



45 



Bull. B.O.C. 2010 130(1) 



BLACK-NAPED ORIOLE Oriolus chinensis frontalis 

Represented on the Banggai and Sula islands by an endemic race, O. c. frontalis, previous 
Sula records were all from below 300 m on Taliabu (Davidson et al. 1991), yet I found O. c. 
frontalis common in degraded and logged forests and orchards to c.800 m. 

ISLAND THRUSH Turdus poliocephalus (undescribed subspecies) 

On 8, 9, 14 and 15 April 2009, singles were seen in a patch of dense montane dwarf forest 
at c. 1,050 m. Initially noted by its alarm call, which resembles that of a Eurasian Blackbird 
Turdus merula, around noon on 8 April, with the first sighting c.3 hours later. All sightings 
were made in a radius of 200 m. On 9 April 2009, a photograph was taken in heavy rain (Fig. 
5), which shows the plumage coloration of the bird involved. 

This is the first record of Island Thrush T. poliocephalus from the Sula Islands, despite 
that it is widespread on numerous islands in the Australo-Pacific region, where it is 
generally — but not always — restricted to dwarf forest at the treeline or in alpine bushland 
and grassland above this (Clement & Hathway 2000, Collar 2005). The geographically most 
proximate subspecies of T. poliocephalus to Taliabu are T. p. deningeri from Seram and T. p. 
hygroscopus and T. p. celebensis from south-west and south Sulawesi, respectively. However, 
the two Sulawesi taxa are complemented by two more potential subspecies from central 
and eastern Sulawesi as yet undescribed (White & Bruce 1986, Coates & Bishop 1997, Collar 
2005). The Island Thrush complex is not only characterised by substantial morphological 
variability, but also by a leapfrogging pattern in which taxa with allied plumage traits are 
irregularly distributed (Collar 2005). From Fig. 5, it is evident that the population on Taliabu 
does not resemble any of its close neighbours, its head being uniformly dark (not pale grey 
as in T. p. deningeri on Seram) and its underparts lacking any of the reddish tones of the 
taxa from Sulawesi. Thus, the Taliabu population warrants subspecific recognition once 
specimens have been collected. Although several geographically distant races from as far 
afield as the Philippines and New Guinea resemble the new population in plumage (Collar 
2005), its closest affinities can only be determined genetically, as the dark ventral and head 
plumage exhibited by Taliabu birds might be an ancestral character lost in neighbouring 
subspecies. A genetic analysis by Jones & Kennedy (2008) showed that several similar races 
of Island Thrush from the Philippines are not each other's closest relatives. 

The Taliabu population of T. poliocephalus must be rare. Appropriate elevations were 
visited on nine days, yet the species was seen just four times and heard a few more. More 
significantly, all encounters were in a small area of dwarf montane forest at 1,050 m, 
which tract was the only one encountered during my survey. Other areas at appropriate 
elevations were either burnt grassland and bushland, resulting from recent forest fires, or 
had been partially logged and lacked a true understorey. Although T. poliocephalus is known 
to inhabit natural alpine grassland elsewhere (e.g. New Guinea), it does not occur in the 
extensive recently created grasslands in the highlands of Taliabu. 

The discovery of a new taxon of T. poliocephalus on Taliabu indicates that other islands 
might also hold new populations of this species. As T. poliocephalus usually occurs near 
the treeline or higher, it is often under-recorded by ornithologists, many of whom do not 
ascend sufficiently high during surveys. If T. poliocephalus occurs at just over 1,000 m on 
Taliabu, other Wallacean islands with even higher elevations could harbour habitat suitable 
for the species. Future searches should concentrate on Halmahera and its satellites (such as 
Bacan and Obi) or Buru. Higher mountains in the interior of Bum have long been neglected 
by ornithologists but were visited recently by an ornithological expedition (Rheindt & 
Hutchinson 2007) that did not quite attain altitudes suitable for T. poliocephalus, whilst the 



Frank E. Rheindt 



46 



Bull. B.O.C. 2010 130(1) 



highlands of Halmahera, Bacan and Obi are notoriously under-studied despite the large 
number of recreational birdwatchers visiting Halmahera in pursuit of its lowland species. 

'TALIABU BUSH WARBLER' Bradypterus sp. 

On 9 April 2009, following a long heavy rain shower, an unfamiliar vocalisation reminiscent 
of Russet Bush Warbler Bradypterus mandelli was briefly heard from a patch of dense montane 
dwarf forest at c.1,050-1,100 m. The vocalisation was instantly recognised as a Bradypterus, 
a montane genus not previously recorded on the Sula Islands. It was not heard again that 
day, but a few days later, and after searching other (fire-impacted) highland sites without 
success, I revisited the same forest on 14-15 April. Despite rain and little vocal activity, I 
heard this bush warbler ten more times. Song bouts were usually too short (<30 seconds) 
to approach the bird closely, but once on 15 April a close bird was briefly seen in the dense 
undergrowth. Its coloration appeared typical of the genus, brown with a well-developed 
white supercilium. The bird appeared large, especially compared to Chestnut-backed Bush 
Warbler B. castaneus from Sulawesi, which was seen just a few days before and after my 
visit to Taliabu. However, these morphological traits require confirmation. No photographs 
were obtained, but low-quality sound recordings were made, the best of which (Fig. 6A) 
was used to lure the bird that was seen. 

Bradypterus is represented in northern Wallacea by the B. castaneus complex: B. c. 
castaneus on Sulawesi, B. c. musculus on Seram and B. c. disturbans on Buru (White & Bruce 
1986, Coates & Bishop 1997). Whilst the nominate form is well known from several sites on 
Sulawesi, the taxa on Seram and Buru have — until recently — been almost unknown and 
biological data are scarce. Rheindt & Hutchinson (2007) documented the vocalisation and 
plumage of B. c. musculus from Seram and concluded that it can hardly be included in the 
same biological species as B. c. castaneus. However, due to the lack of sound-recordings and 
photographs of the geographically intermediate B. c. disturbans from Buru, they did not 
propose species status for B. c. musculus, despite that the vocalisations of B. c. disturbans do 
not sound like B. c. castaneus or B. c. musculus. 

The bush warbler on Taliabu exhibits a highly distinct vocalisation typical of the 
genus by virtue of its insect-like quality, but acoustically distinct from any of the B. 
castaneus complex (see Fig. 6; differences from B. c. disturbans based on pers. obs.). In terms 
of frequency and structure, its song more closely resembles B. mandelli from the Asian 
mainland or one of its island offshoots, such as B. seebohmi from the Philippines (Fig. 6). 
However, this would hardly warrant placing the Taliabu birds with that species, as there 
are pronounced differences in element spacing and note shape between them, rendering 
any resemblance superficial at most (Fig. 6). 

Based on the bio-acoustic evidence, this new Bradypterus probably deserves species 
status. Its evolutionary origins and genetic affinities require elucidation. The superficial 
resemblance to the B. seebohmi / mandelli complex (rather than the geographically adjacent 
B. castaneus complex) may point to its true affinities, or might be an artefact based on 
convergence or the retention of ancestral vocal traits. Molecular methods are required to 
resolve its phylogenetic relationships, and its formal description would benefit from the 
addition of such analysis. 

Taliabu' bush warbler must be rare. I found it in just one tract of montane dwarf 
forest, despite ample search effort in other areas at suitable elevations especially to find this 
bird. Most areas above 1,000 m accessed by me were heavily degraded with a disturbed 
understorey due to logging using heavy machinery. However, an even greater threat is 
probably posed by the recent large-scale destruction of highland forest by fire, which has 
accounted for r.70% of montane forest in the watersheds investigated during my survey 



Frank E. Rheindt 



47 



Bull. B.O.C. 2010 130(1) 



(estimated from GoogleEarth satellite imagery). Once it is formally described, this bush 
warbler might require Red Data listing. 

MOUNTAIN TAILORBIRD Orthotomus cuculatus (undescribed subspecies?) 
Davidson et al. (1991) presented the first records for the Sula Islands, and described the 
species as inhabiting montane forest above 500 m. I found it common in disturbed (less 
commonly within intact) montane forest to over 1,100 m, with a few records in dense 
secondary bamboo thickets down to 50 m. The species is apparently naturally absent 
from lowland forest but tolerates lower elevations in degraded bamboo. Davidson et al. 
(1991) considered it probable that the Taliabu birds require recognition at subspecies level. 
In Wallacea, O. cuculatus is currently subdivided into many island races, with Sulawesi 
possessing several races and additional unnamed populations that perhaps require 
taxonomic recognition, despite being generally poorly differentiated (White & Bruce 1986, 
Coates & Bishop 1997). It is therefore conceivable that the Taliabu birds should be named. 
Genetic and bio-acoustic studies should shed light on whether the current taxonomic 
treatment of this species in Wallacea is appropriate. 

ISLAND LEAF WARBLER Phylloscopus [poliocephalus] (undescribed taxon) 
Davidson et al. (1991) were the only previous ornithologists to find a resident population 
of Phylloscopus leaf warbler on Taliabu, which they found to be common in montane forest 
above 750 m and which they considered to represent an undescribed subspecies of the 
polytypic Island Leaf Warbler P. poliocephalus. During my field work, this leaf warbler 
was common in degraded to less-disturbed montane forest from 700 to at least 1,100 m. 
Poor to average photographs (e.g. Fig. 7) and good sound-recordings were obtained. 
Rheindt & Hutchinson (2007) asserted that the P. poliocephalus complex probably consists of 
several species-level insular taxa and presented evidence for dramatic vocal and plumage 
differences between two constituent taxa, P. p. everetti from Buru and P. p. ceramensis from 
Seram. Rheindt & Hutchinson (2007) did not propose any splits, because some relevant taxa 
have not yet been sampled bio-acoustically, and they recommended that taxonomic revision 
should be based on comprehensive vocal and / or genetic analyses of most constituent taxa. 
Preliminary comparison of vocal and photographic material from Taliabu with Rheindt & 
Hutchinson's (2007) material from Buru and Seram suggests that the Taliabu birds cannot 
be unambiguously assigned to either of the two southern Moluccan taxa. It is probable 
that future bio-acoustic analysis will reveal the Taliabu birds to form a biological species 
apart from the rest of the P. poliocephalus complex. Once specimens become available, 
formal description of the birds on Taliabu should be undertaken in combination with a 
detailed acoustic, morphological and — if possible — genetic comparison with the rest of the 
complex. 

MOUNTAIN WHITE-EYE Zosterops montanus (undescribed subspecies?) 
Davidson et al. (1991) discovered this species in montane forest on Taliabu above 800 m and 
speculated that it replaces the common lowland Black-fronted White-eye Z. atrifrons sulaensis 
at higher altitudes. Mountain White-eye Z. montanus is widespread in the Indonesian and 
Philippine archipelagos, and has been divided into numerous insular subspecies (Mees 1957, 
van Balen 2008). In Wallacea, two prominent plumage types exist: (1) yellow-bellied birds 
on Ternate, Tidore and Seram which are usually considered as Z. m. obstinatus; (2) white- 
bellied birds in the Lesser Sundas, Sulawesi and Buru, which are treated as nominate Z. m. 
montanus by most authors (e.g. van Balen 2008). I found Z. montanus common in montane 
forest and bushland from 750 m to over 1,100 m, with two records from 650 m. Across this 



Frank E. Rheindt 



48 



Bull. B.O.C. 2010 130(1) 



range, Z. montanus was commonly sympatric with Z. atrifrons sulaensis and was even seen in 
the same mixed-species flocks, although Z. montanus usually kept to lower vegetation. The 
two species therefore do not replace each other elevationally, although they do largely keep 
to different strata. Photographs (Fig. 8) reveal that the Taliabu population is white-bellied 
(or pale grey-bellied) akin to neighbouring populations on Sulawesi and Bum, making it 
best to attribute it to nominate Z. m. montanus for now. Genetic analysis might reveal that 
Wallacean populations currently attributed to nominate montanus are distinct. Since the 
holotype of Z. montanus is from Sumatra, this name would no longer apply to the subspecies 
in Wallacea, in which case Taliabu birds might be subsumed with either those on Buru or 
Sulawesi, or be recognised subspecifically, as suggested by Davidson et al. (1991). For now, 
such treatment would be premature and retention of all white-bellied Wallacean forms in 
the nominate subspecies appears preferable. 

BLACK-FRONTED WHITE-EYE Zosterops atrifrons sulaensis 

Davidson et al. (1991) found this species only in the lowlands and thought it was replaced 
by Z. montanus in montane forest. I found it common on Taliabu from near sea level to over 
1,100 m, and the species is widely sympatric with Z. montanus, although it generally keeps to 
higher strata in the forest. Rasmussen et al. (2000) concluded that the endemic Z. a. sulaensis 
exhibits significant differences from the Sulawesi races, Z. a. atrifrons and Z. a. surda, in terms 
of eye-ring width and dawn song vocalisations, but stopped short of elevating Z. a. sulaensis 
to species level because of a lack of vocal data for the Banggai subspecies Z. a. subatrifrons, 
which is intermediate in plumage traits. More recently, Rheindt et al. (submitted) found that 
vocally Z. a. subatrifrons differs vastly from the Sula and Sulawesi taxa, thereby supporting 
elevation of Z. a. sulaensis to species level, given the lack of vocal intermediacy between 
birds on Sula and elsewhere. 

SNOWY-BROWED FLYCATCHER Ficedula hyperythra (undescribed subspecies?) 
One adult male in the interior of undisturbed primary montane dwarf forest at c.1,100 m. 
Discovered on Taliabu by Davidson et al. (1991), who recorded it in montane forest above 
800 m. Its scarcity during my survey could be due to the species' unobtrusive habits, and 
because intact montane forest interior was difficult to access via logging tracks. Davidson et 
al. (1991) contended that the Taliabu population may warrant recognition at subspecies level. 
In fact, Wallacean populations are split into a variety of poorly differentiated subspecies, 
each endemic to its own island or even peninsula, as in various Sulawesi races (White & 
Bruce 1986, Coates & Bishop 1997). Before naming the Taliabu population, a genetic analysis 
or — at the very least — a detailed morphological and bio-acoustic investigation involving 
most taxa from Wallacea, and beyond, is needed. 

ISLAND VERDITER FLYCATCHER Eumyias panayensis (undescribed subspecies?) 
Common from near sea level to c. 1,000 m. Its song — primarily given at dawn and dusk — 
revealed it to be common in disturbed orchards and secondary forest, although it was also 
found in more undisturbed montane and submontane forest. Onlv recently discovered on 
Taliabu, where Davidson et al. (1991) thought it largely restricted to above 800 m, with a 
single sighting in the lowlands. My records indicate that it is more common in the lowlands 
than assumed by Davidson et al. (1991), who might have overlooked it at lower elevations, 
or perhaps E. panayensis has recently increased due to habitat disturbance, which could 
have induced birds to move downslope into edge habitats. 

E. panayensis is patchily distributed throughout the Philippines and northern Wallacea, 
occurring on most larger and random smaller islands in the region. In Wallacea four poorly 



Frank E. Rheindt 



49 



Bull. B.O.C. 2010 130(1) 



differentiated subspecies endemic to individual islands or even peninsulas, as on Sulawesi, 
are recognised (White & Bruce 1986, Coates & Bishop 1997). For convenience, the Taliabu 
population is currently assigned to E. p. septentrionalis from north and central Sulawesi by 
most authors, although Davidson et al. (1991) suggested that it might merit recognition 
as an endemic subspecies. Formal description of this population should be attempted as 
part of a detailed morphological and bio-acoustic analysis — potentially aided by genetic 
enquiry — to ascertain whether the current taxonomic treatment of this species in Wallacea 
is appropriate. 

BLACK-NAPED MONARCH Hypothymis azurea blasii 

This species — represented on Taliabu by H. a. blasii (which is endemic to the Sula and 
Banggai groups) — was common from near sea level to c.900 m in habitats ranging from 
orchards to undisturbed forest. Previous data on the elevational range of this subspecies 
exclusively refer to the lowlands, with Davidson et al. (1991) recording the species 'not . . . 
above c. 300 m'. My records considerably extend its range into the highlands. 

ISLAND MONARCH Monarcha cinerascens cinerascens 

Previous workers did not find this species on Taliabu above 200 m (Davidson et al. 1991), 
but I recorded it in degraded orchards to older secondary forest from near sea level to c.900 
m, indicating a wider elevational range than was assumed. 

RUSTY-BELLIED FANTAIL Rhipidura teysmanni sulaensis 

Represented on the Sula Islands by the endemic R. t. sulaensis (White & Bruce 1986, 
Coates & Bishop 1997), Davidson et al. (1991) recorded it on Taliabu into montane forest. 
I encountered it from the lowlands to at least 1,100 m, and sound-recordings were 
obtained. Preliminary comparison of these with recordings of other R. teysmanni taxa and 
an undescribed population from the Banggai Islands suggest that R. t. sulaensis is vocally 
distinct (Rheindt et al. submitted). 

CITRINE CANARY-FLYCATCHER Culicicapa helianthea helianthea 

Common in degraded to undisturbed forest from the lowlands to c.800 m. Davidson et al. 
(1991) recorded it in ' . . . lowland forest types . . . ' only, but my survey demonstrates that 
its elevational range on Taliabu is wider. 

DRAB WHISTLER Pachycephala griseonota lineolata 

On the Sula Islands represented by the potentially endemic race P. g. lineolata. Davidson et 
al. (1991) reported it in Towland forest types' throughout Taliabu, but I found it common 
from near sea level to c.1,000 m. A good photograph of a female was taken at c.900 m, 
indicating that the species is by no means restricted to lowlands on Taliabu. 

SULAWESI MYZOMELA Myzomela chloroptera (undescribed subspecies?) 
I follow Salomonsen (1967), and thereafter Wolters (1979), Rheindt & Hutchinson (2007) 
and Higgins et al. (2008), in assigning species status to M. chloroptera from Sulawesi to the 
exclusion of the quite different-looking Wakolo Myzomela M. wakoloensis, Banda Myzomela 
M. boiei and Scarlet Myzomela M. sanguinolenta. Sulawesi Myzomela was first recorded on 
Taliabu by Davidson et al. (1991) who considered it a common inhabitant of montane forest 
above 800 m. I found the species abundant (with one photographed, Fig. 9) in montane 
forest to at least 1,100 m, but sporadic records were also made at tall flowering trees in the 
lowlands above c.100 m, indicating a wider elevational range than previously assumed. 



Frank E. Rheindt 



50 



Bull. B.O.C. 2010 130(1) 



Davidson et al. (1991) suggested that Taliabu birds might be subspecifically distinct from 
M. chloroptera on Sulawesi, but I did not notice any consistent plumage differences between 
them. A more detailed morphological investigation — and molecular analysis — is needed to 
establish whether the Taliabu population merits taxonomic recognition. 

BLUE-FACED PARROTFINCH Erythrura trichroa 

An individual apparently of this species was briefly seen in logged secondary forest at 900 
m. It was initially detected giving an extremely high-pitched note, before alighting on a bare 
branch where it remained for no longer than one second. The tiny size, green overall colour 
and relatively heavy-based bill were noted, but the sighting was too brief to be conclusive. 
Not previously recorded on the Sula Islands, but occurrence is conceivable, given that it 
occurs in montane forest to the west (Sulawesi) and east (in the Moluccas: White & Bruce 
1986). Future workers should look for the species on Taliabu. 

Acknowledgements 

I am indebted to Pak Obrin and other villagers from Binadesa for their hospitality during my stay and for 
guiding me to the central highlands of Taliabu. Ditta-Sofie Rheindt is thanked for financially supporting my 
expedition. For some comparative vocal material utilised here, I thank R. O. Hutchinson and the various 
recordists who have deposited their material in the Xeno-canto online sound library (www.xeno-canto.org/ 
asia). Murray Bruce deserves warm thanks for his invaluable input that helped improve the manuscript 
considerably. I also thank the following (in alphabetical order) for helpful criticism of the manuscript: James 
A. Eaton, Robert O. Hutchinson, Guy Kirwan and Filip Verbelen. 

References: 

van Balen, S. 2008. Family Zosteropidae (white-eyes). Pp. 402-485 in del Hoyo, J., Elliott, A. & Christie, D. A. 

(eds.) Handbook of the birds of the world, vol. 13. Lynx Edicions, Barcelona. 
Becker, J. J., Sandwell, D. T., Smith, W. H. F., Braud, J., Binder, B., Depner, J., Fabre, D., Factor, J., Ingalls, S., 

Kim, S.-H., Ladner, R., Marks, K., Nelson, S., Pharaoh, A., Sharman, G., Trimmer, R., von Rosenburg, J., 

Wallace, G. & Weatherall, P. 2009. Global bathymetry and elevation data at 30 arc seconds resolution: 

SRTM30_PLUS. Marine Geodesy 32: 355-371. 
Bintanja, R., van de Wal, R. S. W. & Oerlemans, J. 2005. Modelled atmospheric temperatures and global sea 

level over the past million years. Nature 437: 125-128. 
BirdLife International. 2009. Species factsheet: Megapodius bernsteinii. www.birdlife.org (accessed 5 June 

2009). 

Caputo, R. 2007. Sea level curves: perplexities of an end-user in morphotectonic applications. Global & 

Planetary Change 57: 417-423. 
Clement, P. & Hathway, R. 2000. Thrushes. Christopher Helm, London. 

Coates, B. J. & Bishop, K. D. 1997. A field guide to the birds ofWallacea. Dove Publications, Alderley. 

Collar, N. J. 2005. Family Turdidae (thrushes). Pp. 514-810 in del Hoyo, J., Elliott, A. & Christie, D. A. (eds.) 

Handbook of the birds of the world, vol. 10. Barcelona, Lynx Edicions. 
Collar, N. J. 2007. Taxonomic notes on some insular Loriculus hanging-parrots. Bull. Brit. Orn. CI. 127: 

97-107. 

Davidson, P. J. & Stones, T. 1993. Birding in the Sula Islands. Oriental Bird Club Bull. 18: 59-63. 

Davidson, P. J., Lucking, R. S., Stones, A. J., Bean, N. J., Raharjaningtrah, W. & Banjaransari, H. 1991. Report 

on an ornithological survey of Taliabu, Indonesia. Univ. of East Anglia, Norwich. 
Davidson, P. J., Stones, T. & Lucking, R. S. 1995. The conservation status of key bird species on Taliabu and 

the Sula Islands, Indonesia. Bird Conserv. Intern. 5: 1-20. 
Erritzoe, J. 2003. Family Pittidae (pittas). Pp. 106-160 in del Hoyo, J., Elliott, A. & Christie, D. A. (eds.) 

Handbook of the birds of the world, vol. 8. Lynx Edicions, Barcelona. 
Fishpool, L. D. C. & Tobias, J. A. 2005. Family Pycnonotidae (bulbuls). Pp. 124-251 in del Hoyo, J., Elliott, A. 

& Christie, D. A. (eds.) Handbook of the birds of the world, vol. 10. Lynx Edicions, Barcelona. 
Hall, R. 2002. Cenozoic geological and plate tectonic evolution of Southeast Asia and the southwest Pacific: 

computer-based reconstructions, models and animations. /. Asian Earth Sci 20: 353-431. 
Higgins, P., Christidis, L. & Ford, H. 2008. Family Meliphagidae (honeyeaters). Pp. 498-691 in del Hoyo, J., 

Elliott, A. & Christie, D. A. (eds.) Handbook of the birds of the world, vol. 13. Lynx Edicions, Barcelona. 
ICBP. 1992. Putting biodiversity on the map: priority areas for global conservation. International Council for Bird 

Preservation, Cambridge, UK. 
Jones, A. W. & Kennedy, R. S. 2008. Plumage convergence and evolutionary history of the Island Thrush in 

the Philippines. Condor 110: 35-44. 



Frank E. Rheindt 



51 



Bull. B.O.C. 2010 130(1) 



King, B., Sangster, G. & Yong, D. submitted. The taxonomic status of Otus (magicus) sulaensis and Otus (m.) 

mendeni, two poorly known scops owls from Wallacea. Bull. Brit. Orn. CI. 
Lambeck, K. & Chappell, J. 2001. Sea level change through the last glacial cycle. Science 292: 679-686. 
Lambert, F. & Woodcock, M. 1996. Pittas, broadbills and asities. Pica Press, Robertsbridge. 
Mees, G. F. 1957. A systematic review of the Indo- Australian Zosteropidae, part 1. Zool. Verh. Leiden 35: 

1-204. 

Payne, R. B. 1997. Family Cuculidae (cuckoos). Pp. 508-607 in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.) 

Handbook of the birds of the world, vol. 4. Lynx Edicions, Barcelona. 
Payne, R. B. 2005. The cuckoos. Oxford Univ. Press. 

Rasmussen, P. C., Wardill, J. C., Lambert, F. R. & Riley, J. 2000. On the specific status of the Sangihe White- 
eye Zosterops nehrkorni, and the taxonomy of the Black-crowned White-eye Z. atrifrons complex. Forktail 
16: 69-80. 

Rheindt, F. E. & Hutchinson, R. O. 2007. A photoshot odyssey through the confused avian taxonomy of 

Seram and Bum (southern Moluccas). BirdingASIA 7: 18-38. 
Rheindt, F. E., Verbelen, F., Putra, D. D., Rahman, A. & Indrawan, M. submitted. New biogeographic records 

in the avifauna of the Banggai Islands (Sulawesi), including notes on species and subspecies limits in 

some endemic taxa. Bull. Brit. Orn. CI. 
Salomonsen, F. 1967. Family Meliphagidae, honeyeaters. Pp. 338-450 in Paynter, R. A. (ed.) Check-list of birds 

of the world, vol. 12. Mus. Comp. Zool., Cambridge, MA. 
Sibley, C. G. & Monroe, B. L. 1990. Distribution and taxonomy of the birds of the world. Yale Univ. Press, New 

Haven, CT. 

Siddall, M., Rohling, E. J., Almogi-Labin, A., Hemleben, C., Meischner, D., Schmelzer, I. & Smeed, D. A. 2003. 

Sea-level fluctuations during the last glacial cycle. Nature 423: 853-858. 
Stattersfield, A. J., Crosby, M. J., Long, A. J. & Wege, D. C. 1998. Endemic Bird Areas of the world: priorities for 

biodiversity conservation. BirdLife International, Cambridge, UK. 
Stones, A. J., Lucking R. S., Davidson P. J. & Raharjaningtrah W. 1997. Checklist of the birds of the Sula 

Islands, with particular reference to Taliabu. Kukila 9: 37-55. 
Sujatnika, Jepson, P., Soehartono, T. R., Crosby, M. J. & Mardiastuti^ A. 1996. Indonesian biodiversity: the 

Endemic Bird Area approach. BirdLife International, Jakarta. 
Thompson, W. G. & Goldstein, S. L. 2005. Open-system coral ages reveal persistent suborbital sea-level 

cycles. Science 308: 401-404. 
Vaurie, C. 1949. A revision of the bird family Dicruridae. Bull. Amer. Mus. Nat. Hist. 93: 199-342. 
White, C. M. N. & Bruce, M. D. 1986. The birds of Wallacea (Sulawesi, the Moluccas and Lesser Sunda Islands, 

Indonesia): an annotated checklist. British Ornithologists' Union, Tring. 
Wolters, H. E. 1979. Die Vogelarten der Erde, bd. 4. Paul Parey, Hamburg. 

Address: Harvard University, Department of Organismic and Evolutionary Biology, 26 Oxford Street, 
Cambridge, MA 02138, USA. 



© British Ornithologists' Club 2010 



Andrew C. Vallely et al. 



52 



Bull. B.O.C. 2010 130(1) 



Notes on the birds of the Rio Platano Biosphere Reserve, 
including four new species for Honduras 

by Andrew C. Vallely, Robert J. Gallardo & John S. Ascher 

Received 7 July 2009 

SUMMARY. — We detail records of 27 rare or poorly known species from the Rio 
Platano Biosphere Reserve (RPBR) in eastern Honduras. Four of these, Fasciated 
Tiger Heron Tigrisoma fasciatum, Grey-rumped Swift Chaetura cinereiventris, Striped 
Woodhaunter Hyloctistes siibiilatus and Wing-banded Antbird Myrmornis torquata 
have not previously been reported from Honduras. 

The Caribbean slope lowlands and lower foothills of Central America form an area of 
endemism for birds (Peterson et al. 1998) and have been subject to ornithological investigation 
for over a century (Salvin & Godman 1879-1904). Despite this, most ornithological work has 
focused on easily accessible sites in southern Central America such as Barro Colorado Island 
in Panama (Karr 1990) and La Selva in Costa Rica (Slud 1960). Although humid lowland 
rainforest extends from eastern Honduras south and east to Panama, the true extent of 
many Caribbean slope bird species' ranges are poorly documented due to the difficulty of 
access to this region. Eastern Honduras hosts an extensive area of Caribbean slope humid 
forest, but is incompletely known to ornithologists (Marcus 1983, Anderson et al. 2004). 
Within this region, the Rio Platano Biosphere Reserve (RPBR) encompasses 5,250 knr in 
dptos. Gracias a Dios, Colon and Olancho, and spans the elevational range from sea level 
to 1,500 m. The RPBR, together with adjacent protected areas including Tawahka-Asangni 
Biosphere Reserve, Sierra de Agalta National Park, the proposed Patuca National Park, 
Rus Rus Biosphere Reserve, and Bosawas Biosphere Reserve in adjacent Nicaragua, form 
the largest remaining wilderness in Central America. This region is sparsely populated, 
with an estimated 3-5 human inhabitants / km 2 , and includes extensive uninhabited areas. 
Because past anthropogenic alterations have been limited in extent, the area offers valuable 
opportunities to both researchers and conservationists. Previous investigations of the RPBR 
have concentrated on areas near the village of Las Marias (Marcus 1983, Anderson et al. 
1998, 2004). To date, 496 bird species have been reported from the reserve (RJG pers. obs.). 
Below, we detail observations of 27 species, mostly from the upper drainage of the rio 
Platano, within the forested core of the RPBR, including two genera and four species not 
previously reported from Honduras. 

Methods 

We visited the upper drainage of the rio Platano during 28 March-4 April 2002 (RJG), 
11-21 April 2003 (RJG), 30 July-11 August 2006 (ACV and RJG), 8-27 June 2008 (ACY and 
JSA), 3-14 February 2009 (RJG) and 22 April-2 May 2009 (ACV and RJG). During each visit, 
we searched for birds, primarily in humid lowland rainforest adjacent to the rio Platano. We 
estimated canopy height of the upper rio Platano forest at c.20-25 m and noted numerous 
large emergents over 35 m. The understorev was typically dense along the floodplain of the 
rio Platano and its tributaries, often with stands of palms, large-leaved herbs and lianas. 
Adjacent steep slopes and uplands hosted a more open understorev, in manv areas with 
abundant rock outcrops. Most observations were made opportunisticallv along a network 
of existing trails and passable watercourses. During 8-27 Time 2008, we supplemented 



Andrew C. Vallely et al. 



53 



Bull. B.O.C. 2010 130(1) 




Rio Platano Biosphere Reserve 

district boundaries 

500 m contour 

Figure 1. Map showing the location of the RPBR in Central America and the localities mentioned in the text: 
(1) La Carrizalosa camp, (2) La Cueva Camp, (3) El Subterraneo camp, (4) Pomokir camp, (5) Las Marias, 
(6) Eden, Nicaragua (7) Siuna, Nicaragua, (8) Peha Blanca, Nicaragua, (9) Cordillera de Guanacaste, Costa 
Rica. 



this with a small number of mist-net captures. Coordinates for individual sites within 
the RPBR follow: La Carrizalosa Camp, Colon 15°19'56.13 ,, N, 85°16'37.58"W; La Cueva 
camp, Colon 15°20 / 52.53"N / 85°U'51.50"W; El Subterraneo camp, Colon 15°26'06.48"N, 
85°03'56.28"W; Pomokir camp, Colon 15°28'33.68"N, 84°59'53.82"W; Las Marias, Gracias 
a Dios 15°40'01.06"N, 84°53'51.92"W. The locations of these and most other localities 
mentioned in the text are presented in Fig. 1. 

Species accounts 
FASCIATED TIGER HERON Tigrisoma fasciatwn 

A scarce and local species mostly considered to range no further north than the Caribbean 
slope of Costa Rica (e.g. AOU 1998, Marunez-Vilalta & Motis 1992) where it was not 
documented until 1952 (Slud 1964). Whilst Hancock & Kushlan (1984) and Hancock (1999) 
mapped it in north-east Honduras, the source of this is unclear. ACV & RJG encountered 
an adult T. fasciatum on 1 August 2006 in the upper drainage of the rio Platano. ACV & JSA 
closely observed and photographed an adult at La Cueva camp on 16 June 2008, and an adult 
was seen briefly just below El Subterraneo camp on 19 June 2008. During 22 April-3 May 
2009 ACV & RJG encountered at least three in the upper watershed and obtained several 
photographs (Fig. 1; images will also be archived at the Visual Resources for Ornithology 
[VIREO] collection, Philadelphia) below El Subterraneo camp, a range extension of >400 km 
from the nearest locality, the Cordillera de Guanacaste, Costa Rica (Stiles & Skutch 1989). 



Andrew C. Vallely et al. 



54 



Bull. B.O.C. 2010 130(1) 



BLACK-AND-WHITE HAWK-EAGLE Spizaetus melanoleucus 

Monroe (1968) listed just three records of this poorly known hawk from Honduras, and the 
species is generally regarded as scarce and local over its extensive range. Anderson et al. 
(1998) reported two encounters in the RPBR. We have three additional records. ACV & JSA 
observed an adult soaring over El Subterraneo camp on 17 June 2008. ACV & RJG observed 
two, also in the upper watershed, in late April 2009. 

GREAT GREEN MACAW Ara ambiguus 

Rare and local in Central America, and considered hypothetical in Honduras by Monroe 
(1968), who mentioned a sight record from Olancho. A. ambiguus was subsequently reported 
from Honduras by Marcus (1983, 1984) and by Anderson et al. (2004), who encountered 
the species regularly along the lower rio Platano. A. ambiguus is considered Endangered 
by BirdLife International (2009), who note that it is 'now rare in the rio Platano'. We 
encountered A. ambiguus, including groups of up to six, during each of our visits to the 
upper rio Platano. Systematic surveys to determine the size and extent of the rio Platano 
population are lacking, but the RPBR might represent an important global stronghold for 
this species given the pace and extent of forest loss elsewhere on the Caribbean slope of 
Central America. 

CRESTED OWL Lophostrix cristata 

This widespread species was first reported from Honduras by Monroe (1968) and was 
subsequently considered rare in the country (Bonta & Anderson 2002). On 6 July 2007 and 
13-15 January 2008, RJG recorded L. cristata by voice near Las Marias in the RPBR. 

SHORT-TAILED NIGHTHAWK Lurocalis semitorquatus 

This widespread species was first recorded in Honduras in 1988 (Howell & Webb 1992) and 
has been considered rare in the country (Bonta & Anderson 2002). On 9 February 2009, RJG 
observed one at dusk in the upper drainage of the rio Platano at Pomokir camp. Next day, 
RJG observed two at dusk downriver of Pomokir camp. 

GREY-RUMPED SWIFT Chaetura cinereiventris 

This widespread species was thought likely to occur in eastern Honduras by both Marcus 
(1983) and Anderson et al. (2004), but has not previously been reported north of Nicaragua 
(AOU 1998, Chantler 1999). The northernmost previous record was a specimen taken by T. R. 
Howell 18 km north-east of Siuna, in the Region Autonoma del Atlantico Norte, Nicaragua, 
on 26 June 1954 (University of California Los Angeles, Dickey Collection 35031). We found 
C. cinereiventris common and conspicuous in the upper drainage of the Rio Platano, with 
flocks of 10-25 observed on most days during most visits to the area. We distinguished C. 
cinereiventris from the locally less common Vaux's Swift C. vauxi by the cool grey rump 
contrasting strongly with the darker mantle. This is the first record of C. cinereiventris for 
Honduras, and represents a northward range extension of >200 km. 

SNOWCAP Microchera albocoronata 

Scarce and local, Snowcap is endemic to Central America and was first reported from 
Honduras by Monroe (1968), who detailed sight records from dpto. El Parafso. Anderson 
et al. (2004) considered it 'likely to occur' in the Honduran Moskitia region. RJG first 
encountered a single in the RPBR on 14 April 2003. On subsequent visits, we have found 
it to be fairly common in the upper watershed and, during 9-20 June 2008, we recorded 
3-5 daily near El Subterraneo and La Carrizalosa camps. The presence of several moulting 



Andrew C. Vallely et al. 



55 



Bull. B.O.C. 2010 130(1) 



immature males during the latter period suggests that mid June might represent the end 
of the local breeding season. M. albocoronata is thought to undertake local or elevational 
seasonal movements elsewhere in its range (Stiles & Skutch 1989). We did not encounter it 
in the RPBR during late July / early August 2006. We photographed an immature male near 
La Cueva camp in June 2008 (Fig. 3). 

KEEL-BILLED MOTMOT Electron carinatum 

This scarce and local species is endemic to the Caribbean slope of Central America, and 
is considered Vulnerable by BirdLife International (2009). Anderson et ah (2004) drew 
attention to the importance of the Honduran Moskitia as a probable population stronghold 
for the species. We detected several by voice in the upper drainage of the no Platano, and 
photographed one at La Cueva camp on 15 June 2008, which image will be archived at 
VIREO. 

GREAT JACAMAR Jacamerops aureus 

Long thought to range no further north than Costa Rica (AOU 1998), this widespread but 
scarce species was first reported from Honduras in 2004 (Jones 2004) when RJG videotaped 
one in the Tawahka-Asangni Reserve, dpto. Gracias a Dios. The first records for Nicaragua 
were summarised by Munera-Roldan et al. (2006). Following decades of habitat destruction, 
/. aureus is thought to be declining in Central America (e.g. in Costa Rica: Sigel et al. 2005). 
ACV & JSA detected one by voice at La Cueva camp in the upper drainage of the no Platano 
on 14 June 2008. 

WHITE-FRONTED NUNBIRD Monasa morphoeus 

This widespread species reaches its northernmost limit in eastern Honduras (AOU 1998, 
Rasmussen & Collar 2002). It remains poorly known in Central America and is thought to 
have declined at several well-studied Caribbean slope sites (e.g. La Selva, Costa Rica: Sigel 
et al. 2005). The persistence of this species in Central America may depend on the survival 
of large, continuous blocks of lowland forest such as those protected by the RPBR. We have 
encountered small numbers of M. morphoeus in the upper drainage of the no Platano during 
each of our visits, including groups of 3-8 individuals. 

STRIPED WOODHAUNTER Hyloctistes subulatus 

Known in north-east Nicaragua from a handful of specimens taken by W. B. Richardson 
in 1908-09, including the type of H. s. nicaraguae (Miller & Griscom 1925), one of two 
birds obtained at Rio Grande, a locality believed to be in dpto. Matagalpa (Lecroy & Sloss 
2000). A third specimen of H. subulatus was taken by Richardson at Tena Blanca', which 
locality is thought to be in east-central dpto. Jinotega (J. C. Martinez Sanchez pers. comm., 
but see Anderson 2000). H. subulatus has not previously been reported from Honduras, 
but was regarded as 'likely to occur' in the Honduran Moskitia by Anderson et al. (2004) 
and was also expected by Marcus (1983). ACV & JSA observed one near La Cueva camp 
on 15 June 2008 as it foraged within an forest interior mixed-species flock. It was seen for 
c. 15-20 seconds as it probed in suspended litter and vine tangles in the midstorey. On 23 
April 2009, ACV & RJG encountered a single H. subulatus, and obtained a sound-recording 
(deposited at the Macaulay Library of Natural Sounds, Cornell University, Ithaca). The 
precise locations of W. B. Richardson's localities have proven difficult to determine (Lecroy 
& Sloss 2000; J. C. Martinez Sanchez pers. comm.). Assuming that 'Pena Blanca' is correctly 
traced to dpto. Jinotega, our records represent a >200 km northerly range extension. This is 
the first report of this genus and species from Honduras. 



Andrew C. Vallelv et al. 



56 



Bull. B.O.C. 2010 130(1) 




Figure 2. Fasciated Tiger Heron Tigrisqma fasciatum, Rio Platano Biosphere Reserve, Honduras, April 2009 
(James Adams) 

Figure 3. Immature male Snowcap Microchera albocoronata, Rio Platano Biosphere Reserve, Honduras, June 
2008 (John S. Ascher) 

Figure 4. Male Tawny-crested Tanager Tachyphomis delatrii, Rio Platano Biosphere Reserve, Honduras, June 
2008 (John S. Ascher) 

Figure 5. Carmiol's Tanager Chlorothraupis carmioli, Rio Platano Biosphere Reserve, Honduras, June 2008 
(John S. Ascher) 



FASCIATED ANTSHRIKE Cymbilaimus lineatus 

This species reaches its northernmost limit in eastern Honduras, where specimens are 
available from Arenal, Olancho (Monroe 1968). C. lineatus was considered rare in the 
Honduran Moskitia by Anderson et al. (2004). We saw one on 10 June 2008 at La Carrizalosa 
camp, and detected another by voice on 15 June 2008 at La Cueva camp. 

WING-BANDED ANTBIRD Myrmornis torquata 

Rare and local in Central America, where it is very infrequently reported away from eastern 
Panama. M. torquata is known in Nicaragua from specimens collected by W. B. Richardson, 
including several from Tena Blanca' (dpto. Jinotega, see above). An additional specimen 
was collected in Nicaragua in 1922 at Eden, in the Region Autonoma del Atlantico Norte 
(Huber 1932). Recent sight records from southern Nicaragua were presented bv Cody (2000) 
and Munera-Roldan et al. (2007). In Honduras, M. torquata was considered 'likely to occur' 
in the Moskitia by Marcus (1983) and Anderson et al. (2004). JSA observed one in the upper 
drainage of the rio Platano above La Cueva camp on 14 June 2008. On 25 April 2009, xACV & 
RJG returned to the same site and photographed a male M. torquata (photograph deposited 



Andrew C. Vallely et al. 



57 



Bull. B.O.C. 2010 130(1) 



at VIREO) in tall humid forest surrounded by steep slopes and extensive limestone outcrops. 
These are the first records of the genus and species for Honduras and represent a northward 
range extension of c.200 km from the nearest known locality, Eden, Nicaragua. 

GOLDEN-CROWNED SPADEBILL Platyrinchus coronatus 

Thought to be rare in the Honduran Moskitia by Anderson et al. (2004), who listed two 
specimens from Las Marias. We found P. coronatus to be fairly common in the upper 
drainage of the rio Platano with multiple individuals encountered on most visits to the 
area. 

SPECKLED MOURNER Laniocera rufescens 

Scarce and local in Central America, and regarded as rare in the Honduran Moskitia by 
Anderson et al. (2004). Monroe (1968) considered it 'exceedingly rare' in Honduras, noting 
just four specimens from the country. We found L. rufescens to be locally fairly common in 
the upper drainage of the rio Platano near La Carrizalosa, La Cueva and Pomokir camps, 
with multiple individuals encountered during most visits to the area. 

LOVELY COTINGA Cotinga amabilis 

This Central American Caribbean slope endemic was described as uncommon to locally 
common in Honduras by Monroe (1968). Following decades of habitat destruction, C. 
amabilis is thought to be declining in Central America (e.g. in Costa Rica: Sigel et al. 2005) 
and is now uncommon to rare and local (Snow 2004). RJG observed an adult male in the 
upper drainage on 3 April 2003 and ACV observed an adult male at La Cueva camp on 13 
June 2008. 

SNOWY COTINGA Carpodectes nitidus 

This scarce cotinga is endemic to the Caribbean slope of Central America. It was first 
reported from Honduras by Bangs (1903), who collected several near La Ceiba, an area 
that has since undergone extensive habitat degradation and from where there are no 
recent reports. C. nitidus has declined at several well-studied sites (Sigel et al. 2005). We 
encountered several during each of our visits to the upper rio Platano watershed. 

THREE-WATTLED BELLBIRD Procnias tricarunculatus 

A Central American endemic first reported from the Honduran Moskitia by Anderson et al. 
(2004), who detailed observations made during February-March 1999 along the rio Patuca, 
dpto. Gracias a Dios. P. tricarunculatus is considered Vulnerable by BirdLife International 
(2009) and undertakes complex migrations (Powell & Bjork 2004). These movements, 
particularly those undertaken by northern populations, remain incompletely understood. 
RJG heard singing P. tricarunculatus on 13 April 2003 in the Waraska Valley (near La 
Carrizalosa camp). ACV & RJG encountered several singing male bellbirds during late July 
2006 in the upper drainage of the rio Platano (in the vicinity of La Cueva camp). We did not 
detect the species on 8-27 June 2008 or 22 April-2 May 2009, and we tentatively conclude 
that this highland breeder reaches the RPBR as a seasonal transient, though the precise 
pattern of its occurrence remains to be fully documented. 

SONG WREN Cyphorhinus phaeocephalus 

First documented in Honduras by a single specimen taken in 1887 along the Segovia River 
in Gracias a Dios (Monroe 1968), but poorly known in the region. The few recent reports 
from Honduras include those of Marcus (1983), who encountered it along the rio Platano at 



Andrew C. ValMy et al. 



5S 



Bull. B.O.C. 2010 130(1) 



Mairin Tighni camp, and Anderson et al. (2004), who regarded the species as fairly common 
in the Honduran Moskitia. RJG obtained sound-recordings at the Sutawala Valley w ithin 
the Tawahka-Asangni Biosphere Reserve on 21-22 March 2004 (Gallardo 2008). ACV & JSA 
identified one bv voice above La Carrizalosa camp in the RPBR on 9 June 2008. 

STRIPE-BREASTED WREN Thryothorus thoracicus 

This Central American Caribbean slope endemic reaches its northern limit in eastern 
Honduras, where it is poorly known. The only previous record in Honduras is from 
Tawahka-Asangni Biosphere Reserve in 2004 (Jones 2004, Gallardo 2008). One was 
identified bv voice downriver of Las Marias bv RJG on 10 July 2007. Another was observed 
foraging in the lower midstorev with a mixed-species flock at La Cueva camp on 15 June 
2008 (ACY & JSA). These records are the northernmost reports of the species. 

BLACK-THROATED WREN Thryothorus atrogularis 

Endemic to the Caribbean slope of Central America and poorly known in Honduras, where 
first reported bv RJG, who obtained a sound-recording in the Tawahka-Asangni Biosphere 
Reserve, dpto. Gracias a Dios (deposited at the Macaulav Library of Natural Sounds, Cornell 
University, Ithaca; see Jones 2004). RJG detected one by voice in the upper watershed of the 
rfo Platano above Las Marias on 8 August 2006. This is the second record for Honduras, and 
the northernmost for the species. 

WHITE-THROATED SHRIKE-TANAGER Lanio leucothorax 

This Central American endemic reaches its northernmost limit in eastern Honduras (AOU 
1998), where it was considered rare bv Anderson et al. (2004). We found L. leucothorax to be 
an uncommon member of mixed-species flocks at forested sites in the upper watershed of 
the rfo Platano drainage, recording small numbers on each of our visits. 

TAWNY-CRESTED TANAGER Tachyphonus Matrix 

First reported from Honduras bv Marcus (1983), who encountered it on the Tusknihuas 
River in the eastern RPBR. T. delatrii was considered rare in the Honduran Moskitia 
bv Anderson et al. (2004). We found it common in the forest interior within the upper 
watershed of the rfo Platano drainage. We encountered flocks of 5-10 on most davs during 
each of our visits, and photographed a mist-netted individual in June 2008 (Fig. 4). 

CARMIOL'S TANAGER Chlorothraupis carmioli 

This widespread species was considered rare in the Honduran Moskitia bv Anderson et 
al. (2004) who detailed the first records from near Las Marias. We found C. carmioli to be a 
common and conspicuous species at forest interior sites in the upper watershed of the rio 
Platano drainage. We recorded flocks of 3—1 0 on most davs during each of our visits, and a 
mist-netted individual was photographed in June 2008 (Fig. 5). 

SLATE-COLOURED SEEDEATER Sporophila schistacea 

This widespread species is rare and irregular in the Central American portion of its range 
(Ridgely & Gwvnne 1989, Stiles & Skutch 1989, Howell & Webb 1993), and was not recorded 
in Honduras prior to 1979 (Marcus 1983). RJG noted a single on 3 April 2002 near Las 
Marias. On and around 17 April 2003, RJG found S. schistacea to be common in riparian 
growth along the no Platano, but we have not encountered the species subsequently. 



Andrew C. Vallely et al. 



59 



Bull. B.O.C. 2010 130(1) 



SLATE-COLOURED GROSBEAK Saltator grossus 

This species reaches its northern distributional limit in eastern Honduras, and was first 
reported in the country by Marcus (1983) who encountered it along the Tuskruhuas River 
in dpto. Gracias a Dios. Regarded as uncommon in the Honduran Moskitia by Bonta & 
Anderson (2002), we found S. grossus fairly common in the upper drainage of the Rio 
Platano, with several encountered during each of our visits. 

YELLOW-CROWNED EUPHONIA Euphonia luteicapilla 

Endemic to Central America and regarded as hypothetical in Honduras by Monroe (1968), 
who, mentioned sight records from dpto. Olancho. The species is still poorly known in the 
country, being described as uncommon in eastern Honduras by Bonta & Anderson (2002), 
following observations of E. luteicapilla by RJG east of the RPBR around Wampusirpe, dpto. 
Gracias a Dios in 2002. RJG closely studied a pair of E. luteicapilla along the no Platano 
above Las Marias on 9 August 2006. 

Acknowledgements 

We thank the following people, each of whom provided valuable assistance during our visits to the rfo 
Platano drainage: Arnulfo Fitoria, David Medina, Cara Stiles, Mark Willuhn and Patty Zishka. We are 
grateful to the Corporacion Hondurena de Desarrollo Forestal (COHDEFOR), and the Secretarfa de Recursos 
Naturales y Ambiente (SERNA) for granting research permits for the June 2008 expedition, and also to the 
organisation Mosquitia Pawisa Apiska (MOPAWI), who lent their support to that endeavour in innumerable 
ways. James Adams kindly shared the photograph of T.fasciatum. Paul Sweet and David L. Anderson made 
useful comments on an earlier draft. Comments from the referees, David L. Anderson and Oliver Komar, and 
the editor, also improved the final manuscript. Mary Lecroy and Juan Carlos Martinez-Sanchez graciously 
assisted us in tracing several localities in Nicaragua, and Martinez-Sanchez also patiently answered several 
queries concerning avian distributions in that country. Assistance from Terence Clarke greatly improved the 
map. We owe a debt of gratitude to Jorge & Hermino Salaverri, and the staff of La Moskitia Ecoaventuras for 
providing expert logistical support on each of our visits to the rio Platano watershed. 

References: 

American Ornithologists' Union (AOU). 1998. Check-list of North American birds. Seventh edn. American 

Ornithologists' Union, Washington DC. 
Anderson, D. L. 2000. Notes on the breeding, distribution, and taxonomy of the Ocellated Poorwill 

(Nyctiphrynus ocellatus) in Honduras. Orn. Neotrop. 11: 233-238. 
Anderson, D. L., Bonta, M. & Thorn, P. 1998. New and noteworthy bird records from Honduras. Bull. Brit. 

Orn. CI. 118: 178-183. 

Anderson, D. L., Wiedenfield, D. A., Bechard, M. J. & Novak, S. J. 2004. Avian diversity in the Moskitia region 

of Honduras. Orn. Neotrop. 15: 447-482. 
Bangs, O. 1903. Birds and mammals from Honduras. Bull. Mus. Comp. Zool. 6. 

BirdLife International. 2009. Species factsheet: Ara ambiguus. www.birdlife.org (accessed 18 May 2009). 

Bonta, M. & Anderson, D. L. 2002. Birding Honduras: a checklist and guide. Ecoarte, Tegucigalpa. 

Chantler, P. 1999. Grey-rumped Swift Chaetura cinereiventris. P. 443 in del Hoyo, J., Elliott, A. & Sargatal, J. 

(eds.) Handbook of the birds of the world, vol. 5. Lynx Edicions, Barcelona. 
Cody, M. L. 2000. Antbird guilds in the lowland rainforests of southeast Nicaragua. Condor 102: 784-794. 
Gallardo, R. J. 2008. Bird sounds of Honduras. Audio CD. Privately published by the author. 
Hancock, J. 1999. Herons and egrets of the world; a photographic journey . Academic Press, San Diego. 
Hancock, J., & Kushlan, J. 1984. The herons handbook. Harper & Row, New York. 

Howell, S. N. G. & Webb, S. 1992. New and noteworthy bird records from Guatemala and Honduras. Bull. 
Brit. Orn. CI. Ill: 42-49. 

Howell, S. N. G. & Webb, S. 1995. A guide to the birds of Mexico and northern Central America. Oxford Univ. 
Press, New York. 

Huber, W. 1932. Birds collected in northeastern Nicaragua in 1922. Proc. Acad. Nat. Sci. Philadelphia 84: 
205-249. 

Jones, H. L. 2004. The winter season, December 2003 through February 2004: Central America. North Amer. 
Birds 58: 290-292. 

Karr, J. K. 1990. The avifauna of Barro Colorado Island and the Pipeline Road, Panama. Pp 183-198 in Gentry, 
A. H. (ed.) Four Neotropical forests. Yale Univ. Press, New Haven. 



Andrew C. VaUely et al. 



60 



Bull. B.O.C. 2010 130(1) 



Lecroy, M. & Sloss, R. 2000. T^e specimens of birds in the American Museum of Natural Historv. Part 3. 

Passeriformes: Eurylaimidae, Dendrocolaptidae, Furnariidae, Formicariidae, Conopophagidae, and 

Rhinocrvptidae. Bull. Amer. Mus. Nat. Hist. 257. 
Martfnez-Vilalta, A. & Moris, A. 1991. Fasciated Tiger-Heron Tigrisomafasciatum. P. 422 in del Hovo, J., Elliott, 

A. & Sargatal, J. (eds.) Handbook of the birds of the world, vol. 1. Lynx Edicions, Barcelona. 
Marcus, M. J. 1983. Additions to the avifauna of Honduras. Auk 100: 621-629. 
Marcus, M. J. 1984. Notes on the Great Green Macaw in Honduras. Ceiba 25: 151-155. 
Miller, W. de W. & Griscom, L. 1925. Descriptions of new birds from Nicaragua. Amer. Mus. Novit. 159. 
Monroe, B. L, 1968. A distributional survey of the birds of Honduras. Orn. Monogr. 7. American Ornithologists' 

Union, New York. 

Munera-Roldan, C., Cody, M. L., Schiele-Zavala, R. H., Sigel, B., Woltmann, J. S. & Kjeldsen, J. P. 2007. New 

and noteworthy records of birds from south-eastern Nicaragua. Bull. Brit. Orn. CI. 127: 152-161. 
Peterson, A. T v Escalona-Segura, G. & Griffith, J. A. 1998. Distribution and conservation of birds of northern 

Central America. Wilson Bull. 110: 534-543. 
Powell, G. & Bjork, R. 2004. Habitat linkages and the conservation of tropical biodiversity as indicated bv 

seasonal migrations of Three-wattled Bellbirds. Conserv. Biol. 18: 500-509. 
Rasmussen, P. C. & Collar, N. 2002. White-fronted Nunbird Monasa movphoeus. P. 137 in del Hoyo, J., Elliott, 

A. & Sargatal, J. (eds.) Handbook of the birds of the world, vol. 7. Lynx Edicions, Barcelona. 
Ridgely, R. S. & Gwynne, J. A. 1989. A guide to the birds of Panama, with Costa Rica, Nicaragua, and Honduras. 

Second edn. Princeton Univ. Press. 
Salvin, O. & Godman, F. D. 1897-1904. Biologia Cenirali- Americana. Aves, vol. 3. Taylor & Francis, London. 
Sigel, B. J., Sherry, T. W. & Young, B. E. 2005. Avian community response to lowland tropical rainforest 

isolation: 40 years of change at La Selva Biological Station, Costa Rica. Conserv. Biol. 20: 111-121. 
Slud, P. 1960. The birds of Finca "La Selva" Costa Rica: a tropical wet forest locality. Bull. Amer. Mus. Nat. 

Hist. 121. 

Slud, P. 1964. The birds of Costa Rica distribution and ecology. Bull. Amer. Mus. Nat. Hist. 128. 

Snow, D. W. 2004. Lovely Cotinga Cotinga amabilis. P. 93 in del Hoyo, J., Elliott, A. & Christie, D. A. (eds.) 

Handbook of the birds of the world, vol. 9. Lvnx Edicions, Barcelona. 
Stiles, F. G. & Skutch, A. 1989. A guide to the birds of Costa Rica. Cornell Univ. Press, Ithaca, NY. 

Addresses: Andrew C. Vallely, 52 West 82nd Street, Apt. 4D, New York, NY 10024, USA, e-mail: 
andrewcvaHely@gmail.com. Robert J. Gallardo, Mariposario Alas Encantadas, CopanRuinas, Honduras, 
e-mail: rgallard032@gmail.com. John S. Ascher, Division of Invertebrate Zoology, American Museum of 
Natural History, New York, NY 10024-5192 USA, e-mail: ascher@amnh.org 



© British Ornithologists' Club 2010 



Harold F. Greeney et al. 



61 



Bull. B.O.C. 2010 130(1) 



Observations on the breeding biology of birds in 
south-east Ecuador 

by Harold F. Greeney, Mery E. Juina J:, ]. Berton C. Harris, 
Michael T. Wickens, Ben Winger, Rudy A. Gelis, Eliot T. Miller & 
Alejandro Solano-Ugalde 

Received 6 August 2009 

Summary. — Despite many years of ornithological exploration in Ecuador, we are 
still far from understanding avian nesting seasonality at a countrywide level. 
Similarly, many birds have only one, or very few, published accounts of their 
breeding. Here we present data on the reproduction of 66 species from south-east 
Ecuador, gathered opportunistically between 2004 and 2008. 

Whilst Freile et al. (2006) noted the relative paucity of information published on the 
birds of mainland Ecuador during the 20th century, recent years have seen a dramatic 
increase in the amount of published data on the breeding biology of Ecuador's avifauna. 
In particular, several important works have recently provided information for hundreds 
of species, often the first available data for Ecuador, from both the north-west (Marin & 
Carrion 1994, Greeney & Nunnery 2006, Arcos-Torres & Solano-Ugalde 2007, Solano-Ugalde 
et al. 2007) and the north-east (Greeney et al. 2004, Greeney & Gelis 2007, 2008). Breeding 
biology in Ecuador's south-west has also been fairly well documented, and shows well- 
defined seasonality (Marchant 1959, 1960, Best et al. 1993, 1996). Other than a few scattered 
studies of individual species (e.g., Schulenberg & Gill 1987, Rasmussen et al. 1996, Greeney 
& Rombough 2005, Greeney et al. 2007, Juina et al. 2009), however, the south-east has been 
relatively neglected. Nonetheless, recent reassessments of current knowledge indicate that, 
despite Greeney et al.'s (and others) recent efforts, information is still mostly anecdotal and 
many species are still undocumented (possibly still more unstudied than studied). 

Here we present breeding data for 66 bird species from the area around Tapichalaca 
Reserve (TBR, 04°30'S, 79°10'W), north of Valladolid, and adjacent to Podocarpus National 
Park, in south-east Zamora-Chinchipe Province. We gathered records opportunistically 
during field work in 2003-08, and include records from lower elevations along the 
Quebrada Honda as well as in the vicinity of the small town of Tapala. Thus, while most of 
our observations are centred on the TBR, at 2,500 m, we present data from 1,100-2,700 m in 
this area. For nests where we were able to gather significant amounts of data we describe 
our observations individually. Otherwise we present breeding records in the following 
condensed form: species, date, elevation, any incidental notes (nest status). Nest status is 
indicated by one of the following abbreviations: (B) building; (L) laying, incomplete clutch; 
(I) incubation; (N) nestling; (F) fledgling; and (AN) active nest of unknown stage. 

Species accounts 
SPOTTED BARBTAIL Premnoplex brunnescens 

On 8 October 2004 we found an empty but intact nest at 2,500 m. On 11 October we flushed 
the adult from the nest, at which time it contained a single all-white egg which measured 
22.5 x 17.0 mm and weighed 3.56 g. The nest was 1.4 m above a steep mountain stream and 
affixed into a dense clump of epiphytes and moss hanging from a large tree. We found a 



Harold F. Greeney et al. 



62 



Bull. B.O.C. 2010 130(1) 



second nest on 9 October 2004, at 2,300 m, at which time it also contained a single all-white 
egg. The egg measured 23.0 x 17.0 mm. The nest was 2 m up, directly over a stream and 
built into a shallow depression on a rock face. The first nest faced a compass direction of 
125° whilst the second was oriented 215°. Following the pattern described by Greeney 
(2009), however, the first was oriented directly upstream from the flow of the water and the 
second was oriented perpendicular to the flow of the water below the nest. This illustrates 
that this unique, and still unexplained, pattern of nest orientation is not confined to the 
population studied in north-east Ecuador. We found an additional nest with two nestlings 
on 13 October 2006 at 2,400 m. All nests showed similar architecture and variation in nest 
placement as described for this species in north-east Ecuador (Greeney 2008a) and eggs 
were similar to those described from elsewhere in Ecuador (Marin & Carrion 1994, Greeney 
& Nunnery 2006, Greeney & Gelis 2007, Greeney 2008b). 

SLATE-CROWNED ANTPITTA Grallaricula nana 
G. Mendoza found a nest with an egg on 28 
October 2006 at 2,550 m; the egg hatched on 29 
October. We measured and weighed the nestling 
from 2-10 November (Table 1). We also recorded 
parental care with a video camera for 16.3 hours 
on 5-8 November (7-10 days after hatching; 9.2 
hours during the morning and 7.1 hours in the 
afternoon). The nestling was fed at a mean rate of 
2.2 feeds / hour, and an average of 0.98 faecal sacs 
were removed per hour, all of which were eaten 
by the adults at the nest. The adults vibrated the 
nest 1.04 times / hour, leaning into the nest and 
rapidly moving their bill in and out of the lining 
in a sewing machine-like fashion (rapid probing 
sensu Greeney et al. 2008a). The adults delivered 
36 food items to the nestling comprising 21 small 
unidentified items, nine worms (Oligochaeta), 
three Lepidoptera larvae, two adult beetles (Coleoptera) and one wasp (Hymenoptera). 
On 13 November we found the decapitated body of the nestling in the nest. The nest, egg, 
nestling and parental care were similar to previous observations of this species (Greeney & 
Sornoza 2005, Greeney & Miller 2008), with the exception that faecal sacs were consumed by 
the adults at the nest, probably because the nestling was younger in the present study. 

BLACKISH TAPACULO Scytalopus latrans 

We flushed an adult from a nest on the ground on 19 August 2007 at 2,500 m and felt two 
eggs were in the nest at this time. We visited the nest every 1-3 days, and observed an adult 
carrying food to the nest for the first time on 28 August. From 28 August to 7 September we 
visited the nest every 1-2 days, observing it each visit for 1.5-3.5 hours. Two adults brought 
food to the nest. Nestling begging calls could be heard for the first time on 2 September. 
After a 30-minute observation period on 8 September with no activity, we inspected the 
nest, and found it to be empty and intact. In addition to this nest, we found another with 
two nestlings on 15 September 2007 at 2,450 m, and observed fledglings on 30 October 2007 
at 2,440 m. Our brief observations agree with those of other authors (Skutch 1972, Greeney 
et al 2005a, Greeney 2008c). 



TABLE 1 



Measurements of a nestling Slate-crowned 

Antpitta Grallaricula nana from 
Tapichalaca, Ecuador. * = not measured. 



Days after 


Mass 


Wing 


Tarsus 


hatching 


(g) 


(mm) 


(mm) 


4 


8.5 


10 


13 


5 


9 


11 


14 


6 


10 


12 


15 


7 


11.5 


12.5 


16 


8 


12.5 


14 




9 


12.5 


16 


18 


10 


14 


16 


20 


11 


15.5 


17 


21 


12 


17 


19 


22 



Harold F. Greeney et al. 



63 



Bull. B.O.C. 2010 130(1) 



CHUSQUEA TAPACULO Scytalopus parkeri 

We found a nest on 2 August 2007, at 2,500 m. The nest was built inside a natural earthen 
cavity next to a stream, 2.5 m up a bank, 4.2 m away from the streambed. On 3 August 
the nest contained two all-white eggs. We checked the nest contents on 13 and 15 August; 
both times the nest still contained two eggs. On 17 August both eggs had hatched and 
we estimated the nestlings to have been c.2 days old. We visited the nest every 1-2 days 
thereafter. During these observations, an adult Lepidoptera, a centipede (Chilopoda) and 
other unidentified invertebrates were delivered to the nestlings. At times, two adults were 
present at the nest simultaneously. We last observed the nestlings on 22 August, and by 
24 August the nest had been depredated. We found an additional nest with two eggs on 
15 November 2006 at 2,600 m. We also observed an adult carrying material to a nest on 25 
September 2007 at 2,550 m, found another on this date under construction at 2,400 m, and 
observed fledglings on 27 February 2007 and 1 November 2007, at 2,500 m and 2,450 m, 
respectively. These data agree with the scant information published for this poorly known 
tapaculo (Greeney & Rombough 2005, Greeney 2008c, Greeney & Krabbe 2009). 

CINNAMON FLYCATCHER Pyrrhomias cinnamomea 

On 7 October 2004, at 2,600 m, we found a nest containing two fresh eggs. They measured 
18.1 x 13.6 and 18.3 x 13.8 mm and weighed 1.63 and 1.66 g, respectively. Both eggs were 
white, densely spotted red-brown, most heavily at the larger end. On 17 October the nest 
contained a single nestling weighing 1.38 g, suggesting it had hatched that day. The nest 
was built in a small, sheltered niche, 2.6 m up on a rock ledge. It was a shallow, unlined cup 
of dry moss. On 19 October heavy rains caused the collapse of the bank above the nest and 
it was destroyed. We discovered an additional nest with two eggs on 14 September 2007 at 
2,550 m and a third nest with two nestlings on 29 November 2004 at 2,550 m. Both of these 
nests were also on rock faces and were similar in form to that described above. All nests and 
eggs were similar to those described by Collins & Ryan (1995) from Venezuela. 

WHITE-SIDED FLOWERPIERCER Diglossa albilatera 

On 14 October 2004, at 2,600 m, we flushed a female from a nest containing two eggs. The 
eggs were pale blue with cinnamon freckling, heaviest at the larger end. They measured 
17.7 x 13.5 and 17.7 x 13.2 mm and weighed 1.70 and 1.60 g, respectively. The nest was 
a neat cup built into a vine tangle 1.7 m above the ground. It was composed externally 
of bamboo leaves, petioles and small sticks woven together with moss. The egg cup was 
lined predominantly with Usnea sp. moss mixed sparsely with red-brown tree-fern scales 
(Cyathea sp.) and pale fibres. Externally the nest was 11 cm wide x 7 cm tall with internal 
measurements of 4 cm diameter x 4 cm deep. When we returned 14 days later the nest was 
empty. Additionally we saw a pair with a dependent fledgling on 2 November 2004 at 2,600 
m. The nest and eggs were similar to those previously described (Sclater & Salvin 1879). 

SPECTACLED REDSTART Myioborus melanocephalus 

We observed an adult carrying nest material on 31 July 2007 and subsequently discovered a 
nest with two eggs in this area on 16 August 2007. The nest was on a gently sloping hillside 
c.2 m above a trail at 2,500 m. We visited the nest every 1-3 days. Both eggs hatched around 
22 August, but on 3 September the nest was empty. The internal chamber of this nest was 
8.2 cm high and the internal measurements of the egg cup were 6.5 cm wide x 2.9 cm deep. 
We found three additional nests with two eggs on 20 September 2006 at 2,500 m, on 31 
October 2006 at 2600 m, and 12 October 2007 at 2,400 m. On 31 October 2006, at 2,550 m we 
found a nest with two nestlings. We discovered another nest under construction at 2,550 



Harold F. Greeney et al. 



64 



Bull. B.O.C. 2010 130(1) 



m on 26 August 2007 and two additional nests under construction on 18 September 2007 
at 2,400 m and 2,500 m. These nests were all similar in placement and architecture to those 
described by Greeney et al. (2008b), who also included nesting data from this area. 

BLACK-CRESTED WARBLER Basileuterus nigrocristatus 

On 6 November 2004 we found a nest with a single egg at 2,650 m. We flushed the adult and 
noted that the egg was warm but slightly damaged and appeared to be rotting. We visited 
the nest on subsequent days and always found the egg to be cold, apparently abandoned. 
The egg was white with red-brown flecking forming a ring at the larger end. It measured 
20.5 x 14.6 mm. The nest was globular, domed and built 1.2 m up in a small cavity on 
a rocky cliff face. It was composed externally of moss mixed sparsely with rootlets and 
bamboo leaves. The inner cup lining was composed of two portions: an outer portion of 
tightly compacted dry moss and an inner portion of soft, hair-like reddish tree-fern ramenta 
(Cyatheaceae). Externally it measured 17 cm wide x 15 cm tall and had a lateral entrance 6 
cm wide x 4 cm tall. There was a 12-cm lip of moss and leaves below the opening. Internally, 
the nest chamber was 8 cm tall with the egg cup measuring 5.5 cm wide x 4.0 cm deep. We 
also observed this species with dependent fledglings on 27 November 2003 (2,600 m) and 
on 5 November 2007 (2,600 m). 

The nest described here is remarkably different in composition to the only well- 
described nests of this species (Greeney et al. 2005b), which were almost entirely composed 
of dead, dry bamboo leaves (or grasses), with no well-differentiated lining. Thomas K. 
Salmon (in Sclater & Salvin 1879) also described nests built uniformly of dried materials. 
Whilst the nests described in Sclater & Salvin (1879) were also tucked into cavities, others 
(Guerrero 1996, Greeney et al. 2005b) have described nests suspended low in vegetation. 
The identification of the adult seen leaving the nest on our first visit is fairly certain, and it 
remains to be seen how much variation in nest placement and composition is displayed by 
this species. Until then, we suggest that this description be used with caution. 

RUSSET-CROWNED WARBLER Basileuterus coronatus 

On 28 October 2004, at 2,600 m, we found a nest with two white eggs with red-brown 
flecking and speckling. They measured 22.7 x 15.4 and 22.2 x 15.4 mm, and weighed 2.86 
and 2.76 g, respectively. We revisited the nest every two days and weighed the eggs on 30 
October and 1 November, noting that both were developing. During this period the eggs 
lost 0.87 and 1.06% of their original mass per day, respectively. On 3 November we found 
egg shells several metres from the nest, apparently eaten by a predator. The nest was built 
into a natural niche 0.25 m up on a bank beside a small trail. It was a globular ball of dead 
leaves and moss with an inner cup of two layers. The first layer was of loosely compacted 
tree-fern ramenta (Cyathea sp.). The second (inner) comprised tightly woven pale fibres and 
a few tree-fern ramenta. Externally the nest measured 11.5 cm wide x 15.0 cm tall and had a 
lateral opening which measured 6.5 cm wide x 7.0 cm tall. There was an 8-cm lip of material 
extending outward below the entrance. The inner chamber was 10 cm tall overall with the 
egg cup measuring 5.5 cm wide x 3.5 cm deep, internally. 

On 30 October 2004 we found a second nest at 2,500 m, which also contained two 
partially developed eggs similar to those described above, measuring 20.4 x 14.7 and 20.9 
x 14.7 mm, and weighing 2.26 and 2.32 g, respectively. We weighed them at this time and 
again on our second visit on 7 November. The eggs lost mass at a rate of 1.31 and 1.22% 
/ day, respectively. On our final visit on 16 November the nest was empty. The nest was 
built in a similar situation to the first, 1 m up on a small bank. Externally it was similarly 
composed of moss and dead leaves but the internal egg cup was slightly different. While 



Harold F. Greeney et al. 



65 



Bull. B.O.C. 2010 130(1) 



still composed of two distinct layers, the first (outer) contained fewer tree-fern ramenta 
than in the first nest, and included some pale fibres similar to those comprising the entire 
inner layer of this nest's cup. Externally the nest measured 13 cm wide x 18 cm tall with an 
internal height of only 8 cm. The cup measured 7 cm in diameter internally and was 4 cm 
deep. The lateral entrance measured 6 cm wide by only 3 cm tall. There was a 6.5-cm lip 
of material extending outward below the entrance. Compared to the first nest, it was more 
completely formed dorsally, while at the first nest the 'roof was only partially constructed 
and was instead partially formed in part by the naturally overhanging portion of the 
cavity in which it was placed. This difference is reflected by the differences in nest opening 
heights. 

On 16 August 2007 we found a nest with two eggs 0.8 m up on a slope above a small trail 
at 2,500 m. We visited the nest every 1-3 days to check on its contents. Both eggs hatched 
around 22 August. Between 26 and 27 August, however, the nest was destroyed. On 26 
August, while the nest contained two young nestlings, an adult flushed and performed a 
broken- wing display in front of the observers. The nest cup measured 7.5 cm x 5.1 cm. We 
found three additional nests, each with two eggs, on 17 September 2006, 14 October, and 14 
November 2006, at 2,600 m, 2,350 m and 2,500 m, respectively. We found nests, each with 
two nestlings, on 3 October 2006 and 31 October 2006, at 2,400 and 2,550 m, respectively. 
The nests described here are very similar in composition, architecture and placement to 
those of the only other well-described nest of this species (Greeney et al. 2005b). 

YELLOW-BILLED CACIQUE Amblycercus holosericeus 

On 1 December 2003 we found a nest at 2,500 m. It was a deep cup of dead bamboo leaves 
woven together with a few rootlets and vine tendrils. It was sparsely lined with dark rootlets 
and was attached on three sides to vertical bamboo shoots, 3.5 m above the ground. Externally 
the nest measured 13.5 cm in diameter and 9.0 cm tall. The inner portion was 7.5 cm wide x 
4.0 cm deep. Adults brought large, single prey items including a katydid (Tetigoniidae) and 
a large walking stick (Phasmida). Two days after discovery both chicks successfully fledged. 
Additionally we saw a dependent fledgling on 15 March 2007 at 2,400 m. The nest was 
similar in placement and construction to the only other described Ecuadorian nest (Greeney 
et al. 2008b), as well as to those described from Costa Rica (Skutch 1954). 

Additional records 

We also documented the following breeding information: Bearded Guan Penelope barbata, 
26 June 2007, 2,800 m (F), 14 October 2008, 2,600 m (F); White-eyed Parakeet Aratinga 
leucophthalma, 29 March 2007, 1,400 m, several pairs entering cavities on cliff face (AN); 
Green-fronted Lancebill Doryfera ludovicae, 13 June 2006, 1,750 m, 2 eggs (I); Amethyst- 
throated Sunangel Heliangelus amethysticollis, 29 August 2007, 2,500 m, 2 m above ground 
on the underside of a fern leaf, contained 2 eggs on 9 September (B); Little Sunangel H. 
micraster, 2 November 2006, 2,500 m (F); Collared Inca Coeligena torquata, 9 August 2005, 
2,500 m (F), 29 October 2007, 2,470 m (F); Crimson-mantled Woodpecker Colaptes rivolii, 
8 October 2004, 2,600 m (AN); Rufous Spinetail Synallaxis unirufa, 1 December 2003, 
2,600 m (F), 25 April 2007, 2,500 m (F), 22 August 2007, 2,500 m (B); Pearled Treerunner 

j Margarornis squamiger, 6 November 2004, 2,500 m (F), 4 November 2006, 2,600 m (F); 
Striped Treehunter Thripadectes holostictus, 20 September 2007 (2 AN at 2,300 m and 1 N 

i at 2,150 m); Olive-backed Woodcreeper Xiphorynchus triangularis, 27 June 2007, 1,800 m 

I (N); Lined Antshrike Thamnophilus tenuepunctatus, 16 January 2009, 1,400 m (AN); Long- 
tailed Antbird Drymophila caudata, 26 November 2004, 2,150 m (F); Chestnut-naped 

!; Antpitta Grallaria nuchalis, 18 October 2007, 2,430 m (F), 31 October 2007, 2,350 m (F); 



Harold F. Greeney et al. 



66 



Bull. B.O.C. 2010 130(1) 



Rufous Antpitta G. rufula, 27 September 2007, 2,650 m (B), 27 September 2007, 2,550 m, 2 
eggs (I), 29 October 2007, 2,450 m (F), 4 November 2008, 3,000 m, 2 nestlings (N); Mottle- 
backed Elaenia Elaenia gigas, 2 February 2007, 1,100 m (AN); White-tailed Tyrannulet 
Mecocerculus poecilocercus, 28 November 2004, 2,300 m (F); White-banded Tyrannulet M. 
stictopterus, 27 June 2007, 2,450 m (B); Rufous-headed Pygmy Tyrant Pseudotriccus ruficeps, 
25 February 2007, 2,450 m (F), 26 February 2007, 2,700 m (F), 16 January 2009, 2,600 m (F); 
Streak-necked Flycatcher Mionectes striaticollis, 23 April 2007, 2,400 m (F); Rufous-breasted 
Flycatcher Leptopogon rufipectus, 26 November 2004, 2,200 m, 2 nestlings (N); Black-throated 
Tody-Tyrant Hemitriccus granadensis, 5 November 2007, 2,470 m (F); Rufous-crowned 
Tody-Flycatcher Poecilotriccus ruficeps, 9 October 2004, 2,280 m, 3 m up on tip of bamboo 
shoot (B), 27 July 2007, 2,500 m (B), 2 August 2007, 2,500 m (B); Common Tody-Flycatcher 
Todirostrum cinereum, 9 October 2006, 1,600 m (B); Orange-banded Flycatcher Myiophobus 
lintoni, 6 April 2006, 2,550 m (F), 26 October 2006, 2,550 m (F), 2 November 2006, 2,550 m 
(F); Bran-coloured Flycatcher M.fasciatus, 6 April 2006, 1,150 m (B); Black Phoebe Sayornis 
nigricans, 9 October 2004, 1,800 m, 2 nestlings, 3.5 m up (N); Yellow-bellied Chat-Tyrant 
Ochthoeca diadema, 13 October 2006, 2,700 m, 2 eggs (I); Rufous-breasted Chat-Tyrant O. 
rufipectoralis, 25 November 2003, 2,600 m (F); Green-and-black Fruiteater Pipreola riefferii, 
23 April 2007, 2,450 m (B), 26 June 2007, 2,400 m (N); Chestnut-crested Cotinga Ampelion 
rufaxilla, 10 May 2007, 2,350 m, 2 nestlings (N), 11 May 2007, 2,300 m (AN); Barred 
Becard Pachyramphus versicolor, 24 August 2007, 2,450 m (B), 29 October 2006, 2,550 m (F); 
Turquoise Jay Cyanolyca turcosa, 2 December 2003, 2,650 m, one adult sitting on nest and fed 
by second adult, nest 15 m up (AN), 26 October 2007, 2,350 m, 3 adults attending 2 chicks 
in nest 20 m up over small stream (N); Blue-and-white Swallow Pygochelidon cyanoleuca, 26 
September 2007, 2,550 m (I); Mountain Wren Troglodytes solstitialis, 26 August 2007, 2,515 
m (B); Plain-tailed Wren Thryothorus euophyrs, 26 November 2003, 2,550 m, 2.5 m up in 
bamboo thicket (B), 25 October 2006, 2,500 m (B), 4 November 2007, 2,450 m, ball with a side 
entrance, mostly of bamboo parts, 2.5 m above ground in patch of bamboo, 3 nestlings (N); 
Rufous Wren Cinnycerthia unirufa, 13 October 2004, 2,500 m (F), 1 November 2004, 2,550 m 
(F), 28 November 2004, 2,550 m (F), 7 August 2005, 2,500 m (F), 20 October 2005, 2,550 m 
(F), 5 November 2007, 2,500 m (F); Grey-breasted Wood Wren Henicorhina leucophrys, 26 
November 2004, 2,200 m (I), 26 November 2004, 2,100 m (N); Great Thrush Turdus fuscater, 

28 June 2007, 2,650 m, 2 nestlings (N); Black-capped Hemispingus Hemispingus atropileus, 

29 November 2003, 2,600 m (F); Black-eared Hemispingus H. melanotis, 7 October 2006, 
2,390 m (F), 23 April 2007, 2,400 m (F), 22 May 2007, 2,400 m (F); Grass-green Tanager 
Chlorornis riefferii, 26 November 2003, 2,550 m, adult fed fledgling a small fruit (F); Buff- 
breasted Mountain Tanager Dubusia taeniata, 1 December 2003, 2,550 m, prey loading, 
carrying prey repeatedly to same area, including 2.5-cm-long Saturniidae caterpillar gleaned 
from bamboo (CF); Bluish Flowerpiercer Diglossa caerulescens, 4 April 2006, 2,500 m (N); 27 
June 2007, 1,800 m (B); Masked Flowerpiercer D. cyanea, 12 October 2004, 2,550 m (F), 15 
August 2005, 2,600 m, 5 m up in epiphyte clump (I), 4 April 2006, 2,450 m, 1 nesting (N), 
4 April 2006, 2,500 m (F), 27 June 2007, 2,500 m (B); Common Bush Tanager Chlprospingus 
ophthalmicus, 15 October 2006, 2,450 m (B); Short-billed Bush Tanager C. parvirostris, 26 
November 2004, 2,350 m (N); Fawn-breasted Tanager Pipraeidea melanonota, 24 June 2007, 
1,850 m (N); Flame-faced Tanager Tangara parzudakii, 12 May 2007, 2,250 m (N); Black- 
faced Tanager Schistochlamys melanopis, 16 January 2009, 1,100 m (AN); Citrine Warbler 
Basileuterus luteoviridis, 26 October 2007, 2,450 m (F); Rufous-collared Sparrow Zonotrichia 
capensis, 1 December 2003, 2,500 m (F); Yellow-browed Sparrow Ammodramus aurifrons, 6 
April 2006, 1,200 m (B); Slaty Finch Haplospiza rustica, 12 August 2005, 2,600 m (2 B), 14 
September 2006, 2,450 m (1 I and 1 N), 26 September 2006, 2,650 m (1 B and 1 1); Chestnut- 



Harold F. Greeney et al. 



67 



Bull. B.O.C. 2010 130(1) 



capped Brush Finch Arremon brunneinucha, 16 August 2005, 2,650 m (N); Yellow-breasted 
Brush Finch Atlapetes latinuchus, 28 November 2003, 2,550 m (F), 26 September 2006, 2,530 
m, 2 eggs (I), 26 September 2006 2,550 m, 1 egg (L), 26 October 2006, 2,500 m (F), 24 August 
2007, 2,500 m (B), 14 October 2007, 2,450 m (F); Pale-naped Brush Finch A. pallidinucha, 28 
November 2003, 2,650 m (F), 12 August 2005, 2,650 m (B), 9 October 2006, 2,700 m (F). 

Acknowledgements 

We thank the Jocotoco Foundation for graciously providing accommodations while working at Tapichalaca. 
Geovanny & Vicente Mendoza gave valuable assistance in the field, and Pedro Alvarez and the Tapichalaca 
park guards provided logistical support throughout. HFG thanks the Maryland Ornithological Society, the 
Population Biology Foundation, John V. & the late Ruth Ann Moore, as well as Matt Kaplan, for generously 
supporting his field studies. Writing of this manuscript was accomplished while HFG, RAG and AS-U were 
supported by National Geographic grant #W38-08. All authors are grateful for the continuing support of the 
PBNHS. We thank Guy Kirwan and Juan Freile for helpful comments on earlier versions of this manuscript. 
This is publication no. 198 of the Yanayacu Natural History Research Group. 

References: 

Arcos-Torres, A. & Solano-Ugalde, A. 2007. Notas sobre la anidacion de tres especies del genero Tangara 

(Thraupidae: Aves) en el noroccidente de Ecuador. Bol. Soc. Antioquena Orn. 17: 133-137. 
Best, B. J., Checker, M., Thewlis, R. M., Broom, A. L. & Duckworth, W. 1996. New bird breeding data from 

southwestern Ecuador. Orn. Neotrop. 7: 69-73. 
Best, B. J., Clarke, C. T., Checker, M., Broom, A. L., Thewlis, R. M., Duckworth, W. & McNab, A. 1993. 

Distributional records, natural history notes, and conservation of some poorly known birds from 

southwestern Ecuador and northwestern Peru. Bull. Brit. Orn. CI. 113: 108-119, 234-255. 
Collins, C. T. & Ryan, T. P. 1995. The biology of the Cinnamon Flycatcher Pyrrhomyias cinnamomea in 

Venezuela. Orn. Neotrop. 6: 19-25. 
Freile, J. F., Carrion, J. M., Prieto-Albuja, F., Suarez, L. & Ortiz-Crespo, F. 2006. La ornitologfa en Ecuador: 

un analisis del estado actual del conocimiento y sugerencias para prioridades de investigacion. Orn. 

Neotrop. 17: 183-202. 

Greeney, H. F. 2008a. Nest construction behavior and variability in nest architecture and nest placement of 
the Spotted Barbtail (Premnoplex brunnescens). Bol. Soc. Antioquena Orn. 18: 26-37. 

Greeney, H. F. 2008b. The Spotted Barbtail {Premnoplex brunnescens): a review of taxonomy, distribution, and 
breeding biology, with additional observations from northeastern Ecuador. Bol. Soc. Antioquena Orn. 
18: 1-9. 

Greeney, H. F. 2008c. Additions to our understanding of Scytalopus tapaculo reproductive biology. Orn. 
Neotrop. 19: 463-466. 

Greeney, H. F. 2009. Nest orientation in the Spotted Barbtail, Premnoplex brunnescens, is strongly correlated 

with stream flow. /. Ethology 27: 203-208. 
Greeney, H. F. & Gelis, R. A. 2007. Breeding records from the north-east Andean foothills of Ecuador. Bull. 

Brit. Orn. CI. 127: 236-241. 

Greeney, H. F. & Gelis, R. A. 2008. Further breeding records from the Ecuadorian Amazonian lowlands. 
Cotinga 29: 62-68. 

Greeney, H. F. & Krabbe, N. 2009. Chusquea Tapaculo Scytalopus parkeri, Neotropical Birds Online. In 

Schulenberg, T. S. (ed.) Cornell Lab of Ornithology, Ithaca, NY. http:/ /neotropical.birds.cornell.edu/ 

portal / species / overview?p_p_spp=44072. 
Greeney, H. F. & Miller, E. T. 2008. The nestling and parental care of the Slate-crowned Antpitta (Grallaricula 

nana) in northeastern Ecuador. Orn. Neotrop. 19: 457-461. 
Greeney, H. F. & Nunnery, T. 2006. Notes on the breeding of north-west Ecuadorian birds. Bull. Br. Orn. CI. 

126: 38^5. 

Greeney, H. F. & Rombough, C. J. F. 2005. The nest of the Chusquea Tapaculo (Scytalopus parkeri) in southern 

Ecuador. Orn. Neotrop. 16: 439^40. 
Greeney, H. F. & Sornoza, F. 2005. The nest and egg of the Slate-crowned Antpitta (Grallaricula nana), with 

observations on incubation behavior in southern Ecuador. Orn. Neotrop. 16: 137-140. 
Greeney, H. F., Gelis, R. A. & White, R. 2004. Notes on breeding birds from an Ecuadorian lowland forest. 

Bull. Br. Orn. CI. 124: 28-37. 
Greeney, H. F., Biicker, A. D. L. & Harbers, N. 2005a. Parental care of the Blackish Tapaculo (Scytalopus 

latrans) in northeastern Ecuador. Orn. Neotrop. 16: 283-286. 
Greeney, H. F., Martin, P. R., Lysinger, M., Dobbs, R. C. & Gelis, R. A. 2005b. Notes on the breeding of 

Basileuterus warblers in Ecuador. Bull. Brit. Orn. CI. 125: 129-135. 
Greeney, H. F., Sherman, N., Lynch, R. & Harms, I. 2007. The nest and eggs of Maroon-chested Ground Dove 

Claravis mondetoura in south-east Ecuador. Cotinga 28: 71-73. 



Harold F. Greeney et al. 



68 



Bull. B.O.C. 2010 130(1) 



Greeney, H. R, Dobbs, R. C, Martin, P. R. & Gelis, R. A. 2008a. The breeding biology of Grallaria and 

Grallaricula antpittas. /. Field Orn. 79: 113-129. 
Greeney, H. R, Jaffe, D. F. & Manzaba B., O. G. 2008b. Incubation behavior of the Yellow-billed Cacique 

(Amblycercus holosericeus) in eastern Ecuador. Orn. Colombiana 7: 83-87. 
Greeney, H. F., Martin, P. R., Dobbs, R. C., Gelis, R. A., Biicker, A. D. L. & Montag, H. 2008c. Nesting ecology 

of the Spectacled Whitestart (Myioborus melanocephalus) in Ecuador. Orn. Neotrop. 19: 335-344. 
Guerrero, F. T. 1996. Aves del bosque de Mazdn. Empresa Publica Municipal de Telefonos, Agua Potable y 

Alcantarillado, Cuenca. 

Juiha, M. E., Harris, J. B. C. & Greeney, H. F. 2009. Description of the nest and parental care of the Chestnut- 

naped Antpitta (Grallaria nuchalis) from southern Ecuador. Orn. Neotrop. 20: 305-310. 
Marchant, S. 1959. The breeding season in S. W. Ecuador. Ibis 101: 137-187. 

Marchant, S. 1960. The breeding of some southwestern Ecuadorian birds. Ibis 102: 349-382, 584-599. 
Marin, M. & Carrion B., J. M. 1994. Additional notes on nest and eggs of some Ecuadorian birds. Orn. Neotrop. 
5: 121-124. 

Rasmussen, J. F., Rahbek, C, Poulsen, B. O., Poulsen, M. K. & Bloch, H. 1996. Distributional records and 
natural history notes on threatened and little known birds of southern Ecuador. Bull. Brit. Orn. CI. 116: 
26^5. 

Ridgely, R. S. & Greenfield, P. J. 2001. The birds of Ecuador. Cornell Univ. Press, Ithaca, NY. 
Schulenberg, T. S. & Gill, F. B. 1987. First description of the nest of the Olive Finch, Lysurus castaneiceps. 
Condor 89: 673-674. 

Sclater, P. L. & Salvin, 0. 1879. On the birds collected by T. K. Salmon in the state of Antioquia, United States 

of Colombia. Proc. Zool. Soc. Lond. 1879: 486-550. 
Skutch, A. F. 1954. Life histories of Central American birds. Pacific Coast Avifauna 31. Cooper Orn. Soc, 

Berkeley, CA. 

Skutch, A. F. 1972. Studies of tropical American birds. Publ. Nuttall Orn. CI. No. 10. Nuttall Orn. CI., Cambridge, 
MA. 

Solano-Ugalde, A., Arcos-Torres, A. & Greeney, H. F. 2007. Additional breeding records for selected avian 
species in northwest Ecuador. Bol. Soc. Antioquena Orn. 17: 17-25. 

Addresses: Harold F. Greeney, Mery E. Juiha J. & Alejandro Solano-Ugalde, Yanayacu Biological Station and 
Center for Creative Studies c/o Foch 721 y Amazonas, Quito, Ecuador. J. Berton C. Harris, Michael T. 
Wickens & Ben Winger, Fundacion de Conservation Jocotoco, Av. Los Shyris N37-146 y El Comercio, 
Quito, Ecuador. JBCH currently at: Research Institute for Climate Change and Sustainability, School of 
Earth and Environmental Sciences, University of Adelaide, SA 5005, Australia. Rudy A. Gelis, Pluma 
Verde Tours, Pasaje Manuel Garcia y 18 de Septiembre N20-28, Quito, Ecuador. Eliot T. Miller, Harris 
World Ecology Center, Department of Biology, University of Missouri, St Louis, Missouri, 63121, USA. 



© British Ornithologists' Club 2010 



Ryan Phillips et al. 



69 



Bull. B.O.C. 2010 130(1) 



First nesting of Northern Crested Caracara 
Caracara cheriway in Belize, Central America 

by Ryan Phillips, Philip Balderamos & Daniel Roth 

Received 24 August 2009 

Northern Crested Caracara Caracara cheriway is common throughout most of its 
range from the extreme southern USA to northern South America, but is rare or absent in 
much of Guatemala, southern Mexico and Belize (Howell & Webb 1995, Morrison 1996, 
Ferguson-Lees & Christie 2001). There is one record from Peten, Guatemala, and a few from 
south-east Guatemala (Eisermann & Avendano 2007) but none in Quintana Roo, Mexico, 
in the southernmost Yucatan Peninsula, although there are four records in the state of 
Yucatan within 15 km of the Quintana Roo border (Chable-Santos et al. 2007; B. MacKinnon 
pers. comm.). In Belize, there have been nine confirmed records in four districts (Orange 
Walk, Belize, Cayo and Toledo) but no breeding records (Jones et al. 2002, Jones 2005). The 
nearest known breeding is in the north-west Yucatan Peninsula and the Pacific lowlands of 
Guatemala, which are both >400 km away (Howell & Webb 1995). Here we present the first 
nesting record of Northern Crested Caracara in Belize (Jones & Komar 2009). 

Results 

On 25 April 2008, PB and Rudi Burgos found a stick nest in the crown of a cohune palm 
Orbignya cohune (Arecaceae) containing two nearly fledged Caracara cheriway chicks on the 
Tiger Run Farm, Cayo District, west of Central Farm. The nest tree's diameter at breast 
height was 42 cm and it was in a large active cattle pasture of c.3 km 2 . PB examined other 
cohune palms in close proximity for alternate nests and located a large stick nest in one that 
was 61 m from the nest tree, suggesting that there might have been a nesting attempt prior 
to 2008. The active nest was re-checked on 18 May 2008 by PB, but the chicks had fledged 
and were absent. PB was told by the landowner, Escander Bedran, that the nestlings had 
fledged one week earlier on c.12 May. Considering that incubation in this species lasts 
c.30 days and fledging occurs at c.S weeks (Dickinson & Arnold 1996, Rivera-Rodriguez & 
Rodriguez-Estrella 1998, Nemeth & Morrison 2002), we estimated that the eggs were laid 
on c.ll February 2008. 

On 21 February 2009, DR observed an adult carrying food into the 2008 alternate nest 
tree, which had evident white wash. At least one nestling was observed wing flapping and 
stretching, which behaviour indicates imminent fledging in most raptors (Boal 1994). On 
25 February 2009, RP observed two adults and a recently fledged juvenile, in very fresh 
plumage, on a snag 35 m from the 2009 nest tree, and a second fledgling was seen a few days 
later. It was estimated that the eggs were laid around 2 December 2008. 

Direct feeding observations and prey remains found in the vicinity of the nest trees 
in 2008-09 consisted primarily of unknown snakes, as well as a Cattle Egret Bubulcus ibis, 
an unidentified rat and turtles. It could not be determined if they were preyed upon or 
scavenged. 

Discussion 

This breeding range extension of >400 km could be a result of either deforestation, 
the presence of more field observers in Belize, or the relative lack of field observers in the 
Yucatan and Peten. Until there are more observers in these areas it is difficult to quantify 



Ryan Phillips et al. 



70 



Bull. B.O.C. 2010 130(1) 



if the caracara's range is expanding. However, this pair nested in an area converted 
from lowland broadleaf forest to cattle pasture, suggesting a response to deforestation. 
Historically, suitable habitat did not exist in Belize as broadleaf forest and savanna covered 
most of the countrv, whereas Northern Crested Caracara inhabits drier open country 
(Morrison 1996). Currently, over 30% of the natural vegetation has been lost creating 
corridors with other countries and suitable breeding habitat for caracaras (Miller & Miller 
1998). However, conversion of forest to rice fields and human settlements could negatively 
impact nesting, whereas improved pastures, scattered trees and low abundance of cattle 
would better facilitate breeding (Morrison & Hmnphrev 2001). 

In Belize, there are four distinct corridors surrounded bv large tracts of contiguous 
forest that have been deforested, and all of the confirmed records of caracaras in Belize are 
from close to these corridors. The four areas are in Toledo District in southern Belize, Cavo 
District in central Belize, and two in Orange Walk District in northern Belize. Of the latter, 
one runs from north-west Orange Walk through Blue Creek Village and the other through 
northern Orange Walk. Historically, these areas consisted of broadleaf forest, but thev 
have been cleared for roads, cattle pastures, rice fields or urbanisation. As deforestation 
continues, more corridors and habitat will be created for dispersing caracaras. Given the 
mountain barrier in Guatemala between the Pacific lowlands and Belize, the most plausible 
source population for Belize is the Yucatan Peninsula. 

Acknowledgements 

We are grateful to the Tiger Run Farm lando"wners, Escander & Abdala Bedran for permitting access to 
their land and for providing additional information. We thank Llovd Kiff, Maria Curti, Steven McGehee, 
Jack Eitniear and H. Lee Jones for reviewing the manuscript and their useful suggestions. Da\id Anderson, 
Knut Eisermann, Barbara MacKinnon de Montes and Juan Bautista Chable Santos provided records outside 
Belize. 

References: 

Boal, C. W. 1994. A photographic and behavioral guide to ageing nestling Northern Goshawks. Stud. Avian 
Biol. 16: 32-40. 

Chable-Santos, J., Pasos-Ervriquez, R. & G6mez-U., E, 2007. Aves comunes del sur de Yucatan. Ed. Universidad 

Autonoma de Yucatan, Mexico. 
Dickinson, V. M. & Arnold, K. M. 1996. Breeding biologv of the Crested Caracara in south Texas. Wilson Bull. 

108: 516-523. 

Eisermann, K. & Avendaho, C. 2007. Lista comentada de las ares de Guatemala. Lvnx Editions, Barcelona. 
Ferguson-Lees, J. & Christie, D. A. 2001. Raptors of the world. Houghton Mifflin, Boston, NLA.. 
Howell, S. N. G. & Webb, S. 1995. A guide to the birds of Mexico and nortliern Central America. Oxford Univ. 
Press, New York. 

Jones, H. L. 2005. The winter season: Central America. N. Amer. Birds 59: 337-339. 

Jones, H. L. & Komar, O. 2009. The winter season: Central America. N. Amer. Birds 63: 335-339. 

Jones, H. L., Balderamos, P., Caulfield, P., Caulfield, A., Crawford, G., Donegan, T., McRae, E., Meadows. M. 

Muschamp, M., Saqui, P., Spek, V., Urhina, J. & Zimmer, B. 2002. Fourteen new bird species for Belize. 

Cotinga 17: 33-42. 

Miller, B. W. & Miller, C. M. 1998. Ornithology in Belize since 1960. Wilson Bull. 110: 544-558. 

Morrison, J. L. 1996. Crested Caracara {Caracara cheriwqy). In: Poole, A. (ed.) The Birds of North America 

Online, http://bna.birds.cornell.edu/bna/species/249. 
Morrison, J. L. & Humphrev, S. R. 2001. Conservation value of private lands for Crested Caracaras in Florida. 

Conserv. Biol. 15: 675-684. 

Nemeth, N. M. & Morrison, J. L. 2002. Natal dispersal of the Crested Caracara {Caracara chernvay) in Florida. 
/. Raptor Res. 36: 203-206. 

Rivera-Rodriguez, L. B. & Rodrfguez-Estrella, R. 1998. Breeding biologv of the Crested Caracara in the Cape 
Region of Baja California, Mexico. J. Field Orn. 69: 160-168. 

Addresses: Ryan Phillips, Belize Raptor Research Institute, 1298 Hacienda Avenue, Campbell, CA 9500S USA, 
e-mail: harpiabz@vahoo.com. Philip Balderamos, 19/21 Tumeffe Avenue, Belmopan, Belize. Daniel 
Roth, P.O. Box 176 San Ignacio, Belize. 

© British Ornithologists' Club 2010 



Johan Ingels & Alexandre Vinot 



71 



Bull. B.O.C. 2010 130(1) 



First nest of Dusky Purpletuft lodopleura fusca, 
from French Guiana 

by Johan Ingels & Alexandre Vinot 

Received 11 September 2009 

The three species of canopy-dwelling purpletufts lodopleura were long considered part of 
the Neotropical family Cotingidae (Snow 2004). However, morphological (Prum & Lanyon 
1989) 'and genetic data (Chesser 2004, Barber & Rice 2007, Tello et al 2009) indicate that 
lodopleura should be placed in the Tityridae. Dusky Purpletuft I. fusca is a rare to uncommon 
endemic of the Guianan Shield, from east and south-east Venezuela and the Guianas to 
adjacent Brazil north of the Amazon and east of the Rio Negro (Restall et al. 2006, Whittaker 
& Kirwan 2008, Green & Kirwan in prep.). In French Guiana, it is uncommon albeit 
widespread in the vast forests of the interior, e.g. near Saut Parare and Petit Saut, around 
Saul, along the Piste de Saint Elie, at the Pic du Croissant, in the Massif des Emerillons and 
the Reserve Naturelle des Nouragues (Tostain et al. 1992). In 1994-96, 1, fusca was regularly 
observed at Saint-Eugene, a field research station of the Museum National d'Histoire 
Naturelle (Paris) on the Courcibo River, 30 km south of the Petit Saut hydroelectric dam 
(O. Claessens pers. comm.). In 2006-09, the species was regularly seen at the Centre de 
Cooperation Internationale en Recherche Agronomique pour le Developpement research 
station at Paracou near Sinnamary, and along the dirt road to the Crique Dardanelles 
through the Foret de Petit Saut in the Montagne de Fer (O. Claessens & A. Renaudier pers. 
comm.). More recently, it has also been observed in the Reserve Naturelle de la Trinite (S. 
Uriot pers. comm.). However, because of its tiny size and unobtrusive behaviour high in the 
forest canopy, the species probably often goes undetected. 

Recently, Whittaker & Kirwan (2008) published new natural history data for all three 
lodopleura. They described the nesting of White-browed I. isabellae and Buff- throated 
Purpletufts 7. pipra, but the nest of Dusky Purpletuft was unknown. 

On 27 December 2008, P. Ingremeau, R. Monchatre and AV observed, and AV 
photographed, a pair of Dusky Purpletufts in the sparsely foliated canopy of a c.20-m high 
tree at the forest edge, along the Piste de Counamama, a broad dirt road through the Foret 




Figure 1. Female Dusky Purpletuft lodopleura fusca Figure 2. The Dusky Purpletuft lodopleura fusca nest 
constructing its nest, Piste de Counamama, French looks very inconspicuous, almost like a bump on the 
Guiana (Alexandre Vinot) bark of a horizontal, bare branch, on 27 December 

2008, Piste de Counamama, French Guiana (Patrick 

Ingremeau) 



Johan Ingels & Alexandre Vinot 



72 



Bull. B.O.C. 2010 130(1) 



de Tamanoir near the Counamama River (05°17'N, 53°17'W). The male (violet pectoral tufts) 
was quite vocal. On checking the photographs subsequently, JI noted that the female (white 
pectoral tufts) was constructing a tiny, cone-shaped nest (Fig. 1) on the horizontal part of 
a bare branch with a diameter of c.25-30 mm, in the outer tree crown, a few metres below 
the top. The nest apparently straddled the branch, where a small knothole was present, and 
was very inconspicuous, almost like a bump on the bark (Fig. 2). Its top and bottom had 
estimated diameters of c.30 and c.45 mm respectively, and its height was c.25 mm. When 
observed, the female was adding what appeared to be a cobweb to the outside of the nest. 

On 1 January 2009, the pair was again seen nest building. Apparently the female alone 
constructed the nest, but was always accompanied by the male. Visiting the nest tree on 19 
January 2009, AV thought that the nest was complete. The base appeared slightly broader 
than three weeks earlier, but no Dusky Purpletufts were seen. On 27 January, AV found that 
the original nest had disappeared. Bad weather in the first half of January, characterised 
by heavy rainfall and high winds, might have been the cause. However, the female was 
starting to build a new nest in exactly the same place and was seen arriving with vegetable 
matter, which was fixed to a thin pad of material, the base of a new nest. Due to heavy rains 
in February-March the dirt road became impassable, and the second nest's fate is unknown. 
However on 1 April, the upper part of the nest tree was broken down. 

The small dimensions of the nest cup, with a diameter of c.30 mm and a depth <25 mm, 
are striking compared to the body size of a Dusky Purpletuft, which is cXl cm (Restall et ah 
2006), but presumably relate to the presumed clutch size of one egg as in other purpletufts 
(Snow 2004, Whittaker & Kirwan 2008, Green & Kirwan in prep.). 

Based on Whittaker & Kirwan (2008) and our observations, we conclude that the nest 
sites and nests of the three purpletufts are very similar. The nest is constructed on a small 
horizontal branch, sometimes where it forks or radiates, between c. 10-30 m high in an open- 
crowned tree. Spider's web seems to predominate as nest material. However, fresh lichens, 
fungus fibres and vegetable (seed?) matter are also reported as nesting material. Excrement, 
sticky mistletoe seeds and probably saliva are used to 'cement' the nest, which recalls that 
of a hummingbird. 

Acknowledgements 

We thank Olivier Claessens, Alexandre Renaudier, Olivier Tostain and Sylvain Uriot for sending their 
observations, and Patrick Ingremeau for sharing his photos. Olivier Claessens and Des Jackson commented 
on drafts of this note. We thank Guy M. Kirwan for constructive comments and editing. 

References: 

Barber, B. R. & Rice, N. H. 2007. Systematics and evolution in the Tityrinae. Auk 124: 1317-1329. 
Chesser, R. T. 2004. Molecular systematics of New World suboscine birds. Mol. Phyl. & Evol. 32: 11-24. 
Green, G. & Kirwan, G. M. In prep. Cotingas and manakins. Christopher Helm, London. 

Prum, R. O. & Lanyon, W. E. 1989. Monophyly and phvlogeny of the Schiffornis group (Tvrannoidea). Condor 
91:444-461. 

Restall, R., Rodner, C. & Lentino, M. 2006. Birds of northern South America. Christopher Helm, London. 
Snow, D. W. 2004. Family Cotingidae (cotingas). Pp. 32-108 in del Hoyo, J., Elliott, A. & Christie, D. A. (eds.) 

/ landbook of the birds of the world, vol. 9. Lynx Edicions, Barcelona. 
Tello, J. G., Moyle, R. G., Marchese, D. J. & Cracraft, J. 2009. Phylogeny and phylogenetic classification of the 

tyrant flycatchers, cotingas, manakins, and their allies. Cladistics 25: 429-467. 
Tostain, O., Dujardin, J.-L., Erard, C. & Thiollav, J.-M. 1992. Oiseaux de Guyane. Societe d'Etudes 

Ornithologiques, Brunoy. 

Whittaker, A. & Kirwan, G. M. 2008. Natural history data for the canopy-dwelling purpletufts lodopleura 
(Cotingidae), and first documentation of Dusky Purpletuft /. fusca for Brazil. Bull. Brit. Om. CI. 128: 
28-35. 

Addresses: Johan Ingels, Galgenberglaan 9, B-9070 Destelbergen, Belgium, e-mail: johan.ingels@skynet.be. 
Alexandre Vinot, 127 Av. G. Monnerville, F-97310 Kourou, France, e-mail: alexandre.vmot@wanadoo.tr 



INSTRUCTIONS FOR AUTHORS 



Authors are invited to submit papers on topics relating to the broad themes of taxonomy and distribution of 
birds. Descriptions of new species of birds are especially welcome and will be given priority to ensure rapid 
publication, and can be accompanied by colour photographs or paintings. 

Submission should be made electronically (preferred) to the Editor (GMKirwan@aol.com): if large (>5mb) 
files are involved, e.g. to include illustrations, please contact the Editor first. Submission can also be made by 
post (to Guy Kirwan, 74 Waddington Street, Norwich NR2 4JS, UK); in this case send three hard copies and 
also a copy on a 3.5" disk, as MS Word or Rich Text files for PC. Where possible, reviews, and returns of 
papers and reviewers' comments to authors will be undertaken electronically. 

Colour photographs will be included wherever possible, but authors should obtain funding to support the 
inclusion of colour plates if these are likely to exceed more than two printed pages. 

Papers should follow the general style: 

Title — lower case, centred, bold 

by Author (s) — lower case, centred, italics 

Introductory section without a heading 

Primary headings — lower case, centred, bold 

Secondary headings — left justified, lower case, italics, bold 

English names of animals should begin with capitals; give English name at first mention of every species. 
Numerals — thousands separated by commas, e.g. 1,000, 12,000 
Units of measurement, SI. Space between values and unit, e.g. 12.1 g 
Statistical tests in the form: (r 2 g = 3.12, P < 0.01). (X 2 3 = 7.31, n.s.) 

Citations to references in text: Author (Date); Author & Author (Date); if three or more authors — Author et 
al. (Date); or (Author(s) Date) etc. 

References: 

Author, A. (or Author, A. & Author, B.) Date. Title of paper. Title of journal in italics. Volume: pages. 
Author, A. Date. Title of book in italics. Publisher, place of publication. 

Author, A. Date. Title of paper/ chapter. Pages in Editor, A. & Editor, B. (eds.) Title of book/proceedings in italics. 
Pages. Publisher, place of publication. 

Address(es): addresses of authors, including e-mails if desired. 
Format for tables (to be typed on separate sheets at end of paper): 

TABLE n 





Column A 


Column B 


Row 1 


Data 


Data 


Row 2 


Data 


Data 



Description of table contents, including any abbreviations 

Legends for figures to be typed on one sheet at end of paper, in the form: Figure n. Text of legend, including 
key to symbols etc. 

Authors should provide an abstract of no more then 150 words. 

Correspondence confirming acceptance of papers will be accompanied by a form on which authors must 
assign copyright of their paper to the British Ornithologists' Club. Authors may be charged for any corrections 
that they request after their papers have been sent to the typesetter. After publication, authors will be sent, 
free of charge, a PDF file of their paper. 



Bulletin of the British Ornithologists' Club 

ISSN 0007-1595 
Edited by Guy M. Kirwan 

Volume 130, Number 1, pages 1-72 



CONTENTS 

Club Announcements 1 

KRABBE, N. & RIDGELY, R. S. A new subspecies of Amazilia Hummingbird Amazilia amazilia from 

southern Ecuador 3 

ABRAHAMCZYK, S. & KESSLER, M. Ecological and distributional notes on hummingbirds from 

Bolivian lowland forests 8 

DONEGAN, T. M. & AVENDANO, J. E. A new subspecies of mountain tanager in the Anisognathus 

lacrymosus complex from the Yarigufes Mountains of Colombia 13 

RHEINDT, F. E. New biogeographic records for the avifauna of Taliabu (Sula Islands, Indonesia), 

with preliminary documentation of two previously undiscovered taxa 33 

VALLELY, A. C, GALLARDO, R. J. & ASCHER, J. S. Notes on the birds of the Rio Platano 

Biosphere Reserve, including four new species for Honduras 52 

GREENEY, H. F., JUINA J., HARRIS, J. B. C, WICKENS, M. T., WINGER, B., GELIS, R. A., MILLER, 
E. T. & SOLANO-UGALDE, A. Observations on the breeding biology of birds in south-east 

Ecuador 61 

PHILLIPS, R., BALDERAMOS, P. & ROTH, D. First nesting of Northern Crested Caracara Caracara 

cheriway in Belize, Central America 69 

INGELS, J. & VINOT, A. First nest of Dusky Purpletuft Iodopleura fusca, from French Guiana , 71 



COMMITTEE 

Miss H. Baker (Chairman) (2009) D. J. Fisher {Hon. Website Manager) (2007) 

Dr R. P. Prys-Jones (Vice-Chairman) (2009) S. M. S. Gregory (2009) 

S. A. H. Statham (Hon. Secretary) (2004) K. Heron Jones (2009) 

D. J. Montier (Hon. Treasurer) (1997) C. W. R. Storey (2009) 

M. J. Walton (2008) 

Ex-officio members 

Hon. Editor: G. M. Kirwan (1 January 2004) 

Chairman ofBOU/BOC Joint Publications Committee (JPC): Revd. T. W. Gladwin 
Administration Manager: S. P. Dudley (2005) 
BOU/BOC Commissioning Editor: Dr D. R. Wells (2009) 



EDITORIAL BOARD 

Murray Bruce, R. T. Chesser, Edward C. Dickinson, Francoise Dowsett-Lemaire, Steven M. S. Gregory, 
Jose Fernando Pacheco, Robert B. Payne, Pamela C. Rasmussen, Cees Roselaar, Thomas S. Schulenberg 
Lars Svensson 

Registered Charity No. 279583 
© British Ornithologists' Club 2010 

www.boc-online.org 



Printed on acid-free paper. 
Published by the British Ornithologists' Club 
Typeset by Alcedo Publishing of Arizona, USA, and printed by Latimer Trend, UK 



British Ornithologists' Club 




~ 7 JUM 2010 



Volume 130 No. 2 
June 2010 



MEETINGS are normally held in the ground floor of the Sherfield Building of Imperial College, South 
Kensington, London, SW7. This suite is now called the Tower Rooms and meetings will normally take place 
in Section B with the entrance opposite the Queen's Tower in the main quadrangle . The nearest Tube station 
is at South Kensington; a map of the area will be sent to members, on request. (Limited car parking facilities 
can be reserved [at a special reduced charge of £5.00], on prior application to the Hon. Secretary.) 

The cash bar is open from 6.15 pm, and a buffet supper, of two courses followed by coffee, is served at 
7.00 pm. (A vegetarian menu can be arranged if ordered at the time of booking.) Informal talks are given on 
completion, commencing at about 8.00 pm. 

Dinner charges are £22.50 per person. 



FORTHCOMING MEETINGS 

See also BOC website: http://www.boc-online.org 

Please note the minor change to our regular venue (see above). Section B of the renamed Tower Rooms is to 
the east of the previous venue of the Ante-room which no longer exists; this is nearer to the main entrance off 
Exhibition Road but still part of the Sherfield Building. 



22 June — Dr Lincoln Fishpool — BirdLife International's Important Bird Area programme: a global perspective 
Dr Fishpool coordinates technical aspects of BirdLife's Important Bird Areas (IBA) programme. His talk will 
present a summary of the global programme through which sites critical for bird conservation worldwide are 
identified, documented and their protection sought. The talk will highlight recent developments, including 
the standardised methods by which sites are monitored, the uses to which resulting data are put, progress 
in identifying marine IBAs and how IBA methodology is contributing to the expansion of the approach to 
non-avian taxa: Key Biodiversity Areas. 

Applications closed on 8 June 2010 



21 September — Dr Andrew Gosler — Eggs dressed and undressed 

Dr Gosler (Edward Grey Institute, Oxford University) is well known for the studies he has carried out over 
many years on the tit populations in Wvtham Woods, near Oxford. His talk will provide an overview of 
recent research he has been conducting into the functional ecology of eggshell pigmentation, which includes 
novel ideas regarding the selective factors underlying variation in the external appearance of eggs. 

Applications to Hon. Secretary (address below) by 7 September 2010 



2 November — Michael Jennings — Birds of Arabia 
Details to be announced. 



Overseas Members visiting Britain are especially welcome at these meetings, and the Hon. Secretary would 
be very pleased to hear from anyone who can offer to talk to the Club giving as much advance notice as 
possible — please contact: S. A. H. (Tony) Statham, Ashlvns Lodge, Chesham Road, Berkhamsted, Herts. HP4 
2ST, UK. Tel. +44 (0)1442 876 995 (or e-mail: boc.sec@bou.org.uk). 



BOC Office 

P.O. Box 417, Peterborough PE7 3FX, UK 
E-mail: boc.office@bou.org.uk. Website: www.boc-online.org 
Tel. & Fax: +44 (0) 1733 844 820. 



Club Announcements 



73 



HISTORY MUSEUM 

- 7 JUNlftf 

PRESENTED 
TRING LIBRARY 



O.C. 2 010 130(2) 



Bulletin of the 
BRITISH ORNITHOLOGISTS' CLUB 



Vol. 130 No. 2 



Published 14 June 2010 



CLUB ANNOUNCEMENTS 

Members are reminded that subscriptions for 2010 were due on 1 January and are kindly asked to check that 
any Standing Orders with their banks are for the correct amount (£20 p.a.). Regrettably, several members are 
still paying incorrect subscription rates, causing the Club unnecessary time and expense in administration. 



Chairman's message 

A flyer asking for a volunteer to take over the role of Hon. Secretary was included with the December Bulletin. 
Unfortunately, no one has come forward and Tony Statham has kindly agreed to continue in post for now. 
The role could be split between two people, a Meetings Organiser and a Secretary. Because of this and the low 
attendance at some recent meetings, we are proposing to reduce the number of Club meetings to four, instead 
of six, in 2011. The number of Committee meetings will also be reduced. In addition, we are investigating 
the use of Skype at Committee meetings to enable members to participate without travelling to London. 
This should widen the geographical area from which Committee members can be drawn. Reasonable travel 
expenses can, in any case, be claimed. In the next year or so the Club will also need a Treasurer. Without a 
Secretary, Meetings Organiser and Treasurer the Club cannot function, making it imperative that volunteers 
come forward quickly. I very much welcome offers of help. 

Helen Baker 
E-mail: helen.baker60@tiscali.co.uk 



ANNUAL GENERAL MEETING 

The Annual General Meeting of the British Ornithologists' Club was held in the Tower Rooms, Sherfield 
Building, Imperial College, London SW7, on Tuesday 27 April 2010 at 6.10 pm with Miss H. Baker in the 
chair. Twelve members were present (including eight from the committee). Apologies were received from 
Revd. T. W. Gladwin, Mr S. M. S. Gregory, Mr G. M. Kirwan and Dr C. F. Mann. 

1. Minutes of the previous meeting. The Minutes of the 2009 AGM held on 29 April 2009, which had been 
published (Bull. Brit. Orn. CI. 129: 66), were approved and signed by the Chairman. 

2. Chairman's report. The Chairman referred members to her review, the Trustees' Annual Report and the 
Annual Accounts, which were combined in one document available at the meeting. She highlighted the main 
points of her report, thanking Committee members for their contributions and support over the last year and 
drawing attention to the difficulty of finding volunteers to take over the key roles. 

3. Trustees' Annual Report taken with item 4, the Bulletin, and item 5, Publications report. The Hon. 
Secretary, referring to the Trustees' report, drew attention to the range of papers that had been published 
in the Bulletin and to the publication of The birds of Barbados: an annotated checklist. The Hon. Treasurer drew 
attention to the income and expenditure details, which showed a total of £2,586 excess of income over 
expenditure. Subscription income and investment income had fallen, but it had been a good year for sales 
of BOU / BOC Joint Publications. Expenditure for the year of £33,148 was slightly less than in 2008. He 
proposed the adoption of the Report and Accounts and this was seconded by Mr R. R. Langley. 

6. Election of Officers. The Chairman proposed that Mr S. A. H. Statham be re-elected as Hon. Secretary and 
Mr D. J. Montier be re-elected as Hon. Treasurer. This was seconded by Cdr. M. B. Casement, RN. No other 
changes to the Committee were proposed as all other members were eligible to serve at least one more year 
in office. Ex-officio members are appointed by the Committee. 

7. Any Other Business. There was no other business and the meeting closed at 6.35 pm. 

The Committee has decided that in future the Chairman's review, Trustees' Annual Report and the Accounts 
should not appear in the Bulletin. They will be available and retained on the BOC website (www.boc-online. 
org) and hard copies can be obtained from the Hon. Treasurer, D. J. Montier, Eyebrook, Oldfield Road, 



Club Announcements 



~4 



Bull. B.O.C. 2010 130(2) 



Bicklev, Bromley, Kent, BR1 2LF, UK, e-mail: djmontier@btinternet.com 

Members may wish to note that copies of the Minutes of Committee meetings are available on request, 
once they have been approved. 



The Bob Scott Memorial Quiz 

Bob Scott, who died last year, was a BOC member for many years. To commemorate his life and to aid 
trans-Saharan migrants, his wife Ann and friends have launched a quiz that can be downloaded or ordered 
by post. It covers many areas of natural history and has four excellent prizes. To take part, visit www. 
birdguides.com and click the 'Donate' button. A hard copv can be obtained from The Bob Scott Appeal, 
FREEPOST PLUS RLSE-XAJX-UYRY, BirdLife International, Wellbrook Court, Girton, Cambridge CB3 ONA, 
UK. A minimum donation of £5 is suggested. 



David Lack Centenary Symposium, Edward Grey Institute, Oxford 

David Lack was arguably the leading figure in the development of modern ornithology in the 20th century, 
with foundational contributions in many disciplines. On 16 July 2010, the centenarv of his birth, an 
international cast of plenary speakers will review his contribution in key scientific fields and their future 
development, as well as contributing biographical and personal recollections from those -who worked with 
him. Full information on this event, and the sixth International Hole Nesting Bird Meeting (13-15 July), can 
be found at: www. zoo. ox. ac.uk/egi/newsevents/2010conferences.html 



Becking' s paper on Javan egg collections 

A forceful counterpoint to the Becking discussion of Javan egg collections (Bull. Brit. Orn. CI. 129: 18-48) was 
received from Dr G. F. Mees, disputing the charge of fraud levelled against H. Hoogerwerf and questioning 
the accuracy of some of the supporting evidence provided bv Becking. Following the refereeing process, the 
Hon. Editor and Dr Mees were unable to reach agreement as to the length and wording of his response. With 
the agreement of Dr Mees, the full correspondence and manuscript have been deposited at Naturalis, Leiden, 
which institution will, in due course, be conducting its own independent investigation into the claim that 
parts of the Hoogerwerf collection were fraudulently acquired. — The Hon. Editor. 



Peter G. Ryan et al. 



75 



Bull. B.O.C. 2010 130(2) 



Geographic variation in Socotra Sparrows Passer insularis 

by Peter G. Ryan, Lisa Nupen, Barrie Rose & Ahmed Saeed Suleiman 



Summary. — Socotra Sparrow Passer insularis is the only Socotran endemic landbird 
that occurs on the other islands of the Socotra archipelago. It is widely reported to 
occur on Abd 'Al Kuri, but the populations on Samha and Darsa were unknown 
until very recently. We present genetic data to support a recent call to elevate the 
Abd 'Al Kuri population to species level, Abd 'Al Kuri Sparrow P. hemileucus. 
Sequence divergence in two mitochondrial genes between hemileucus and insularis 
is 1.3-1.7%. The evolutionary history of the sparrows on Socotra cannot be inferred 
reliably until other taxa in the P. motitensis superspecies have been sampled. 
Sparrows on Samha are not genetically distinct from those on the main island of 
Socotra, but are appreciably smaller and should be recognised subspecifically. 
Birds on nearby Darsa were not caught, but photographs suggest they are similar 
to those on Samha. The Abd 'Al Kuri Sparrow qualifies as Vulnerable, due to its 
small population (<1,000 mature birds) and limited range (<100 km 2 ). 

The Socotra archipelago off the Horn of Africa consists of Socotra, a large continental 
island, and several smaller islands. The main island of Socotra is an Endemic Bird Area 
with at least six endemic landbird species (Stattersfield et al. 1998, Kirwan & Grieve 2007). 
Of these species, only the Socotra Sparrow Passer [motitensis] insularis occurs on other 
islands in the archipelago: Abd 'Al Kuri, Samha and Darsa (Fig. 1). Until recently, little had 
been published about geographic variation in sparrows at Socotra. Birds collected on Abd 
'Al Kuri, the largest of the satellites, were described as Passer hemileucus (Ogilvie-Grant & 
Forbes 1899), but this has been ignored by most recent authors, who failed to recognise the 
Abd 'Al Kuri population even as a subspecies (see Kirwan 2008 for a review). 

Kirwan (2008) re-examined specimens of the sparrow from Abd 'Al Kuri, and argued 
that it warrants species status, based on the paler plumage and smaller size. However, he 
did not consider any genetic markers, nor was he able to assess the status of sparrows on 



Received 3 June 2009 





Socotra 



0 



20 



40 



km 



60 



80 100 



Indian 
Ocean 





<0 



Abd 'Al Kuri 



Darsa 



Samha 



Figure 1. The Socotra archipelago, showing the four main islands and their position relative to the Horn of 
Africa and the Arabian Peninsula. 



Peter G. Ryan et al. 



76 



Bull. B.O.C. 2010 130(2) 



the other two islands in the group, Samha and Darsa, where sparrows were not known to 
occur until recently (Kirwan 2008). In this paper we confirm that Abd 'Al Kuri Sparrows 
are genetically distinct from those on Socotra, and demonstrate that the sparrows on Samha 
are appreciably smaller than other Socotra Sparrows. We also suggest that the Abd 'Al Kuri 
Sparrow qualifies as Vulnerable, due to its small population (<1,000 mature birds) and 
limited range (<100 km 2 ). 

Materials and Methods 

PGR and BR visited Socotra in March- April 2007 as part of a survey of the outer islands 
(Fig. 1) led by ASS under the aegis of the Socotra Conservation & Development Programme. 
We spent a week on the main island, two days on Abd 'Al Kuri, two days on Samha and 
a few hours on Darsa. Sparrows were caught in mist-nets on the northern coastal plain 
of Socotra (12°36'N, 53°42'E) on 25 March and 4 April, and at a small spring behind the 
settlement at the west end of Samha (12°10'N, 53°01 / E) on 1 April. It was too windy and 
exposed to catch sparrows using mist-nets in the conventional way on Abd 'Al Kuri, but we 
managed to trap four individuals by dropping a net over birds feeding on rice at the main 
settlement (12°11 , N, 52°14'E) on 29 March. Only a few sparrows were seen on Darsa. None 
was trapped during our brief visit ashore on 2 April, but a breeding pair was photographed. 
Photographs were taken of birds at other locations too, permitting comparison of plumage 
features identified by Kirwan (2008). 

Sparrows caught were measured: flattened wing-chord to the nearest 1 mm, and tarsus, 
total head, culmen, and bill depth to the nearest 0.1 mm. Juveniles could not be sexed 
reliably, but other birds were sexed on the basis of plumage characters (see Kirwan 2008). 
Additional measurements (wing length, tail length, bill length to skull and bill depth) of 
specimens from Socotra and Abd 'Al Kuri were supplied by G. M. Kirwan (in litt. 2007); his 
measuring protocols are described in Kirwan (2008). A small amount of blood was collected 
from the brachial vein of a subset of birds and stored in ethanol. 

DNA was extracted from this blood with a DNeasy tissue kit (Qiagen) using the 
animal tissue protocol. Two mitochondrial (mt) DNA target regions were amplified: partial 
cytochrome-^ (cyt-fc, 273 bp) and partial NADH dehydrogenase subunit 3 (ND3, 320 bp) 
fragments. The primer sequences used for cyt-b were GGATTCTCAGTAGACAACCC 
(523F, forward, Thomassen et al 2003) and GTAGGATGGCGTAGGCGA (827R, reverse, 
van der Meij et al 2005) and those used for ND3 were GACTTCCAATCTTTAAAATCTGG 
(L10775, forward, Chesser 1999) and GATTTGTTGAGCCGAAATCAAC (H11151, reverse, 
Chesser 1999). 

PCRs were carried out on a GeneAmp PCR System 2700 (Applied Biosvstems) and 
comprised an initial denaturation step at 94°C for three minutes, followed by 35 cycles of 
94°C for 60 seconds (denaturation), 54°C for 30 seconds (primer annealing) and 72°C for 60 
seconds (extension), with a final extension step of 72°C for five minutes. Bands were cut 
out and gel purified using the Promega Wizard PCR Clean-up Kit (Promega, UK). Cycle 
sequencing was carried out with the ABI PRISM Big Dye Terminator V3.1 cycle sequencing 
Ready Reaction Kit (Applied Biosystems). Sequencing was undertaking using BigDve 
Technology on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems). 

Sequences were inspected in BioEdit (Hall 1999) and checked using FinchTV (Geospiza 
Inc. v. 1.4.0). Any sequence with ambiguous bases or missing data was discarded. Sequences 
were aligned and edited with BioEdit Sequence Alignment Editor v. 7.0.4.1 (Hall 1999), 
which includes Clustal W for multiple sequence alignments (Thompson et al. 1997). Unique 
haplotypes were identified and sequence variation between populations was estimated 
using DnaSP (Rozas et al 2003). 



Peter G. Ryan et al. 



77 



Bull. B.O.C. 2010 130(2) 



Unweighted Parsimony (MP), maximum likelihood (ML) and Bayesian approaches 
were used to infer phylogeny from sequence data for each gene region separately and 
for the combined sequence data. Parsimony-based analyses were conducted in PAUP* 
4.0bl0 (Swofford 2002), using branch and bound and heuristic searches, tree-bisection- 
reconnection (TBR) branch swapping, and 1,000 bootstrap replicates to assess nodal support 
(Felsenstein 1985). Maximum likelihood analyses were conducted using PhyML (Guindon 
& Gascuel 2003) using a full heuristic search with 1,000 random addition replicates and TBR 
branch-swapping. 

Bayesian inference was implemented in MrBayes v3.1.2, using a mixed model 
(GTR+I+G for each target region). Markov Chain Monte Carlo (MCMC) analyses (chain 
length = 10 million, trees sampled every 1,000 generations, burn-in set at 10% [1,000 trees] 
for all MCMC analyses) were repeated four times. MCMC convergence was determined by 
the standard deviation of split frequencies approaching zero and the PSRF (potential scale 
reduction factor) reaching 1.0 for all parameters. 

Sequence data for outgroup Passer spp. were obtained from GenBank. The outgroups 
used were Cape Sparrow P. melanurus (GenBank accession numbers (L77905, AY329468.1), 
Russet Sparrow P. rutilans (AF230912.1), House Sparrow P. domesticus (AY030163.1), 
Eurasian Tree Sparrow P. montanus (AY030164.1, EF102488.1, AB159160.1), Saxaul Sparrow 
P. ammodendri (AF230915.1) and Sudan Golden Sparrow P. luteus (AF230919). Sequences 
obtained in this study were deposited with GenBank (accession numbers EU478411-22 for 
ND3 and EU478423-34 for cyt-fc). 

Results 

Twenty sparrows were caught on Socotra, 15 on Samha and four on Abd 'Al Kuri. 
Restricting the analysis to birds from Socotra, there was no significant difference in mean 
wing length or bill depth measurements from live birds and those from museum skins 
(t 53 =0.20, 0.57, P>0.8, 0.5, respectively). A biplot of these characters for the pooled samples 
revealed very little overlap between populations from each island, with the greatest 
difference between birds from Socotra and Samha (Fig. 2). Comparison of birds caught on 
Socotra and Samha during this study confirms the markedly smaller size of birds on Samha 
in all dimensions (Table 1). Within island populations, males averaged slightly larger than 
females, but these differences were smaller than the differences between islands. Socotra 
birds averaged 8-12% larger in all dimensions except bill depth, which was 26% greater for 
both sexes combined. 

Sparrows on Samha resembled Socotra Sparrows more closely than Abd 'Al Kuri 
Sparrows, they having darker, more saturated plumage (Table 2, Figs. 3-6). Females from 
Samha and Socotra were quite similar, but Samha males differed from those on Socotra 
in having small black bibs largely confined to the chin and throat, not extending onto the 
breast, and in having more extensive whitish tips to the median wing-coverts. They also had 
less extensive black on the ear-coverts than most Socotra Sparrows, although this feature is 
variable on Socotra. The birds photographed on Darsa resembled birds from Samha. 

Partial cyt-fr sequences (273 bp) were obtained from 12 sparrows (four from Socotra, 
five from Samha and three from Abd 'Al Kuri), and partial ND3 sequences (320 bp) from 
four sparrows from each island. Two haplotypes, differing by three transitions, were found 
in the partial cyt-£> sequences, one confined to Abd 'Al Kuri and the other to Socotra and 
Samha (Table 4). Sequences of ND3 were more variable, with five haplotypes found: four 
on Socotra, of which one was also found in all birds from Samha, and another haplotype on 
Abd 'Al Kuri (Table 4). The difference between the Abd 'Al Kuri haplotype and the closest 
Socotra / Samha haplotype was four transitions. Mean sequence divergence among island 



Peter G. Ryan et al. 



78 



Bull. B.O.C. 2010 130(2) 



TABLE 1 

Mensural differences between Socotra Sparrows Passer insularis on Samha and the main 
island of Socotra (mean ± SD and range; all measurements in mm; excludes juveniles). 
Significance tested with Mann- Whitney U-tests. 



Males 
Wing 
Tarsus 
Total head 
Culmen 
Bill depth 

Females 
Wing 
Tarsus 
Total head 
Culmen 
Bill depth 



Socotra 
n=9 

75.2±1.8 (73-78) 
21.2+0.5 (20.4-22.2) 
34.5±0.4 (33.9-35.4) 
14.4±0.5 (13.7-15.1) 

9.4±0.2 (9.2-9.7) 
n=9 

74.8+1.5 (72-77) 
21.2+0.7 (20.0-21.8) 
35.2±0.8 (34.0-36.3) 
14.9±0.6 (14.2-16.2) 

9.4±0.2 (9.1-9.7) 



Samha 
n=5 

70.2±0.5 (70-71) 
19.4±0.2 (19.2-19.8) 
31.5±0.4 (31.1-32.1) 
13.0±0.4 (12.6-13.6) 

7.6+0.1 (7.4-7.7) 
n=9 

68.4±1.0 (67-70) 
19.0±0.3 (18.4-19.4) 
31.7+0.4 (31.2-32.2) 
13.2+0.3 (12.8-13.6) 

7.4±0.1 (7.3-7.5) 



Significance 

U=45, P<0.001 
U=45, P<0.001 
U=45, P<0.001 
U=45, P<0.001 
U=45, P<0.001 

U=81, P<0.001 
U=81, P<0.001 
U=81, P<0.001 
U=81, P<0.001 
U=81, P<0.001 



TABLE 2 



Plumage differences among male sparrows in the Socotra archipelago. 



Character 


Socotra 


Samha 


Abd 'Al Kuri 


Head-sides 


rich chestnut 


rich chestnut 


sandy rufous 


Wing-coverts 


rich chestnut 


rich chestnut 


sandy rufous 


Underparts 


pale grey 


pale grey 


sandy buff 


Back and rump 


grey 


grey 


sandy grey 


Mantle streaking 


heavy 


moderate 


moderate-light 


Black on ear-coverts 


extensive* 


limited 


limited 


Bib 


extends onto breast* 


confined to throat 


confined to throat 



*Some variation; one male on Socotra had a rather narrow black line on its ear-coverts and the bib barely extending 
onto the breast 



populations was limited between 
Socotra and Samha, but was 1.3-1.7% 
between these islands and Abd 'Al 
Kuri (Table 3). 

In all phylogenetic analyses of 
the genetic sequence data (cyt-fr, ND3 
and the combined dataset), birds 
from the three island populations 
formed a monophyletic group, 
with Socotra and Samha clustered 
together, distinct from birds on Abd 
'Al Kuri (Fig. 7). The Abd 'Al Kuri 
clade had consistently high nodal 
support (>90% for each gene region 
separately and for the combined 
dataset). There was little consistency 
in the identification of a closest 
relative among other sparrows for 
which sequence data are available 
in GenBank. However, no sequences 
were available for other members of 
the Passer motitensis superspecies. 




65 70 75 80 

Wing length (mm) 

Figure 2. Biplot of wing length versus bill depth in three 
island populations of Socotra sparrows, based on specimens 
(G. M. Kirwan in litt. 2007) and live birds. Open symbols are 
females, solid symbols males. 



Peter G. Ryan et al. 



79 



Bull. B.O.C. 2010 130(2) 



TABLE 3 



Genetic divergence (%) between island populations of Socotra sparrows. 
Cyt-b top right above diagonal, ND3 lower left below diagonal. 



Locality 


Socotra 


Samha 


Abd Al Kuri 


Socotra 




0.0 


1.48 


Samha 


0.40 




1.48 


Abd Al Kuri 


1.66 


1.26 








TABLE 4 






Haplotype frequencies 


for island populations of Socotra sparrows. 




Locality 


Socotra 


Samha 


Abd Al Kuri 


ND3 Haplotype 1 


o 


o 


4 


ND3 Haplotype 2 


1 


4 


0 


ND3 Haplotype 3 


1 


0 


0 


ND3 Haplotype 4 


1 


0 


0 


ND3 Haplotype 5 


1 


0 


0 


Cyt-fr Haplotype 1 


0 


0 


3 


Cyt-b Haplotype 2 


4 


5 


0 



Discussion 

Our findings support Kirwan's (2008) call to recognise Abd 'Al Kuri Sparrow Passer 
hemileucus as a species, because it is diagnosably distinct in its plumage and morphology, 
and shows significant molecular divergence from Socotra Sparrows. Based on a rate of 
change in cyt-b of 2% per one million years (Lovette 2004), sparrows on Abd 'Al Kuri have 
been isolated from those on Socotra and Samha for around 0.8 million years. However, 
recent studies have found that substitution rates at the avian cyt-fr gene vary considerably 
across lineages, and can be appreciably slower than 2% per million years (Pereira & Baker 
2006). Allende et al. (2001) estimated a rate of roughly 0.4% per million years for Passer, 
suggesting that sparrows on Abd 'Al-Kuri diverged from those on Socotra / Samha some 
3.5 million years ago. We attempted to date this divergence by implementing a relaxed 
molecular clock (Drummond et al. 2006), but without fossil evidence to calibrate the clock, 
we were unable to obtain acceptable levels of confidence around the nodes of interest. 
Attempts at constraining the root of the tree using an approximate time for the appearance 
of the genus Passer or geological constraints such as the time of the split of Socotra from 
mainland Africa proved ineffective at improving confidence (highest posterior density 
regions). In the absence of sequence data from other taxa in the motitensis superspecies, we 
cannot test whether the two species arose as a result of dispersal / vicariance within the 
archipelago, or from separate colonisation events, presumably from the Horn of Africa. 

The apparent lack of gene flow between birds on Abd 'Al Kuri and the rest of the 
archipelago is consistent with the greater isolation of Abd ' Al Kuri. It is 63 km from Samha 
and 105 km from Socotra, whereas Samha and Darsa are only 17 km apart, and 46 and 36 
km from Socotra, respectively. Indeed, Abd 'Al Kuri is closer to the African mainland (96 
km) than it is to Socotra. Abd 'Al Kuri also has been isolated from the rest of the archipelago 
for longer than have Samha and Darsa. Socotra split from Africa and Arabia as a result of 
block faulting during the Tertiary period, probably in association with the formation of the 
Gulf of Aden some 36MYA (Miller & Morris 2004, Cheung et al. 2006). Samha and Darsa 
formed through erosion of the original Socotra massif; they are separated from the main 
island by waters <50 m deep, whereas Abd 'Al Kuri is separated from the other islands by a 
channel >200 m deep (Klaus & Turner 2004). Abd 'Al Kuri exhibits a greater level of species 



Peter G. Ryan et al. 



80 



Bull. B.O.C. 2010 13<)(2) 




Figure 3. Typical male Socotra Sparrow Passer insularis, lowlands of Socotra, late March 2007 (P. G. Ryan) 
Figure 4. Typical male Socotra Sparrow Passer insularis, Samha, late March 2007 (P. G. Ryan) 
Figure 5. Male Socotra Sparrow Passer insularis, Darsa, early April 2007 (B. Rose) 

Figure 6. Typical male Abd 'Al Kuri Sparrow Passer hemileucus, Abd 'Al Kuri, late March 2007 (P. G. Ryan) 




Passe r domesticus 
Passer ammodendri 
Passer luteus 
Passer melanurus 
Passer rutilans 
Passer montanus 
P. hemiieucus (Abe Al Kuri) 
P insulans (Socotra & Samha) 



Figure 7. Unrooted phylogeny of Socotra sparrows based on the combined partial cytochrome-b and NADH 
subunit 3 sequence data. Values given for nodes are Bavesian posterior probabilities (below node) and 
maximum parsimony bootstrap support (above node). 



Peter G. Ryan et al. 



8! 



Bull. B.O.C. 2010 130(2) 



endemism among other terrestrial vertebrates (e.g., reptiles, Rosier & Wranik 2004) as well 
as flowering plants (Miller & Morris 2004), compared to Samha and Darsa. 

Despite the limited genetic distance between sparrow populations on Socotra and 
Samha, the birds on Samha are appreciably smaller, with no overlap in any of the 
measurements among birds of the same sex (Table 1). Males also differ in several plumage 
characters (Table 2). The Samha population probably warrants recognition as a distinct 
taxon, but its formal naming awaits collection of a specimen. 

The paucity of genetic diversity within populations on Samha and Abd 'Al Kuri is 
consistent with the much smaller populations on these islands. Socotra is a large island 
(3,625 km 2 ), and the sparrow is the most abundant of the endemic landbirds, with an 
estimated population in excess of 200,000 birds (Kirwan 2008). There are many fewer 
sparrows on the other islands, in part due to their smaller size but also their much drier 
climate, linked to their lower elevation (Miller & Morris 2004, Cheung et al. 2006). Abd 'Al 
Kuri (133 km 2 ) is the second-largest of the archipelago, but is very hot and dry, with little 
vegetation over much of the island, and no surface water (Ripley & Bond 1966). Sparrows 
were fairly common at the main settlement, Khisat Salha, where perhaps 100 scavenged 
among refuse. At dusk, pairs of adults were observed leaving the settlement along dry 
drainage lines with scattered shrubs, apparently to roost in taller vegetation in the foothills 
of the high limestone mountain range that runs along the spine of the island east of Khisat 
Salha. Several pairs were also found in the better-vegetated wadis running down from these 
mountains well away from the village. There appears to be little other suitable habitat on 
the island. During a circumnavigation by small boat the only area we saw with sufficient 
vegetation to support sparrows was the main mountain chain. Sparrows were absent 
from the village near the main landing site on the north coast, but ASS has recorded them 
previously around a small fishing camp at the extreme western end. We estimate a total 
population of <1,000 mature individuals. The Abd 'Al Kuri Sparrow qualifies as Vulnerable 
(BirdLife International 2004), due to its small population (criterion Dl) and limited range 
(D2). 

Samha (41 km 2 ) is even smaller than Abd 'Al Kuri, but the island is dominated by a 
high limestone mountain range that runs virtually the length of the island, with springs 
at its eastern and western ends. Sparrows were abundant around these springs and at the 
settlement at the western end. The total population almost certainly is greater than that 
on Abd 'Al Kuri, but probably <5,000 birds. Darsa is the smallest island (16 km 2 ) and is 
uninhabited. Like Samha, it has a limestone mountain running the length of the island. We 
observed a few sparrows along the southern sea cliffs during a circumnavigation by small 
boat, and found a pair nesting in a cavity in the roof of a cave on the northern shore. The 
total population probably is <1,000 birds. 

Given considerable interest in the evolution of island birds, it is remarkable that 
the diversity of sparrows at the Socotra archipelago has been largely ignored (Kirwan 
2008). Further studies are required to assess whether the smaller size of sparrows on the 
outer islands are adaptive (e.g. related to dietary differences or different physiological 
constraints), or merely a consequence of founder effects and subsequent drift. 

Acknowledgements 

We thank the members of the Socotra Conservation & Development Programme, especially Paul Scholte, 
and other participants on the 2007 outer island survey for their assistance and support. Guy Kirwan 
kindly provided measurements of specimens, and Tony Verboom and Jacqueline Bishop provided help 
with analyses. Financial support for this project was obtained from the University of Cape Town (UCT). 
Computing facilities were provided by the AEON (UCT) and laboratory facilities by the Molecular 
Systematics Lab, Botany Department (UCT). 



! 



Peter G. Ryan et al. 



82 



Bull. B.O.C. 2010 130(2) 



References: 

Allende, L. M., Rubio, I., Ruiz-del-Val, V., Guillen, J., Martinez-Laso, J., Lowy, E., Varela, P., Zamora, J. & 
Arnaiz-Villena, A. 2001. The Old World sparrows (genus Passer) phylogeography and their relative 
abundance of nuclear mtDNA pseudogenes. /. Mol. Evol. 53: 144-154. 

BirdLife International. 2004. Threatened birds of the world 2004. CD-ROM. BirdLife International, Cambridge, 
UK. 

Chesser, R. T. 1999. Molecular systematics of the Rhinocryptid genus Pteroptochos. Condor 101: 439-446. 
Cheung, C, DeVantier, L. & van Damme, K. 2006. Socotra: a natural history of the islands and their people. 

Odyssey Publications, Hong Kong. 
Drummond, A. J. & Rambaut, A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BioMed 

Central Evol. Biol. 7: 214-229. 
Drummond, A. J., Ho, S. Y. W., Phillips, M. J. & Rambaut, A. 2006. Relaxed phylogenetics and dating with 

confidence. PLoS Biol. 4: e88. 
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 

783-791. 

Guindon, S. & Gascuel, O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by 

maximum likelihood. Syst. Biol. 52: 696-704. 
Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for 

Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41: 95-98. 
Huelsenbeck, J. P. & Ronquist, F. 2006. MrBayes v. 3.1.2: Bayesian analysis of phylogeny. Univ. of California, 

San Diego. 

Kirwan, G. M. 2008. Studies of Socotran birds III. Morphological and mensural evidence for a 'new' species in 

the Rufous Sparrow Passer motitensis complex endemic to the island of Abd 'Al-Kuri, with the validation 

of Passer insularis Sclater & Hartlaub, 1881. Bull. Brit. Orn. CI. 128: 83-93. 
Kirwan, G. M. & Grieve, A. 2007. Studies of Socotran birds II. One, two or three species: towards a rational 

taxonomy for the Golden-winged Grosbeak Rhynchostruthus socotranus. Bull. Afr. Bird CI. 14: 159-169. 
Klaus, R. & Turner, J. R. 2004. The marine biotopes of the Socotra Archipelago. Fauna of Arabia 20: 45-115. 
Lovette, I. J. 2004. Mitochondrial dating and mixed support for the "2% rule" in birds. Auk 121: 1-6. 
van der Meij, M. A. A., de Bakker, M. A. G. & Bout, R. G. 2005. Phylogenetic relationships of finches and allies 

based on nuclear and mitochondrial DNA. Mol. Phyl. & Evol. 34: 97-105. 
Miller, A. & Morris, M. 2004. Ethnobotany of the Soqotra archipelago. Royal Botanic Garden, Edinburgh. 
Ogilvie-Grant, W. R. & Forbes, H. O. 1899. Descriptions of the new species of birds. Bull. Liverpool Mus. 2: 

2-4. 

Pereira, S. L. & Baker, A. J. 2006. A mitogenomic timescale for birds detects variable phylogenetic rates of 
molecular evolution and refutes the standard molecular clock. Mol. Biol. Evol. 23: 1731-1740. 

Ripley, S. D. & Bond, G. M. 1966. The birds of Socotra and Abd-el-Kuri. Smithsonian Misc. Coll. 151(7): 1-37. 

Rosier, H. & Wranik, W. 2004. A key and annotated checklist of the reptiles of the Socotra Archipelago. Fauna 
of Arabia 20: 505-534. 

Rozas, J., Sanchez-DelBarrio, J. C, Messeguer, X. & Rozas, R. 2003. DNAsp, DNA polymorphism analyses by 

the coalescent and other methods. Bioinformatics 19: 2496-2497. 
Stattersfield, A. J., Crosby, M. J., Long, A. J. & Wege, D. C. 1998. Endemic Bird Areas of the world: priorities for 

biodiversity conservation. BirdLife International, Cambridge, UK. 
Swofford, D. L. 2002. PAUP phylogenetic analysis using parsimony (and other methods) v. 4. Sinauer Associates, 

Sunderland, MA. 

Thomassen, H. A., Wiersema, A. T., de Bakker, M. A. G., de Knij, V. P., Hetebrij, E. & Povel, G. D. E. 2003. 
A new phylogeny of swiftlets (Aves; Apodidae based on cvtochrome-£> DNA). Mol. Phyl. & Evol. 29: 
86-93. 

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. 1997. The CLUSTAL X windows 
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic 
Acids Res. 25: 4876-4882. 

Addresses: Peter G. Ryan, Lisa Nupen & Barrie Rose, Percy FitzPatrick Institute, DST / NRF Centre of 
Excellence, University of Cape Town, Rondebosch 7701, South Africa, e-mail: peter.ryan@uct.ac.za. 
Ahmed Saeed Suleiman, Socotra Conservation & Development Programme, Ministry of Water & 
Environment, P.O. Box 16494, Sana'a, Yemen. 



© British Ornithologists' Club 2010 



Guy M. Kirwan & Andrew Grieve 



83 



Bull. B.O.C. 2010 130(2) 



How many subspecies of Coal Tit Periparus ater 
are there in Iran? 

by Guy M. Kirwan & Andrew Grieve 

Received 23 July 2009 

Summary. — We discuss subspecific limits in Coal Tit Periparus ater in Iran and 
immediately adjacent regions. Three races are generally accepted as occurring 
in' the country, one of them, P. a. phaeonotus, known only from four specimens 
collected in the Zagros Mountains of south-west Iran. We speculate that the type 
series of the latter taxon might have been incorrectly labelled as to date, and that 
the species is only a rare winter visitor to this region of the country. The other 
subspecies listed as occurring in Iran, P. a. gaddi and P. a. chorassanicus, are only 
extremely doubtfully distinct from phaeonotus. 



Numerous publications testify to the complexity of geographical variation observable 
in the Coal Tit Periparus ater (e.g. Snow 1956, Vaurie 1959, Shirihai & Svensson in prep.), a 
wide-ranging Palearctic species, from the British Isles east across Eurasia to Kamchatka and 
Japan, and south to north-west Africa, the northern Middle East, the northern Himalayas 
and Taiwan (Harrap & Quinn 1996). The most recent treatments recognise either 20 (Harrap 
& Quinn 1996) or 21 subspecies (Dickinson 2003, Gosler & Clement 2007), subdivided into 
six groups by several authors, including Harrap & Quinn (1996), although the necessity of 
recognising all these groups, never mind subspecies, is not always clear, given that most 
described variation is clinal (Snow 1997, Kirwan et al. 2008). The last-named work is the 
most recent to have discussed racial limits within the so-called 'Caucasus group', whose 
constituents range from the Crimea of southern Russia to south-west Turkmenistan. Here, 
we further discuss the subspecific question within Iran. 

Three subspecies are generally recognised for the populations in Iran: Periparus a. 
phaeonotus (Blanford, 1873) in the Zagros Mountains of south-west Iran; P. a. gaddi Zarudny, 
1911, of the Elburz Mountains as far east as Gorgan in the southern Caspian Sea region 
(and south-east Azerbaijan); and P. a. chorassanicus Zarudny & Bilkevitch, 1911, which 
ranges through Khorasan province, in north-east Iran (and in the neighbouring mountains 
of south-west Turkmenistan). The first of these is by far the most fascinating of the trio, 
being known solely from four specimens, among them a syntype held at The Natural 
History Museum, Tring (BMNH 1874.11.23.35; Fig. 1), which was one of three collected 
in oak woodland near Shiraz at 1,525-2,135 m (29°37'N, 52°05'E; probably somewhere 
near Dasht-e Arjan, to the west of the city of Shiraz), by Major Oliver Beauchamp St. John 
in June 1870, according to the BMNH label. A colour illustration of the taxon by J. G. 
Keulemans appears in Blanford (1876). The fourth specimen was taken by Zarudny (1905) 
at the Gamdalkal Pass (31°53'N, 50°32'E), between Dow Polan and Dehdez, Fars province, 
on 2 January 1904 (modern dating) although the whereabouts of this individual, which is 
often overlooked in the literature (e.g. by Vaurie 1959, Harrap & Quinn 1996), are presently 
unknown. Enquiries at the following museums with large holdings of Zarudny's material, 
Bonn, Moscow, New York, St. Petersburg, Tashkent and Vienna, have failed to locate it. 
Warren & Harrison (1971) discussed the status of the Tring syntype, which was received 
on exchange from the Calcutta (formerly Indian) Museum. Both of the other syntypes were 
also held in Calcutta (Blanford 1876: 1, Sclater 1892: 74), but the latter museum reportedly 



Guy M. Kirwan & Andrew Grieve 



84 



Bull. B.O.C. 2010 130(2) 




Figure 1. Syntype (BMNH 
1874.11.23.35) of Coal Tit 
Periparus ater phaeonotus, 
collected in 'June' 1870, by 
Major Oliver Beauchamp 
St. John, near Shiraz, Iran 
(Guy M. Kirwan / © 
Natural History Museum, 
Tring) 




Figures 2-3. Syntype (BMNH 1874.11.23.35) of Coal Tit Periparus ater phaeonotus 
(with red label) flanked by specimens of P. a. gaddi, collected in the southern 
Caspian region of Iran, showing ventral and dorsal surfaces (Guy M. Kirwan / 
© Natural History Museum, Tring) 



no longer has any specimen of P. ater from 
Persia (Iran) (K. Deuti in litt. 2009). 

Seven years after Zarudny collected his 
Zagros specimen, Witherby (1910) reported 
on a handful of specimens of Coal Tit 
collected by R. B. Woosnam in 1907 in 
the Elburz and southern Caspian, which 
he unhesitatingly assigned to phaeonotus, 
despite that Zarudny would, the following 
year, describe P. a. gaddi from the very same 
region. It is worth remarking that others had 
already ascribed to phaeonotus a much wider 
range than is currently accepted for this 
taxon. Thus, Seebohm (1883: 14) claimed that 
specimens from Lenkoran, Caucasus, could 
be considered representative of phaeonotus, 
and further stated (with supporting plumage 




Figure 4. Syntype (BMNH 1874.11.23.35) of Coal 
Tit Periparus ater phaeonotus (at left) with three 
specimens of P. a. chorassanicus, collected in modern- 
day Turkmenistan, showing dorsal plumage (Guv M. 
Kirwan / © Natural History Museum, Tring) 



Guy M. Kirwan & Andrew Grieve 



85 



Bull. B.O.C. 2010 130(2) 



detail) under P. michailovskii that this taxon 'is an intermediate form between P. phaeonotus 
and P. ater; and future researches will probably prove that these two forms are conspecific.' 
Dresser (1889: 88) also considered two males from Tiflis, Transcaucasia, to be P. phaeonotus 
and remarked that 'a comparison of [P. michalowskii] with the type of P. phaeonotus in the 
British Museum convinces me that the two forms cannot possibly be separated, as they 
are identical in coloration and do not differ in size/ Nonetheless, Hartert (1910: 360-361) 
upheld michalowskii and assigned the Lenkoran specimens (mentioned above) to this taxon. 
Zarudny (1911), in distinguishing his gaddi specimens from his own example of phaeonotus, 
remarked that the former had less extensive brown on the breast-sides and belly, and 
distinctly paler upperparts. Witherby (1910) already remarked that an error might perhaps 
have occurred in Blanford's type locality, and he further speculated that the species 
perhaps does not even occur in south-west Iran. Zarudny's specimen, already mentioned, 
presumably allayed such concerns, for the question of phaeonotus has since abated, although 
several commentators (e.g. Vaurie 1959, Harrap & Quinn 1996) have drawn attention to 
the failure of both subsequent collectors (e.g. Koelz) and experienced modern-day field 
workers, such as Derek Scott and Lindon Cornwallis, to find P. ater in the Zagros. As part 
of our ongoing museum work on Iranian birds, and at the prompting of our colleague 
K. Kratochwill (in litt. 2007), we decided to reinvestigate this issue, especially as it was 
apparently never truly examined by Vaurie (1957: 20). 

We assembled relevant material at BMNH, namely their syntype of phaeonotus, eight 
specimens of gaddi and eight specimens of chorrasanicus, for study. Figs. 1-4 shows the 
phaeonotus syntype compared to representative material of the other two Iranian subspecies. 
P. a. phaeonotus has almost invariably been considered either to have the brownest 
upperparts of the entire Caucasus group (Snow 1956, Harrap & Quinn 1996) or at least to be 
browner or darker than other Transcaucaus and Transcaspian taxa (Vaurie 1959, Gosler & 
Clement 2007). However, in considering these and other comparisons, including our own, 
it is vital to recall that virtually all 20th-century and some 19th-century commentators have 

TABLE 1 



Comparative published and unpublished mensural data for three taxa of Coal Tits Periparus ater in Iran; 
all measurements in mm. Authors' data (all measurements by GMK): wing = max. chord, and bill = to skull. 



Source — 
1 Taxon 


Authors' data 


Snow (1956) 


Harrap & Quinn (1996) 
(n = unknown) 


Shirihai & Svensson 
(in prep.) 


Periparus ater phaeonotus 










Wing 


67 (d) 




c.67-70 {<?<?) 




Tail 


46(d) 








Bill 


10.83 (0 








P. a. gaddi 










Wing 


66-69 (n=5) 


67.5-70.0 (3 dV) 
64.5-66.0 (4 ¥?) 


65-70 (<?<?) 
63-70 (??) 


64.5-70.0 (n=8) 


Tail 


44.0-47.5 (n=5) 






45-18 (n=S) 


Bill 


10.54-11.98 (n=5) 








P. a. chorassanicus 










Wing 


67.5-69.5 (3 oV) 
66.5-67.5 (4 ??) 


66-70 (7 <fd) 


66-70 (oV) 




Tail 


45.0-49.5 (3 dw) 
46.5^9.5 (4 ??) 








Bill 


11.22-11.67 (3 oV) 
10.57-11.55 (4 9?) 









Guy M. Kirwan & Andrew Grieve 



86 



Bull. B.O.C. 2010 130(2) 



relied on the single phaeonotus syntype now in Tring. Harrap & Quinn (1996) considered the 
upperparts to be slightly more cinnamon-brown than gaddi, but such elements are variably 
present in both gaddi and chorassanicus (Figs. 2-4). Vaurie (1959) considered chorassanicus 
to be marginally greyer above than gaddi, but such distinction is equally not apparent in 
the Tring material examined by us. Whereas Vaurie (1959) was content to remark that 
phaeonotus was slightly paler below than gaddi, Harrap & Quinn (1996) and Gosler & 
Clement (2007) noted that the paler buff on the flanks reaches to the undertail-coverts; Fig. 2 
demonstrates that gaddi and phaeonotus are very similar in respect of underparts coloration 
and pattern, and chorassanicus is probably indistinguishable from either in these respects. 
The one difference that might be sufficient to distinguish chorassanicus from both phaeonotus 
and gaddi is the slightly narrower bill (cf. Fig. 4), a character already noted by Snow (1956) 
and Vaurie (1959) but seemingly ignored by subsequent commentators. Though we did not 
attempt to quantify this difference, we doubt its significance. (It might also be worth noting 
that Dementiev & Gladkov 1954 had already elected to synonymize chorassanicus with P. a. 
michalowskii (Bogdanov, 1879) of the Caucasus and central and eastern Transcaucasia.) Our 
own and others' measurements (see, e.g., Snow 1956, Harrap & Quinn 1996; and Table 1) 
suggest more or less complete overlap between all three Iranian taxa in wing and tail 
lengths. 

That specimens from the Elburz and Zagros Mountains appear more or less identical 
becomes less surprising when we reconsider the available evidence for the species' presence 
in the latter range. Given that Coal Tits are capable of performing quite long-range eruptive, 
latitudinal, and shorter-range altitudinal movements (see, e.g., Gosler & Clement 2007), and 
vagrants have reached as far afield as Israel (Shirihai 1996), Zarudny's midwinter specimen 
from the Zagros might easily have been an accidental migrant. St. John's midsummer 
specimens, however, are harder to explain, except that, as already correctly noted by 
Witherby (1910), the available syntype BMNH 1874.11.23.35 is in very fresh plumage, which 
seems most atypical if it was indeed taken in June. Moult in P. ater generally commences 
in late May and can continue until late September or early October (Harrap & Quinn 
1996). Given that St. John (a) reported several taxa of principally or exclusively northerly 
distribution in the Zagros in summer, for instance European Robin Erithacus. rubecula, (b) 
that some of these specimens were brought to him by a native collector, such that (c) it 
would have therefore been easy for mistakes of dating between the Gregorian and Islamic 
calendars to have occurred, we suggest that it is difficult to be unequivocal about the dating 
of the P. a. phaeonotus syntype, especially given its plumage state. From the 320 specimens 
collected by Blanford and St. John received from the India Museum by the British Museum 
(and now held at Tring), it is obvious that St. John was collecting birds in the environs of 
Shiraz from at least June to December (pers. obs.). Moult in some of the other Paridae (e.g. 
a Great Tit Varus major and a Sombre Tit Poecile lugubris) taken by St. John in this region in 
June also appears to be well advanced, at least compared to our knowledge of the moulting 
regimes of these species in Europe (Flegg & Cox 1969, Dhondt 1981, Svensson 1992). 
This might, of course, merely reflect the different regime of populations in southern Iran. 
Nonetheless, a mistake in the specimen's date appears to us to require as much elimination 
as the alternatives, i.e. that Periparus ater has, since the early 20th century, become extinct 
in the Zagros, or that the considerable subsequent field work has failed to locate any 
breeding population there of an obvious species. If the Zagros birds were all non-breeders, 
the question arises as to their breeding grounds. Given the syntype's close match for 
specimens of gaddi we consider it likely that its origin was elsewhere in (northern) Iran. 
Until better evidence becomes available, we recommend that P. a. phaeonotus be considered 
an apparently rare visitor to the Zagros Mountains, and that P. a. gaddi be treated as a 



Guy M. Kirwan & Andrew Grieve 



87 



Bull. B.O.C. 2010 130(2) 



synonym of phaeonotus, whilst P. a. chorassanicus is only very doubtfully distinct from other 
specimens taken elsewhere in northern Iran. 

Acknowledgements 

We are grateful to staff at the Natural History Museum, Tring, namely Dr Robert Prys-Jones, Mark Adams 
and Alison Harding, for their ever-sterling assistance in the collection and library there. Prys-Jones and 
Dr Lars Svensson refereed the submitted manuscript and made very valuable comments that improved it 
immeasurably. We thank Anita Gamauf, Paul Sweet, Pavel Tomkovich, Roman Kashkarov and Vladimir 
Loskot for searching unsuccessfully for the Zarudny specimen of P. a. phaeonotus on our behalf. Dr C. S. 
Roselaar kindly provided data on specimens of Coal Tit from Iran. Dr Kaushik Deuti searched for specimens 
of Periparus ater in the Calcutta museum on our behalf, and Dr Jo Cooper also made efforts to locate these 
specimens. Much gratitude is due to Karl KratochwilL who alerted us to the interesting problem posed by 
Iranian P. ater populations, and who might just as easily have prepared this text himself. 

References: 

Blanford, W. T. 1873. Description of new species of Nectarinia, Sitta, and Parus from Persia and Baluchistan. 
Ibis (3)3: 86-90. 

Blanford, W. T. 1876. Eastern Persia: an account of the journeys of the Persian Boundary Commission 1870-72, vol. 
2. Macmillan, London. 

Dementiev, G. P. & Gladkov, N. A. 1954. [The birds of the Soviet Union], vol. 5. Nauka, Moscow. 
Dhondt, A. A. 1981. Postnuptial moult in Great Tit in southern Sweden. Ornis Scand. 12: 127-133. 
Dickinson, E. C. (ed.) 2003. The Howard and Moore complete checklist of the birds of the world. Third edn. 

Christopher Helm, London. 
Dresser, H. E. 1889. Notes on birds collected by Dr. G. Radde in the Transcaspian region. Ibis (6)1: 85-92. 
Flegg, J. J. M. & Cox, C. J. 1969. The moult of British Blue Tit and Great Tit populations. Bird Study 16: 

147-157. 

Gosler, A. & Clement, P. 2007. Family Paridae (tits and chickadees). Pp. 662-750 in del Hoyo, J., Elliott, A. & 
Christie, D. A. (eds.) Handbook of the birds of the world, vol. 12. Lynx Edicions, Barcelona. 

Harrap, S. & Quinn, D. 1996. Tits, nuthatches and treecreepers. Christopher Helm, London. 

Hartert, E. 1910. Die Vogel der paldarktischen Fauna, Bd. 1(3). R. Friedlander und Sohn, Berlin. 

Kirwan, G. M., Boyla, K. A., Castell, P., Demirci, B., Ozen, M., Welch, H. & Marlow, T. 2008. The birds of 
Turkey: the distribution, taxonomy and breeding of Turkish birds. Christopher Helm, London. 

Sclater, W. L. 1892. On the Indian Museum and its collection of birds. Ibis (6)4: 65-87. 

Seebohm, H. 1883. Notes on the birds of the Caucasus. Ibis (5)1: 1-37. 

Shirihai, H. 1996. The birds of Israel. Academic Press, London. 

Shirihai, H. & Svensson, L. In prep. Photographic handbook to the birds of the Western Palearctic, vol. 1. 

Christopher Helm, London. 
Snow, D. W. 1956. Geographical variation in the Coal Tit, Parus ater L. Ardea 43: 195-226. 
Snow, D. W. 1997. Should the biological be superseded by the phylogenetic species concept? Bull. Brit. Orn. 

CI. 117: 110-121. 

Vaurie, C. 1957. Systematic notes on Palearctic birds. No. 27 Paridae: the genera Parus and Sylviparus. Amer. 
Mus. Novit. 1852: 1-43. 

Vaurie, C. 1959. The birds of the Palearctic fauna: Passeriformes. H. F. & G. Witherby, London. 

Warren, R. L. M. & Harrison, C. J. O. 1971. Type-specimens of birds in the British Museum (Natural History), vol. 

2. Trustees of the Brit. Mus. (Nat. Hist.), London. 
Witherby, H. F. 1910. On a collection of birds from the south coast of the Caspian Sea and the Elburz 

Mountains, with field notes by R. B. Woosnam. Ibis (9)4: 491-517. 
Zarudny, N. 1905. [Itinerary of the voyage to western Iran in the year 1903-1904]. Ezhegodnik' Zoologicheskago 

Muzeya Imperatorskoi Akademii Nauk 9: XLV-LI. [In Russian.] 
Zarudny, N. 1911. Verzeichnis der Vogel Persiens. /. Orn. 59: 185-241. 

Addresses: Guy M. Kirwan, 74 Waddington Street, Norwich NR2 4JS, UK, e-mail: GMKirwan@aol.com. 
Andrew Grieve, 3 Miriam Close, Second Avenue, Caister-on-Sea, Great Yarmouth, Norfolk NR30 5PH, 
UK, e-mail: agl947@hotmail.co.uk 



© British Ornithologists' Club 2010 



Pavel S. Tomkovich 



88 



Bull. B.O.C. 2010 130(2) 



Assessment of the Anadyr Lowland subspecies of 
Bar-tailed Godwit Limosa lapponica anadyrensis 

by Pavel S. Tomkovich 

Received 2 October 2009 

Summary. — New specimens of breeding Bar-tailed Godwits Limosa lapponica in 
the Zoological Museum of Moscow State University have permitted a revision 
of the doubtful subspecific status of the isolated population that breeds in the 
Anadyr River basin, Chukotka, Russia. It is demonstrated that in spite of some 
intermediate characters between westerly L.l. menzbieri and the easterly L.l. baueri, 
birds of the Anadyr population should not be treated as a cline. Birds of this 
population differ significantly from one or both neighbouring populations in 
their back pattern, axillaries barring, number of bars on the axillaries, contrast of 
lines on the underwing-coverts and, in males, absence of a whitish patch on the 
bent wings formed by the upper greater secondary-coverts. Thus, the Anadyr 
population should be treated as a separate subspecies, L.l. anadyrensis Engelmoer 
& Roselaar, 1998. 

Two new subspecies of Bar-tailed Godwit Limosa lapponica were described from Siberia 
in the late 20th century based on an in-depth analysis of specimens (Engelmoer & Roselaar 
1998). In addition to the known East Siberian subspecies L.l. menzbieri, it was suggested 
to recognise L.l. taymyrensis and L.l. anadyrensis from western and easternmost Siberia, 
respectively. However, the necessity to name the easternmost Siberian population was 
subsequently questioned by Tomkovich & Serra (1999) because Engelmoer & Roselaar, 
(1) included both local and non-breeding specimens in their analyses, the latter from an 
area known to host godwits of at least two other subspecies (L.l. menzbieri and L.l. baueri) 
on migration, and (2) they based their assessment on only a few specimens of known 
nesting origin. Adding to the confusion is the continued uncertainty as to the geographic 
provenance of the holotype of L.l. anadyrensis. Since Engelmoer & Roselaar (1998), additional 
specimen records have expanded the known breeding range of godwits on the Anadyr 
Lowland, Chukotka Autonomous Area, Russia, but more importantly, new specimens of 
known breeding origin have become available, both from the Anadyr Lowland and Alaska. 
It is essential to have Alaskan specimens for direct comparisons with birds from Asia. Here 
I use this new information to reassess the taxonomic status of the population that currently 
bears the name L.l. anadyrensis. 

Distribution 

The eastern part of the species' breeding range is shown in Fig. 1. The breeding range 
of the putative L.l. anadyrensis population is very restricted and until recently known 
to encompass only a c.250-km-long stretch of the Kanchalan River, Anadyr Lowland 
(Kistchinski et al. 1983). Subsequent records in the first decade of the 21st century have 
shown godwits breeding or suspected of breeding in additional areas between 63°57'N and 
65°50'N and from 174°56'E to 178°41'E (Lappo et al in prep.; E. Koblik & Y. Red'kin pers. 
comm.). Recently, a godwit thought to be L.l. baueri was fitted with a satellite tag in New 
Zealand and tracked to the Belaya River valley (66°14'N / 173°50'E), a northern tributary of 
the Anadyr (Gill 2008), suggesting an additional possible breeding site for L.l. anadyrensis. 
Still no signs of breeding Bar-tailed Godwits have been found on the middle Anadyr River, 



Pavel S. Tomkovich 89 Bull. B.O.C. 2010 130(2) 




156° 162° 168° 174° 180° -174° -168° 

Figure 1. Eastern part of the breeding range of Bar-tailed Godwit Limosa lapponica in Siberia after Lappo et 
at (in prep.) and in Alaska after McCaffery & Gill (2001). 

in particular, broadly around Markovo (64°40'N, 170°25'E) (Portenko 1939, Kretchmar et at. 
1991; A. V. Kondratyev pers. comm., E. Nesterov & I. Karagodin pers. comm.; PST pers. 
obs.), where the holotype of putative L.l. anadyrensis originates (Tomkovich & Serra 1999). 

Material and methods 

Specimens used in this study included, presumably locally breeding birds (based on 
their behaviour) from the Anadyr Lowland collected in 2005-06 (n=S) and adults guarding 
young on the Kanchalan River, north-eastern Anadyr Lowland in 1975 (n=7). These were 
compared with breeders from the Yukon-Kuskokwim Delta, Alaska, taken in 1976 (n=l) 
and 2006 (n=4), as well as with birds from the Chaun Gulf area, north-west Chukotka 
(n=4) and northern Yakutia (w=20) collected in 1912-96. All are housed in the Zoological 
Museum of Moscow University. Recently, museums have begun preparing skins with one 
wing detached and spread to facilitate more detailed studies of feathers and moult. In this 
study all specimens collected post-2000 were prepared accordingly. Unfortunately, no such 
spread wings are available for L.l. menzbieri for comparison with putative L.l. anadyrensis. 

In this study, I compared specimens of the population breeding on the Anadyr River 
lowland with neighbouring subspecies (Fig. 1). Bar- tailed God wits from Alaska have 
always been recognised as L.l. baueri, unlike Siberian birds which are assigned to one or 
another subspecies (e.g., Portenko 1936, 1939, Engelmoer & Roselaar 1998, McCaffery & 
Gill 2001, Stepanyan 2003). The population breeding between the Yana and Kolyma rivers, 
northern Yakutia, Siberia, is definitely considered to be L.l. menzbieri according to Portenko 



Pavel S. Tomkovich 



90 



Bull. B.O.C. 2010 130(2) 





Figure 2. Patterns of back plumage of Siberian and Alaskan 
Bar-tailed God wits Limosa lapponica used for scoring. Depicted 
specimens are from the Zoological Museum of Moscow 
State University: (1) R- 114825 from the Yamal Peninsula, 
West Siberia; (2) R-l 18470 from the Gydan Peninsula, West 
Siberia; (3) R-l 17372 from the Taimyr Peninsula; (4) R-100996 
from the Indigirka River, Yakutia; (5) R-120159 from the 
Anadyr Lowland, Chukotka; and (6) R-123155 from the 
Yukon-Kuskokwim Delta, Alaska. 



(1936) and all subsequent researchers 
who have recognised this race (e.g., 
Higgins & Davies 1996, Engelmoer & 
Roselaar 1998, Stepanyan 2003). The 
taxonomic status of the population 
breeding in the Chaun Gulf area, 
north-west Chukotka, is assigned 
either to L.l. menzbieri (Kistchinski 
1988, Engelmoer & Roselaar 1998) or 
L.l. baueri (Stepanyan 2003). From its 
geographical location, this population 
may form a transition between L.l. 
menzbieri and the population of the 
Anadyr Lowland. Therefore the 
specimens from Chaun Gulf coasts 
are compared here first before turning 
to the Anadyr population. 

I assessed differences in 
specimens by measuring the same 
suite of morphometric variables 
measured by Engelmoer & Roselaar 
(1998), namely bill and tarsus length 
(to 0.1 mm), and length of the wing, 
secondaries and rectrices (to 1.0 mm). 
Only wing length was measured 
differently. Engelmoer & Roselaar 
(1998) used the maximum length 
of the wing, i.e. wing maximally 
straightened and flattened against a 
ruler. I measured flattened but not 
straightened wing length on a ruler, 
because straightening seems to give 
a much more variable characteristic 



and it is not always possible to 
measure straightened wings on skins. Thus, wing length measurements obtained in this 
study cannot be compared directly with those of Engelmoer & Roselaar (1998). 

I also scored the pattern of light and dark barring on the axillaries (after Engelmoer 
& Roselaar 1998: Fig. 13) and counted the number of dark bars on the outer web of the 
axillaries. The barring varies on the different axillary feathers; therefore the longest axillary 
feather on a specimen was used for pattern scoring and counting of dark bars. 

Lastly, though Engelmoer & Roselaar found no differences in the degree of whiteness of 
the uppertail-coverts among stocks of godwits, I nevertheless scored this region and also that 
of the back using a score of 1-6 (Fig. 2). Plumage of study skins was compared also in other 
respects, but without a quantitative approach. All measurable differences were compared 
using Systat (version 7.01, SPSS Inc. 1997) with critical values considered where P<0.05. 



Results 



Only four specimens, all females, of Bar-tailed Godwit are available from the Chaun 
Gulf, north-west Chukotka, and they are identical (f-test & Mann- Whitney test, P>0.1) 



Pavel S. Tomkovich 



91 



Bull. B.O.C. 2010 130(2) 



TABLE 1 



Measurements of eastern samples of adult breeding Bar-tailed Godwits Limosa lapponica held in the 
Zoological Museum of Moscow State University. For each population mean ±S.D. (n) are given in the 

upper row and limits in the lower row. 



Population 


Wing 


Bill 


Tarsus Secondary 
males 


Tail 


Back 
score 


Axillary 
score 


No. of 
bars on 
axillaries 


Yakutia- 


210.6±3.8 (8) 


85.09±3.41 (7) 


52,21±1.61 (9) 87.1+1.9 (9) 


68.7±5.6 (9) 


4.0 (9) 


(9) 


8.4 (9) 


Chaun 


208-219 


81.4-91.2 


ACi O F A O OP f\C\ 

49.2-54.3 85-90 


55-75 


4-5 


D, E, G 


7-10 


Anadyr 


21/.6±3./ (10) 


82.43±4.21 (10) 


53.82±2.28 (10) 89.5±1.84 (10) 


■71 o . o o /1 n\ 
/ 1.3±3.9 (10) 


5.1 (10) 


(10) 


n a /ia\ 
9.4 (10) 




210-228 


75.0-89.5 


50.6-57.6 87-92 


66-78 


4-6 


h, G 


8-11 


Alaska 


ll/.5±5.o (4) 


84.60±4.16 (4) 


56.1+2.43 (4) 91.75±2.21 (4) 


/0.0±0.8 (4) 


6 (4) 


(4) 


10 (4) 




lOO OOO 

223-232 


80.5-90.4 


54.4-59.7 90-95 
females 


69-71 


6-6 


G 


10-10 


Yakutia- 


220.0±4.0 (14) 


107.46±5.88 (14) 54.84±1.73 (15) 93.4±2.32 (15) 


73.3±3.5 (15) 


4.1 (15) 


(15) 


8.1 (15) 


Chaun 


214-228 


100.1-119.9 


52.1-58.3 90-97 


69-79 


3-5 


E 


7-10 


Anadyr 


224.6±10.1 (5) 


101.62+10.7 (5) 


56.46±2.98 (5) 94.2+3.11 (5) 


73.0±2.9 (5) 


5.6 (5) 


(5) 


9.8 (5) 




213-235 


85.8-115.9 


53.6-60.2 91-98 


70-77 


5-6 


E, G 


9-10 


Alaska 


240 (1) 


113.7(1) 


63.5 (1) 100 (1) 


73(1) 


6(1) 


G(l) 


9(1) 



in all characteristics to more western female godwits from Yakutia that belong to L.l. 
menzbieri. Comparison of females collected in Chaun and Anadyr revealed that they 
differ significantly in back score and number of bars on the axillaries (Mann- Whitney test, 
P<0.05). Following these results, samples from Yakutia and Chaun were lumped in further 
analyses. 

Quantitative characteristics of birds of the population breeding on the Anadyr 
Lowland and neighbouring subspecies are presented in Table 1. Information presented in 
this table supports the findings of earlier authors that large sexual differences exist in most 
morphometries, particularly in the length of the wing, bill, tarsus and secondary feathers. 
These large size differences between males and females are shown in all three compared 
populations. 

In wing length, tarsus length and secondary feather length, Anadyr males and females 
are intermediate in average between the other two populations (Table 1), in accordance 
with their central geographical position, while bill length in both sexes of Anadyr birds is 
on average smallest and does not differ significantly from either neighbouring population. 
Analyses of variance revealed a high degree of specificity of Anadyr males in wing 
length (P<0.001), tarsus length (P=0.017) and secondary feather length (P=0.002), but not 
in bill length (P=0.4). Differences in females do not reach the significant level in any of 
the morphometries, possibly partly because of the small Alaskan sample size (one bird). 
The same result is achieved by discriminant analysis applied to the three most important 
measurements, wing length, bill length and tarsus length (P=0.002 for males; P=0.099, n.s. 
for females). 

As to plumage variables under comparison, no significant sexual difference was 
found within the Yakutia-Chaun and Anadyr populations (Mann- Whitney test, P>0.1), 
but this could not be tested for the Alaskan birds with only one female available. This 
differed from males in only one of the considered characteristics — it is the only Alaskan 



Pavel S. Tomkovich 



92 



Bull. B.O.C. 2010 130(2) 



specimen at my disposal that has nine not ten dark bars on the longest axillary. This 
result agrees well with the finding of Engelmoer & Roselaar (1997) concerning absence of 
sexual differences in scored plumage variables; because of this, sexes were combined for 
quantitative comparisons of plumage between the populations in this study. The studied 
plumage characteristics in Bar-tailed Godwits of the Anadyr region are intermediate on 
the gradient in eastern populations, but they are significantly specific (ANOVA for each: 
back pattern, axillary pattern and number of bars on the axillary feather, P<0.001). The 
Anadyr population also differs from the two others according to discriminant analysis 
when all three characteristics are considered (P<0.001). However, differences are smaller 
when comparing only Anadyr and Alaskan birds, being significant only for back pattern 
(Mann-Whitney test, P=0.014). 

Two additional plumage characteristics useful for distinguishing the populations were 
found, but these were not quantified. First, the contrast of dark lines on the underwing- 
coverts of Bar-tailed Godwits decreases eastward, which difference can be seen best on the 
greater underwing primary-coverts. Only a few spread wings are available for comparison 
with none from the Yakutia-Chaun region, making statistical analysis impossible. Second, 
on folded wings the greater upperwing-coverts in the Anadyr population are of the same 
general colour as the other wing-coverts, although they often have narrow whitish edges 
or fringes. Anadyr birds share this character with Yakutia-Chaun birds, but Alaskan males 
differ markedly: the four birds examined are not uniform grey-brown, but show a slight 
whitish tinge and broad greyish-white fringes to the greater upperwing-coverts; the only 
Alaskan female checked does not have these prominent whitish fringes to the wing-coverts. 
As a result, folded wings of the Yakutia-Chaun and Anadyr population specimens are rather 
uniformly coloured above, whilst a whitish wing patch is shown by Alaskan males (Fig. 3). 
This difference in coloration of male wings does not seem to be due to the feathers being 




Figure 3. Coloration of the wings in specimens from the Anadyr (two lower birds) and Alaskan (two upper 
birds) populations of Bar-tailed Godwit Limosa lapponica; females two central birds, males upper and lower 
birds 



Pavel S. Tomkovich 



93 



Bull. B.O.C. 2010 130(2) 



slightly fresher in specimens collected in Alaska, because no difference is observable when 
comparing the one Alaskan male taken in July with three others collected in May. 

Discussion 

Identity of birds from the Chaun Gulf area and north-eastern Yakutia confirms the view 
of Kistchinski (1988) and Engelmoer & Roselaar (1997) that they belong to L.l. menzbieri, for 
which the type locality is the Indigirka River delta, Yakutia (Portenko 1936). 

The above analysis showed that most studied characters of size and scored plumage 
variables show signs of gradual change west to east, but they nevertheless significantly 
differ between the eastern populations of Bar-tailed Godwit. Colour contrast on the folded 
wing of males does not follow this pattern, being present in the Alaskan and absent in 
both the Anadyr and Yakutia-Chaun populations. Hence Anadyr godwits are distinct in 
several characters from both westerly Yakutia-Chaun (L.l. menzbieri) and easterly Alaska 
(L.l. baueri) birds. Differences in plumage (back pattern, axillary barring pattern, number of 
bars on the axillary feather, contrast of lines on the underwing-coverts, and uniformity of 
colour on the bent wing) are responsible for the significant peculiarity of Anadyr birds. 

Engelmoer & Roselaar (1997) stated that, in comparison with Alaskan birds, 'secondary 
lengths are longer' in L.l. anadyrensis. The present findings do not support this conclusion. 
These authors described L.l. anadyrensis on the basis of morphometries (mostly intermediate 
among eastern races), and they remarked that this population and Alaskan L.l. baueri 'share 
the dark axillaries and upper tail coverts'. These statements differ from the findings of the 
current study in respect of several plumage characteristics separating eastern populations 
quite well from each other. It also merits noting that wing length measurements in this 
study were consistently smaller than those given by Engelmoer & Roselaar (1997), which 
reflects methods of measuring this parameter and therefore are not surprising. 

From the above analysis it is certain that the Anadyr population of Bar-tailed 
Godwit differs from other populations morphologically, and hence is meritorious of a 
separate name. As was clearly shown by Engelmoer & Roselaar (1997) on the basis of 
morphometries none of the four old names given to non-breeding birds of the southern 
Pacific can be applied to either of the Bering Sea breeding populations, therefore their 
name L.l. anadyrensis should be used for the Anadyr population. As a result of this study a 
new diagnosis for L.l. anadyrensis can be suggested. 

Diagnosis. — Bent wings of males are uniformly coloured similar to westerly L.l. 
menzbieri but unlike easterly L.l. baueri, which have a whitish patch formed by the upper 
greater secondary-coverts (Fig. 3). Measurements of the sexes given in Table 1 (although 
not significant in females), back pattern (score 5 is most typical), axillary barring pattern 
(score E or G), number of bars on the longest axillary feather (9 and 10 are typical), are all 
intermediate between L.l. menzbieri and L.l. baueri. Contrast of the lines on the underwing- 
coverts increases in comparison with L.l. baueri. 

Notes on the holotype. — There are uncertainties as to the origin of the holotype of 
L.l. anadyrensis (Tomkovich & Serra 1999), no. 45871 in the Zoological Institute in St. 
Petersburg, Russia. The holotype is a female with brood patches, supposedly collected on 
3 June 1897 near Markovo, on the middle Anadyr River, where the species is unknown to 
breed. Information concerning the breeding of Bar-tailed Godwit near Markovo (Marcova) 
was based on a report by N. P. Sokolnikoff in Allen (1905) and the data originating from 
Markovo and the Anadyr Gulf area is confusing (Portenko 1939). This fact together with 
the early date for a female to have developed brood patches and indication of male sex 
on the specimen label instead of female (real sex is obvious from morphometries and 
plumage), all raise doubts about the specimen and / or its label. It was suggested that 



Pavel S. Tomkovich 



94 



Bull. B.O.C. 2010 L30(2) 



labels of two specimens, the holotype female and a migrant male Bar-tailed Godwit, 
delivered to the St. Petersburg Zoological Institute in late 19th century were exchanged at 
some stage (Tomkovich & Serra 1999). 

The very bad condition of the holotvpe prevented its transportation from St. 
Petersburg to Moscow for this study. Based on photographs and some additional notes 
kindly made by Dr V. M. Loskot, it is clear that the specimen fits the description of not only 
L.I. anadyrensis but also L.I. menzbieri. It has an appropriate back pattern (score 5, which 
can be found also in L.I. menzbieri) and uniformly coloured bent wing (identical in these 
two races). Measurements of the specimen (in Engelmoer & Roselaar 1997) fit any of the 
eastern races, apart from wing length, which is incomparable between this study and that 
of Engelmoer & Roselaar (1997), but does not accord well with the range of L.I. menzbieri 
females (Wilson et al. 2007). It is thus certain that the holotvpe is not a typical example of 
L.I. anadyrensis. Moreover, doubts persist concerning its original label. 

Biology and migration. — No focused study on the breeding ecology, biology and 
/ or migrations of L.I. anadyrensis has been undertaken, and no nest has been found. 
Nevertheless, several facts, related mostly to breeding phenology are available. 

Until very recently nothing was known concerning the migration routes and wintering 
grounds of L.I. anadyrensis. However, it was suggested that thousands of godwits on 
passage in coastal west-central Kamchatka, Russian Far East, during mid May possibly 
belong to this population (Wilson et al. 2007). In 2007, during a study of Bar-tailed Godwits 
that spend the non-breeding season in New Zealand, one of 15 birds fitted with a satellite 
transmitter migrated from Golden Bay, New Zealand, to the Yellow Sea and then to 
the Belaya River valley/ a northern tributary of the Anadvr, where the bird spent the 
entire breeding season (Gill 2008). This male paused en route at the base of Kamchatka 
Peninsula and arrived at its presumed breeding area on 22 May. Bar-tailed Godwits have 
been recorded migrating north along the west Kamchatka coast between 10 May (in some 
years as late as 16 May) and 2 June (Gerasimov & Gerasimov 1998). Obseryations and / or 
collection of several migrants near Markovo were made on 27 May-5 June (Portenko 1939), 
but nothing is known as to their racial identity; Portenko considered all four specimens 
from that area as L.I. menzbieri, not L.I. baueri, while he identified both races at the lower 
Anadyr. An opinion concerning the presence of migrant L.I. baueri on eastern Chukotka has 
been indirectly supported by a USA ring recovery there in spring (Tomkovich 2003). 

According to the behaviour of birds in the second to fourth weeks of June, Bar-tailed 
Godwits on the Anadyr Lowland defend territories, chase avian predators and not very 
actively mob humans (Y. A. Red'kin pers. comm., N. N. Yakushev pers. comm.; PST pers. 
obs.), which indicates the incubation period. The only find of downy chicks (4-5 days old) 
was made on 3 July 1975 and agitated behaviour of other birds in that year was recorded 
after 30 June (Kistchinski et al. 1983), suggesting young hatched in very late June and 
early July. Recently fledged young accompanied bv a group of adults were recorded on 
30 July (Kistchinski et al. 1983). Not a single L.I. anadyrensis has ever been ringed on the 
breeding grounds. An adult Bar-tailed Godwit bearing a New Zealand ring was shot on 2 
October in south-west Kamchatka (Riegen 1999) and a sighting of seven birds with New 
Zealand colour flags on 12-18 August (Schuckard et al. 2006) possibly marks the post- 
breeding migration route of L.I. anadyrensis. On southbound migration Bar-tailed Godwits 
are more abundant in west Kamchatka than during May. However, large numbers of 
birds colour-flagged in north-west Australia were seen in west Kamchatka (Schuckard 
et al. 2006), which may mean that L.I. anadyrensis and Ld. menzbieri mix there, because 
north-west Australian Bar-tailed Godwits belong to the latter subspecies (Wilson et al. 
2007). Surprisingly, not a single record of a Bar-tailed Godwit marked in eastern Australia 



Pavel S. Tomkovich 



95 



Bull. B.O.C. 2010 130(2) 



is known from Kamchatka, which might indicate that the non-breeding grounds of L.l. 
anadyrensis are mostly in New Zealand. 

It is clear that L.l. anadyrensis is currently the least-studied race of Bar-tailed Godwit 
in the Pacific region and hence its small population should be a priority for research in the 
near future. 

Acknowledgements 

This study was only possible due to the accumulation of new Bar-tailed Godwit specimens in the Zoological 
Museum of Moscow University obtained due to the support of Evgeny Syroechkovskiy, Jr., the leader of 
the Arctic Expedition of the Institute of Ecology and Evolution, the Russian Academy of Sciences, and 
Robert .Gill, Jr. of the Alaska Science Center, US Geological Survey. Yaroslav Red'kin and Nikolai Yakushev 
collected several specimens on request. Dr Vladimir M. Loskot, the curator of the bird collection at the 
Zoological Institute of the Russian Academy of Sciences, was of great assistance in collecting information 
on and sending photographs of the L.l. anadyrensis holotype. Mikhail Soloviev helped with the statistics, 
and Elena Lappo assisted in preparing the distribution map. Fig. 2 was kindly drawn by Evgeny Koblik. 
The draft of this paper was greatly improved thanks to the correction of my English and valuable comments 
by Robert Gill, Jr. and Adrian C. Riegen, as well as by a referee, Cees S. Roselaar. My sincere thanks go to 
all these people. 

References: 

Allen, J. A. 1905. Report on the birds in north-eastern Siberia by the Jesup North Pacific Expedition, with 

field notes by the collectors. Bull. Amer. Mus. Nat. Hist. 21: 219-257. 
Engelmoer, M. & Roselaar, C. S. 1998. Geographical variation in waders. Kluwer Academic Publishers, 

Dordrecht. 

Gerasimov, N. N. & Gerasimov, Y. N. 1998. The international significance of wetland habitats in the lower 

Moroshechnaya River (West Kamchatka, Russia) for waders. Intern. Wader Stud. 10: 237-242. 
Gill, R. 2008. [Satellite technology reveals amazing stories about individual Bar-tailed Godwits]. Inform. 

Materials of the Working Group on Waders (Moscow) 21: 48-51. [In Russian.] 
Higgins, P. J. & Davies, S. J. J. F. (eds.) 1996. Handbook of Australian, New Zealand & Antarctic birds, vol. 3. 

Oxford Univ. Press, Melbourne. 
Kistchinski, A. A. 1988. [Avifauna of north-east Asia: history and modern state]. Nauka, Moscow. [In Russian.] 
Kistchinski, A. A., Tomkovich, P. S. & Flint, V. E. 1983. [Birds of the Kanchalan River basin, Chukotsky 

Autonomous Area]. Arch. Zool. Mus. Moscow State Univ. 21: 3-76. [In Russian.] 
Kretchmar, A. V., Andreev, A. V. & Kondratyev, A. Y. 1991. [Birds of the northern plains]. Nauka, Leningrad. 

[In Russian.] 

Lappo, E. G., Tomkovich, P. S. & Syroechkovski, E. E. In prep. Atlas of wader breeding ranges for the Russian 
Arctic. 

McCaffery, B. & Gill, R. 2001. Bar-tailed Godwit (Limosa lapponica). In Poole, A. & Gill, F. (eds.) The birds of 

North America, no. 581. The Birds of North America Inc., Philadelphia, PA. 
Portenko, L. A. 1936. The Bar-tailed Godwit and its races. Auk 53: 194-197. 

Portenko, L. A. 1939. [The fauna of the Anadyr region. The birds], pt. I. Glavsevmorput, Leningrad. [In 
Russian.] 

Riegen, A. C. 1999. Movements of banded Arctic waders to and from New Zealand. Notornis 46: 123-142. 
Schuckard, R., Huettmann, F., Gosbell, K, Geale, J., Kendall, S., Gerasimov, Y., Matsina, E. & Geeves, W. 

2006. Shorebird and gull census at Moroshechnaya Estuary, Kamchatka, Far East Russia, during August 

2004. Stilt 50: 34-46. 

Stepanyan, L. S. 2003. [Conspectus of the ornithological fauna of Russia and adjacent territories]. Academkniga, 
Moscow. [In Russian.] 

Tomkovich, P. S. 2003. List of wader species of Chukotka, Northern Far East of Russia: their banding and 

migratory links. The Stilt 44: 29-43. 
Tomkovich, P. S. & Serra, L. 1999. Morphometries and prediction of breeding origin in some Holarctic 

waders. Ardea 87: 289-300. 

Wilson, J. R., Nebel, S. & Minton, C. D. T. 2007. Migration ecology and morphometries of two Bar-tailed 
Godwit populations in Australia. Emu 107: 262-274. 

Address: Zoological Museum, Moscow M. V. Lomonosov State University, Bolshaya Nikitskaya Street 6, 
Moscow, 125009, Russia, e-mail: pst@zmmu.msu.ru 



© British Ornithologists' Club 2010 



Charles T. Collins 



96 



Bull. B.O.C. 2010 130(2) 



A review of natal pterylosis of passerines: 
useful information or avian marginalia? 

by Charles T. Collins 

Received 28 October 2009 

Summary. — Since Wetherbee's (1957) review of passerine natal down patterns, two 
new neossoptile tracts and a new region of the spinal tract have been identified. 
Natal down patterns provide limited support for some phylogenetic relationships 
based on morphological or molecular information. Ecological and geographic 
correlates noted in natal down patterns need to be revisited when information 
on more individuals and a greater array of species becomes available. The post- 
hatching appearance of down-like coverings of nestlings could represent a 
semiplume portion of the first teleoptile plumage and not natal down. 



The first coat of feathers in some but not all voung birds has been termed the 'natal 
down plumage 7 (Gill 1995). It is made up entirely of filamentous natal down feathers or 
neossoptiles. These feathers lack a shaft and consist of a tuft of barbs which extrudes on the 
tip of an mcoming typical contour feather of the juvenile (first teleoptile) plumage. As they 
are fragile feathers, neossoptiles normally last for no more than a few days to a week in 
passerines before being permanently lost due to abrasion. Some non-passerine chicks have a 
dense coating of natal down as in waterfowl (Anseriformes) and fowl-like birds (Galliformes). 
Others, such as woodpeckers (Piciformes), kingfishers and allies (Coraciiformes) are naked 
at hatching being devoid of any neossoptiles (Gill 1995). In the Apodiformes, newly 
hatched swifts (Apodidae) are naked whilst treeswifts (Hemiprocnidae) and hummingbirds 
(Trochilidae) have variable amounts of neossoptiles (Collins 1978). Passerines encompass 
both extremes with some hatching naked (Skutch 1960, Collins & McDaniel 1989) whilst 
others have a thick covering of up to several hundred neossoptiles (Wetherbee 1957; CTC 
unpubl.). 

The presence or absence of natal down has been noted, sometimes almost in passing, 
by many authors describing passerine chicks. In other cases the colour and length of these 
downs, as well as their distribution on various regions of the body, have been carefully 
noted (Skutch 1960, 1969, Kovshar & Gavrilov 1974, Gill 1982, 1993, 1994, Gill & Dow 1983, 
Smith 1985, Greeney & Gelis 2005, Greeney et al. 2005). Earlier studies of passerine chicks 
combined natal down characters (presence or absence of specific neossoptile tracts) with 
other characters such as mouth colour, tongue spots and size of rictal flanges to assess 
relationships among closely related species or genera (Neufeldt 1972, and references 
therein). A new phase in the study of the natal down plumage began with the detailed 
and quantified study of natal down distribution in North American passerines bv D. K. 
Wetherbee (1957, 1958). This was followed bv a similar survey of natal downs in African 
birds by M. K. Markus (1970, 1972). 

My own interest in this topic was sparked by a brief encounter with Wetherbee and a 
copy of his monograph. I was drawn to some of the gaps in his data, particularly for some 
familiar family level taxa such as the Thraupidae (now Thraupinae: Burns 1997); this gap 
was partially closed by data on Scarlet Tanager Piranga olivacea presented subsequently 
(Wetherbee 1958). My first field season with Neotropical birds in Trinidad permitted me 
to gather some additional information on this diverse group (Collins 1963a). Thereafter, 



Charles T. Collins 



97 



Bull. B.O.C. 2010 130(2) 



during field studies of swifts in Trinidad and Venezuela, I opportunistically collected 
specimens of newly hatched passerines and a hummingbird (Rufous-breasted Hermit 
Glaucis hirsutus: Collins 1978). I followed Wetherbee's terminology in describing these 
specimens, often many years later, as time permitted or when students became interested 
enough to participate (Collins & Kemp 1976, Collins & Minsky 1982, Minsky & Collins 1983, 
Wimer & Collins 1994, Collins & Araya 1998, 2002). At this point it would be valid to ask 
two questions: 'What have we learned' and 'What does it tell us'? 

In answer to the first question, we have learned more about the distribution of 
neossoptiles on passerine birds. Two new neossoptile tracts and additional regions of the 
spinal tract have been identified. Post-humeral neossoptiles were described for the first time 
by Ilyashenko (1984) from seven species of Asian passerines. A unique row of cervical tract 
neossoptiles was described from the Red-capped Cardinal Paroaria gularis (Collins & Bender 
1977a). A new medial row of unpaired neossoptiles has been recognised in the pelvic 
region of the spinal tract (Collins & Bender 1977b). A similar medial row of neossoptiles is 
sometimes found anterior to the mid-dorsal region of the spinal tract and has been termed 
the inter-scapular region (Collins & Keane 1991, Collins & Araya 1998). There is a need 
for additional refinements in the description of the complex distribution pattern of the 
numerous neossoptiles in the capital tract of some Neotropical tyrannid flycatchers (Elainea 
and Phelpsia: CTC unpubl.). 

What natal pterylosis tells us is less clear. It would seem logical that some informative 
comparisons of natal down patterns should be possible based on the new information 
available on additional taxa. This would include the first data on the Neotropical families 
Furnariidae (Collins et al. 1991, Collins & Araya 2002), Conopophagidae (Hilty 1975, 
Hillman & Hogan 2002), Pipridae (Collins 1982) and Tersinidae (Collins 1973) (although 
Swallow Tanager Tersina viridis is no longer recognised at this level: Sibley & Ahlquist 1990). 
However, even among the Thraupinae where there have been several studies (Collins 1963a, 
1973, Ingels 1979, Levy 1997, Collins & Araya 1998), the natal down distribution of only ten 
species in eight genera within this large assemblage (235 species in 58 genera: Paynter & 
Storer 1970) have been examined in detail. In other families, such as the Furnariidae, the 
number of species for which there is natal down information is equally low. Even so, some 
ecological trends have been noted. Closed-nest building species frequently possess few or 
no neossoptiles (Skutch 1960, Collins & McDaniel 1989) and tropical species tend to have 
fewer neossoptiles than congeneric temperate zone species (Collins & Minsky 1982, Wimer 
& Collins 1994). However, these trends are based on only a few genera and need to be 
re-examined when further studies, involving more taxa, become available. 

In addition to the low number of species examined, studies of natal pterylosis have 
generally been characterised by small sample sizes, often only a single brood, and in some 
cases, only a single individual. Intraspecific variation has been examined only in a few cases 
(Clark 1967, Collins 1990). This also needs to be given further attention. 

A variety of single-character analyses have been utilised to clarify higher level 
relationships (Beecher 1953, Tordoff 1954, Glenny 1955, Ames 1971, Raikow 1982, 1987, 
Prum 1990) including some pterolographic studies (Morlion 1980, Clench 1992, 1995). 
However, recent molecular studies utilising cladistic approaches to phylogeny have proved 
far more informative in resolving avian lineages and relationships (Burns 1997, Klicka et al. 
2007). Even so, natal pterylosis data have some utility in supporting conclusions based on 
behavioural, morphological and molecular characters. One early example was the generic 
placement of the Dull-coloured Grassquit Tiaris obscura in Tiaris, as proposed by Schwartz 
(1972) and Bates (1997), and not among the Sporophila seedeaters. Tiaris grassquits build 
globe-shaped nests with a side entrance (Bates 1997, Hilty 2003) and have sparse or no natal 



Charles T. Collins 



Bull. B.O.C. 2010 130(2) 



down (Goodwin 1959; P. Schwartz pers. comm.). The open-cup nest Sporophila seedeaters 
have a more complete covering of neossop tiles (Collins & Kemp 1976). Natal ptervlosis 
data also support the family level separation of the Thamnophilidae and the Formicariidae 
(Sibley & Ahlquist 1990). Chicks of 20 species in 14 genera of the Thamnophilidae have all 
been reported to be naked at hatching (Skutch 1969, Lill & ffrench 1979, Wilkinson & Smith 
1997, Cadena et al. 2000, Wilson 2000, Christian 2001, Hennessey 2002, Armacost 2004; CTC 
unpubl.). Chicks of the Formicariidae generally possess a sparse to heavy covering of natal 
downs, especiallv in Grallaria (but see below); only chicks of Hylopezus and Grallaricula are 
naked at hatching (Schwartz 1957, Skutch 1969, Greeney et al. 2004). 

Neossoptile information can also point to other situations needing further study. 
One example was the relationship of the Thrush-like Manakin Schiffornis turdina to other 
manakins (Pipridae). Skutch (1969) reported it to have 'copious long brownish grey down, 
more abundant than that on the nestlings of the majority of passerine birds.' This contrasted 
with the rather minimal amount of natal down in other piprids (Skutch 1969, Foster 1976, 
Collins 1982, Christian 2001). Later, based on morphological characters, Snow (1971) noted 
the genera Manacus, Pipra and Chiroxiphia formed a well-defined core group in the Pipridae. 
He also felt that the inclusion of Schiffornis was 'especially problematical' and it might best 
be included in the Tityrinae or Tyrannidae. Thereafter, syrinx morphology (Prum & Lanyon 
1989) and DNA hybridisation data indicated Schiffornis to cluster with the 'tityra-becard 
group' of the Tyrannidae (Sibley & Ahlquist 1990). Like Schiffornis, some tyrannids possess 
extensive long natal down (Collins & McDaniel 1989, Collins 1990). 

Neossoptiles in passerines are generally considered to be fully developed in both 
pattern and length at hatching (Wetherbee 1957). However, in a few cases noted bv 
Ilyashenko (1984) it is clear that some neossoptiles, particularly in the post-humeral tract 
can appear 2-3 days after hatching. This was also noted for alar tract neossoptiles in a single 
specimen of Palm Tanager Thraupis palmarum (Collins & Araya 1998). In other cases, Skutch 
(1960) reported Elainea flycatchers to have a dense coat of what he termed 'secondary down' 
that erupts 5-7 days after hatching. These downy feathers are not attached to mcoming 
teleoptiles and thus cannot be considered true neossoptiles. In all likelihood thev represent 
an early-appearing semiplume portion of the first teleoptile (juvenile) plumage. This has 
been reported in Cypseloidine swifts (Collins 1963b) and one passerine, Blue-and-white 
Swallow Notiochelidon cyanoleuca (Arnold et al. 1983). Other reports of such secondary coats 
of natal down in Erithacns and Luscinia (Cramp 1988) need to be critically re-examined. 

Similarly, the occurrence of natal down and other nestling feather coats in antpittas 
of the genus Grallaria needs closer examination. The hatchlings of Scaled Antpitta G. 
guatimalensis are reported to be 'mostly naked with some sparse down' (Dobbs et al. 2001) 
and hatchlings of Scrub Antpitta G. watkinsi were 'mostly naked' and 'sparse blackish down 
was present on most, if not all feather tracts' (Martin & Dobbs 2004). In Pale-billed Antpitta 
G. carrikeri natal down was 'sparse' (Wiedenfeld 1982). However, after 4-5 davs post- 
hatching, chicks of G. guatimalensis had 'dark colored down . . . present on all feather tracts 
except the main element of the ventral tract' (Dobbs et al. 2001). The nestling feather coat 
of 'dense black down' in Rufous Antpitta G. rufula (Pevre de Fabriques 1991), 'dark grey 
down' in White-bellied Antpitta G. hypoleuca (Price 2003), 'dense black downy plumage' and 
'covered in black down' in Variegated Antpitta G. varia (Quintela 1987, Protomastro 2000), 
and 'dark grey down' in two subspecies of Moustached Antpitta G. alleni (Freile & Renjifo 
2003) presumably all refer to a later-appearing feather coat in older nestlings and not to 
the sparse natal down present in hatchlings. Similarly, one Peruvian Antpitta Grallaricula 
peruviana nestling, estimated to be 1-2 days old, was 'bare' but when 13-14 days old was 
'covered in a thick red-brown down' (Greenev et al. 2004). This later-appearing covering of 



Charles T. Collins 



Bull. B.O.C. 2010 130(2) 



downy feathers in both Grallaria and Grallaricula is clearly not natal down which is largely, if 
not completely, pre-hatching in its development (Wetherbee 1957). In all likelihood it is yet 
another case of an early-appearing semiplume portion of the incoming juvenile plumage 
in passerines. How widespread these semiplume feather coats are in passerines and their 
significance to developing chicks remains to be determined. 

The functional significance of natal down remains unclear. As previously reviewed 
(Wetherbee 1957, and references therein), there are several suggested advantages for these 
feathers. Among them are (1) the provision of cryptic coloration, (2) protection from the 
sun's rays, (3) protection from insects, and (4) insulation for the retention of body heat. The 
absence (= loss?) of natal downs in a variety of closed-nest and cavity-nesting species tends 
to support some of these suggested functions. However, there are numerous exceptions. A 
variety of species, as well as the family Thamnophilidae, build open-cup nests and have 
naked chicks. The reverse is also true with some species that construct enclosed nests 
having dense coats of natal down (Collins 1990). Again, with additional information for 
more species on the presence, or absence, of natal downs and their distribution in passerine 
birds it might prove possible to better understand the adaptive significance of the natal 
plumage. 

Considering the limited information derived thus far from studies of natal pterylosis, 
choices will have to be made by both field collectors and museum curators as to whether 
additional material will be collected and made available for future study. In an era of 
shrinking budgets other material with a higher potential information value, especially DNA, 
might have to be given priority. Even so, field workers can still make useful contributions to 
this field of study as shown by the many careful observations made by Skutch (1960, 1969) 
and others mentioned herein. 

References: 

Ames, P. L. 1971. The morphology of the syrinx in passerine birds. Bull. Peabody Mus. Nat. Hist. 37: 1-194. 
Armacost, J. W. 2004. The nest, eggs, and nestlings of Castelnau's Antshrike (Thamnophilus cryptoleucus) with 

notes on its ecology and conservation. Wilson Bull. 116: 262-266. 
Arnold, K. A., Boyd, E. J. & Collins, C. T. 1983. Natal and juvenal plumages of the Blue-and-white Swallow 

(Notiochelidon cyanoleuca). Auk 100: 203-205. 
Bates, J. M. 1997. Distribution and geographical variation in three South American grassquits (Emberizidae, 

Tiaris). Pp. 91-110 in Remsen, J. V. (ed.) Studies in Neotropical ornithology honoring Ted Parker. Orn. 

Monogr. 48. 

Beecher, W. J. 1953. A phylogeny of the oscines. Auk 70: 270-333. 

Burns, K. J. 1997. Molecular systematics of tanagers (Thraupinae); evolution and biogeography of a diverse 

radiation of Neotropical birds. Mol. Phyl. & Evol. 8: 334-338. 
Cadena, C. D., Londoho, G. A. &. Parra, J. L. 2000. Nesting records of five antbird species from the Colombian 

Amazon. Wilson Bull. 112: 313-317. 
Christian, D. G. 2001. Nests and nesting behavior of some little known Panamanian birds. Orn. Neotrop. 12: 

327-336. 

Clark, G. A. 1967. Individual variation in natal pterylosis of Red-winged Blackbirds. Condor 69: 423-424. 
Clench, M. H. 1992. Pterolography of birds-of-paradise and the systematic position of MacGregor's Bird of 

Paradise (Macgregoria pulchra). Auk 109: 923-928. 
Clench, M. H. 1995. Body pterylosis of woodcreepers and ovenbirds (Dendrocolaptidae and Furnariidae). 

Auk 112: 800-802. 

Collins, C. T. 1963a. Natal pterylosis of tanagers. Bird-Banding 34: 36-38. 

Collins, C. T. 1963b. The "downy" nestling plumage of swifts of the genus Cypseloides. Condor 65: 324-328. 

Collins, C. T. 1973. The natal pterylosis of the Swallow-tanager. Bull. Brit. Orn. CI. 93: 155-157. 

Collins, C. T. 1978. The natal pterylosis of hummingbirds. Bull. Soc. Calif. Acad. Sci. 77: 14-21. 

Collins, C. T. 1982. Natal pterylosis of Manacus manacus (Pipridae). Bull. Brit. Orn. CI. 102: 37-39. 

Collins, C. T. 1990. Intraspecific variation in the natal pterylosis of the Ochre-bellied Flycatcher Mionectes 

oleagineus (Tyrannidae). Bull. Brit. Orn. CI. 110: 143-145. 
Collins, C. T. & Araya, T. A. 1998. Natal pterylosis of tanagers II: Tachyphonus, Ramphocelus and Tangara. Bull. 

Brit. Orn. CI. 118: 172-178. 



Charles T. Collins 



100 



Bull. B.O.C. 2010 130(2) 



Collins, C. T. & Araya, T. A. 2002. Natal pterylosis of two Trinidadian ovenbirds (Furnariidae). Pp. 18-22 in 
Hayes, F. E. & Temple, S. A. (eds.) Studies in Trinidad and Tobago ornithology honouring Richard ffrench. 
Dept. of Life Sci, Univ. West Indies, St. Augustine, Occ. Pap. 11. 

Collins, C. T. & Bender, K. E. 1977a. Cervical neossoptiles in a Neotropical passerine. Bull Brit. Orn. CI. 97: 
133-135. 

Collins, C. T. & Bender, K. E. 1977b. The natal pterylosis of the House Finch. Bull. Soc. Calif. Acad. Sci. 76: 
209-211. 

Collins, C. T. & Keane, K. 1991. Natal pterylosis of phoebes. Wilson Bull. 103: 300-303. 

Collins, C. T. & Kemp, M. H. 1976. Natal pterylosis of Sporophila finches. Wilson Bull. 88: 454-457. 

Collins, C. T. & McDaniel, K. M. 1989. The natal pterylosis of closed-nest building tyrant flycatchers (Aves: 

Tyrannidae). Bull. Soc. Calif. Acad. Sci. 88: 127-130. 
Collins, C. T. & Minsky, D. 1982. Natal pterylosis of three Neotropical blackbirds (Icteridae). Bull. Brit. Orn. 

CI. 102: 129-131. 

Collins, C. T., Marin A., M. & Lentino R., M. 1991. Natal pterylosis of Premnoplex brunnescens, Thripadectes 

virgaticeps and Synallaxis candei (Furnariidae). Bull. Brit. Orn. CI. Ill: 118-120. 
Cramp, S. (ed.) 1988. The birds of the Western Palearctic, vol. 5. Oxford Univ. Press. 

Dobbs, R. C, Martin, P. R. & Kuehn, M. J. 2001. On the nest, eggs, nestlings, and parental care of the Scaled 

Antpitta (Grallaria guatimalensis). Orn. Neotrop. 12: 225-233. 
Foster, M. S. 1976. Nesting biology of the Long-tailed Manakin. Wilson Bull. 88: 400^20. 
Freile, J. F. & Renjifo, L. M. 2003. First nesting records of the Moustached Antpitta (Grallaria alleni). Wilson 

Bull. 115: 11-15. 

Gill, B. J. 1982. Description of the newly hatched Willie Wagtail Rhipidura leucophrys. Emu 82: 112-113. 
Gill, B. J. 1993. Natal down and egg size of the Kokako Callaeas cinerea (Aves: Callaeidae). Rec. Auckland Inst. 
Mus. 30: 87-91. 

Gill, B. J. 1994. Natal down of the Silvereye. Notornis 41: 147-148. 

Gill, B. J. & Dow, D. D. 1983. Morphology and development of nestling Grey-crowned and Hall's Babblers. 
Emu 83: 41-43. 

Gill, F. B. 1995. Ornithology. Second edn. W. H. Freeman & Co., New York. 

Glenny, F. H. 1955. Modifications of pattern in the aortic arch system of birds and their phylogenetic 

significance. Proc. US Natl. Mus. 104: 525-621. 
Goodwin, R. 1959. Breeding of the Black-faced Grassquit, Tiaris bicolor, in captivity and some notes on the 

comparative behavior of the genus. Avicult. Mag. 65: 131-134. 
Greeney, H. F., Dobbs, R. C. & Gelis, R. A. 2005. The nest, eggs, nestlings, and parental care of Bronze-olive 

Pygmy-tyrant {Pseudotriccus pelzelni). Orn. Neotrop. 16: 511-518. 
Greeney, H. F., Hannelly, E. C. & Lysinger, M. 2004. First description of the nest and vocalisations of the 

Peruvian Antpitta Grallaricula peruviana with a northward range extension. Cotinga 21: 14-17. 
Greeney, H. F. & Gelis, R. A. 2005. The nest and nestlings of the Long-tailed Tapaculo (Scytalopus micropterus) 

in Ecuador. Orn. Colombiana 3: 88-91. 
Hennessey, A. B. 2002. First description of the nest of the Chestnut-tailed Antbird. Wilson Bull. 114: 161— 

164. 

Hillman, S. W. & Hogan, D. R. 2002. First nest record of the Ash-throated Gnateater (Conopophaga peruviana). 
Orn. Neotrop. 13: 293-295. 

Hilty, S. L. 1975. Notes on a nest and behavior of the Chestnut-crowned Gnateater. Condor 77: 513-514. 
Hilty, S. L. 2003. Birds of Venezuela. Princeton Univ. Press. 

Ingels, J. 1979. Natal pterylosis of three Thraupis tanagers. Bull. Brit. Orn. CI. 99: 12-15. 

Ilyashenko, V. Y. 1984. A new downy pteryla in passerine birds. Bull. Brit. Orn. CI. 104: 53-54. 

Klicka, J., Burns, K. J. & Spellman, G. M. 2007. Defining a monophyletic Cardinalini: a molecular perspective. 

Mol. Phyl. & Evol. 45: 1014-1032. 
Kovshar, A. F. & Gavrilov, E. I. 1974. On the biology of the Olivaceous Leaf Warbler of the Tian-Shan 

Mountains. /. Bombay Nat. Hist. Soc. 71: 367-375. 
Levy, C. 1997. Nesting of an endemic Orangequit, Eneornis campestris (Emberizidae), in lamaica. Carib. J. Sci. 

33: 284-286. 

Lill, A. & ffrench, R. P. 1970. Nesting of the Plain Antvireo Dysithamnus mentalis andrei in Trinidad, West 
Indies. Ibis 112: 267-268. 

Markus, M. B. 1970. A preliminary survey of the occurrence of neossoptiles in South African passeriform 
birds, with special reference to natal pterylosis. M.Sc. thesis. Univ. of Pretoria. 

Markus, M. B. 1972. Notes on the natal plumage of some South African passeriform birds. Ostrich 43: 17-22. 

Martin, P. R. & Dobbs, R. C. 2004. Description of the nest, egg and nestling of Watkins's Antpitta Grallaria 
watkinsi. Cotinga 21: 35-37. 

Minsky, D. & Collins, C. T. 1983. The natal pterylosis of Amphispiza sparrows. Condor 85: 375-376. 

Morlion, M. L. 1980. Pterylosis as a secondary criterion in the taxonomy of the African Ploceidae and 
Estrildidae. Proc. IV Pau-Afr. Orn. Cougr.: 27-41. 



Charles T. Collins 



101 



Bull. B.O.C. 2010 130(2) 



Neufeldt, I. 1972. [Juvenile features of the passeres and possibilities of their use in classification]. Zool. Zn. 

51: 1826-1845. [In Russian.] 
Peyre de Fabriques, F. 1991. Die Einfarb-Ameisen Pitta Grallaria rufa. Tropische Vogel 12: 39-41. 
Price, E. R. 2003. First description of the nest, eggs, hatchlings, and incubation behavior of the White-bellied 

Antpitta (Grallaria hypoleuca). Orn. Neotrop. 14: 535-539. 
Paynter, R. A. & Storer, R. W. 1970. Check-list of birds of the world, vol. 13. Mus. Comp. Zool., Cambridge, 

MA. 

Protomastro, J. J. 2000. Notes on the nesting of Variegated Antpitta Grallaria varia. Cotinga 14: 39-41. 
Prum, R. 0. 1990. A test of the monophyly of the manakins (Pipridae) and of the cotingas (Cotingidae) based 

on morphology. Occ. Pap. Mus. Zool, Univ. Michigan 723: 1-44. 
Prum, R. O. &. Lanyon, W. E. 1989. Monophyly and phylogeny of the Schijfornis group (Tyrannoidea). Condor 

91: 444-461. 

Quintela, C. E. 1987. First report of the nest and young of the Variegated Antpitta (Grallaria varia). Wilson 
Bull. 99: 499-500. 

Raikow, R. J. 1982. Monophyly of the Passeriformes: test of a phylogenetic hypothesis. Auk 90: 431-445. 
Raikow, R. J. 1987. Hindlimb myology and evolution of the Old World suboscine passerine birds 

(Acanthisittidae, Pittidae, Phylepittidae, Eurylaimidae). Orn. Monogr. 41: 1-81. 
Schwartz, P. 1957. Observaciones sobre Grallaricula ferrugineipectus. Bol. Soc. Venez. Cienc. Nat. 88: 42-62. 
Schwartz, P. 1972. El sonido como implemento adicional en la taxonomia ornitologia. Acta IV Congr. Latin. 

Zool. 1: 207-217. 

Sibley, C. G. & Ahlquist, J. E. 1990. Phylogeny and classification of birds. Yale Univ. Press, New Haven, CT. 
Skutch, A. 1960. Life histories of Central American birds, I. Pacific Coast Avifauna 34. Cooper Orn. Soc, 
Berkeley, CA. 

Skutch, A. 1969. Life histories of Central American birds, III. Pacific Coast Avifauna 36. Cooper Orn. Soc, 
Berkeley, CA. 

Smith, G. T. 1985. Natal downs and plumage changes in the Noisy Scrub-bird, Atrichornis clamosus 

(Passeriformes: Atrichornithidae). Rec. Aus. Mus. 37: 157-163. 
Snow, D. W. 1971. The classification of the manakins. Bull. Brit. Orn. CI. 95: 20-27. 

Tordoff, H. B. 1954. A systematic study of the avian family Fringillidae based on the structure of the skull. 

Misc. Publ. Mus. Zool, Univ. Michigan 81: 1-42. 
Wetherbee, D. K. 1957. Natal plumages and downy pteryloses of passerine birds of North America. Bull. 

Amer. Mus. Nat. Hist. 113: 339^36. 
Wetherbee, D. K. 1958. New descriptions of natal pterylosis of various bird species. Bird-Banding 29: 232- 

236. 

W'iedenfeld, D. A. 1982. A nest of the Pale-billed Antpitta (Grallaria carrikeri) with comparative remarks on 

antpitta nests. Wilson Bull. 94: 582-584. 
Wilkinson, F. A. & Smith, U. R. 1997. The first records of the Sooty Antbird (Myrmeciza fortis) with notes on 

eggs and nestling development. Wilson Bull. 109: 319-324. 
Wilson, S. K. 2000. First nest record of the White-throated Antbird (Gymnopithys salvini) and detailed records 

of the Hairy-crested Antbird (Rhegmatorhina melanosticta. Orn. Neotrop. 11: 313-357. 
Wimer, M. C. & Collins, C. T. 1994. Natal pterylosis of some Neotropical thrushes (Muscicapidae: Turdinae). 

Bull. Brit. Orn. CI 114: 170-173. 

Address: Department of Biological Sciences, California State University, Long Beach, California 90840, USA, 
e-mail: ccollins@csulb.edu 



© British Ornithologists' Club 2010 



Jonny Schoenjahn 



102 



Bull. B.O.C. 2010 130(2) 



The type and other early specimens of Grey Falcon 

Falco hypoleucos 

by Jonny Schoenjahn 

Received 10 November 2009 

Summary. — The origin, identity and current location of the type specimen of Grey 
Falcon Falco hypoleucos and three further specimens known to John Gould, collected 
in 1839-45, are investigated. The specimen hitherto considered to be the holotype, 
held at the Academy of Natural Sciences of Philadelphia, is almost certainly not the 
type but a bird secured by Charles Sturt. The holotype almost surely is missing. The 
two specimens at Philadelphia are almost certainly those secured by Sturt at Depot 
Glen. The fourth specimen, collected by John Gilbert in 1842, almost definitely is 
the only specimen of the species held at the National Museums Liverpool. That 
specimen was considered missing but was re-found during this work. 

After John Gould sold his collection of Australian birds to Dr Thomas B. Wilson of 
Philadelphia in 1847-48, it was sent to the firm Maison Verreaux, taxidermists in Paris. The 
consequences were unfortunate for the history of Australian bird collections. Data were lost 
and some specimens disappeared. Gould's Australian collection numbers over 300 type 
specimens, thus the transfer has had significant negative consequences for taxonomists 
studying Australia's avifauna. Historical facts are obscured by ambiguous and inconclusive 
texts, by contradictory statements, and missing evidence such as letters, lists, specimens and 
labels. The four Grey Falcon specimens known to Gould in writing The birds of Australia 
(1848b) are affected by these problems. Their origin and fate are investigated here. 

Materials and methods 

I studied photographs of specimens in collections and compared them with personal 
observations of wild and captive birds, and researched published and unpublished 
materials, including notes by John Gilbert. Unpublished printed and reproduced or 
archived materials are listed as [notes] under 'References'. 

Results 

The holotype. — At a meeting of the Zoological Society of London on 24 November 
1840, John Gould exhibited a specimen of Grey Falcon. The species' description appears 
on pp. 162-163 of Part 8 of the Proceedings of the Zoological Society of London, dated 1840 but 
published in July 1841 (Zoological Society of London 1893). The description and the specific 
epithet refer to the specimen's juvenile plumage; underparts white with spatulate black 
spots, upperparts dark grey, tail grey with obscure brown bars, tipped buff (Marchant & 
Higgins 1993). Gould did not mention bare-part colours. Measurements are given in Table 1. 
Gould (1841b) stated that the specimen was the only example available, but in the Handbook 
to the birds of Australia (Gould 1865: 25), he added that he had characterised 'this species by 
. . . a young female then in my possession'. Morphological differences between the sexes 
appear to be limited to the reversed sexual size dimorphism typical of many raptors, with 
no sex-related plumage differences known (Marchant & Higgins 1993). 



Jonny Schoenjahn 



103 



Bull. B.O.C. 2010 130(2) 



TABLE 1 

Measurements: Gould's type (1840) versus VN 96 / ANSP No. 2099 



Note that only Rice measured the specimen according to known procedures and precision. 
The precision of Gould's measurements is assumed to be to the nearest eighths of an inch, i.e. ± 1/16". 



VjOUIQ S type VS. VINI 70 


Total length 


Wing 


l an 


Rill 
Dill 


Tarsus 


Gould's type (1840) 












inches 


17 


12 1/2 


71/2 


1 1/4 


13/4 


converted to mm 


431.8 


317.5 


190.5 


31.8 


44.5 


range in mm (i.e. ± 1/16") 


430.2^33.4 


315.9-319.1 


188.9-192.1 


30.2-33.3 


42.9-46.0 


VN 96/ ANSP 2099 (in mm) 












Meyer de Schauensee (1957) 




326 


157 


19 


49 


Fisher 


444.5 


324 


187 


31.8 


49.2 


Rice 




314.5 


166.5 


18.8 





Measurements. — Although it is unknown who took the measurements published in the 
Proceedings, they are assumed to be Gould's. Compared with other species described in part 
8 of the Proceedings, it appears safe to presume that they were taken to the nearest eighth of 
an inch, i.e. to a precision of ± 1/16". 

Total length is strongly dependent on the method of specimen preparation and is 
therefore generally disregarded here. Although the bill does not normally change shape 
after death, there are several different ways to measure length (Baldwin et al. 1931, Winker 
1998). The resulting differences are considerable. As Gould's methodology is unknown no 
interpretation is possible. It is unclear how wing length was measured. If it was maximum 
chord then 12.5 inches lies within the range for juvenile females (Marchant & Higgins 1993), 
but is above that for juvenile males, given the assumed precision of Gould's measurements. 
If natural chord was measured, then the maximum chord would be even greater. Tail 
length is difficult to take accurately because it is not always obvious where the feathers 
erupt from the skin (R. McGowan pers. comm.). Gould measured this as 7.5 inches (190.5 
mm), i.e. considerably greater than the range given by Marchant & Higgins (1993), of 
161-170 mm for juvenile females (n=3) and 156-176 mm (n=10) for adult females. Either 
the type was measured differently or it has indeed such a long tail that the bird is perhaps 
female, or 7.5 inches is incorrect, or the skin was damaged. Consequently the measurement 
is disregarded. The length of the tarsometa tarsus is given as 1.75 inches (42.9-46.0 mm, 
if accurate to the nearest eighth of an inch). This range overlaps slightly with males (< 
43.6 mm, ages combined) and slightly more with females (> 44.6 mm, ages combined) 
(Marchant & Higgins 1993). Consequently, this measurement is inconclusive as to sex. 

Winker (1998) pointed out that 'a single measurement taken to represent individual 
size (e.g., wing chord) is not sufficient for careful studies.' He suggested that 'multivariate 
approaches are preferable'. This, together with the uncertainty over Gould's methodology 
and his precision, makes a definitive conclusion as to sex on the basis of his measurements 
impossible. There is a moderate probability, however, that it is a female on wing length. 

Collection. — The first information about the type is found on a collection data sheet 1 
written by John Gilbert, probably in 1839, just after obtaining the specimen. Gilbert was 
Gould's principal collector in Western Australia. 



lr The following was recorded on a collection data sheet by Gilbert, probably in 1839: Falco. Aboriginal name. 
Gwet"=el=bur (Mountain) Colonial White Falcon. A very rare visitants [sic] in this country. I saw no other 
specimen in any collection, this [sic] specimen was killed over the Mountain about 60 Miles from the Coast. 
Presented by Mr L. Burgefi [sic]. Source: Tapers [microform]: [M725-727], 1835-1876. Mfm M726, No. l.e'. 
(University of Cambridge, Department of Zoology.) Australian Joint Copying Project, Canberra. 



Jonny Schoenjahn 



104 



Bull. B.O.C. 2010 130(2) 



Lock C. Burgess, 1813-86 (Whittell 1938, Fisher 1992, Sauer 1999), lived near York, east 
of Perth in Western Australia, where he moved in 1836 (Whittell 1938). Although Gilbert did 
not expressly state that Burgess collected the specimen, it appears a safe assumption. The 
specimen was presented to Gilbert in 1839, during his first visit to the Swan River Colony, 
between 6 March 1839 and 29 January 1840 (Chisholm 1938). Gould (1841b) repeated the 
information provided by Gilbert, writing that Burgess 'stated that it had been killed over 
the mountains about sixty miles from the coast/ 

It is very likely that Burgess collected the specimen near York, which is on the Avon 
River, c.87 km from Perth or slightly further from the coast, consistent with Gilbert's '60 
miles' when travelling overland to the east. It is inland of the Darling Range, consistent with 
"over the Mountain'. Gilbert may have met Burgess during a trip inland in June 1839, when 
Gilbert passed through York on 20 June (Fisher 1992). The precise date is unclear. It was not 
until September 1839 that Gilbert mentioned 'a Falcon like Gvrfalco ' to be one of the latest 
additions to his collection 2 (Whittell 1941). The specimen was shipped on the Lord William 
Bentinck to England, in 1840 3 . 

The type locality had been incorrectly assumed by some to be the vicinity of the Moore 
River, but was clarified by Whittell (1938). G. M. Mathews may have been responsible for 
this. In his The birds of Australia (1915-16), he cited the relevant sentence in Gould with 
incorrect punctuation: The specimen . . . was presented to Mr. Gilbert by Mr. L. Burgess, 
who stated that he had killed it over the mountains, about sixty miles from Swan River: 
[sic] subsequently it was obtained by Mr. Gilbert himself in the vicinity of Moore's River 
in Western Australia'. The locality was correctly given by Meyer de Schauensee (1957), 
Condon (1975) and Debus (in del Hoyo et ah 1994) as York. 

Illustration. — Gould's wife Elizabeth lithographed the specimen. The plate is titled 
'FALCO HYPOLEUCUS: Gould.', marked 'J&E. Gould del. et lith/, and shows a juvenile. 
It is the first plate in Part 5 of Gould's The birds of Australia (1840-48), published on 1 
December 1841. The illustrated bird's plumage matches Gould's (1840) description. 
Obvious are the white underparts with the prominent spatulate spots typical of juveniles, as 
are the dark grey upperparts. Unmentioned in the description were the bare-parts colours. 
As illustrated, the cere is the same yellow as the toes. The bill is mostly pale grey, becoming 
dark grey to almost black at the tip. The side of the basal lower mandible, i.e. 'below' the 
cere, is illustrated as being the same yellow as the cere. The orbital ring is pale grev, the 
adjacent bare skin slightly darker. Noteworthy is that no yellow or orange is shown around 
the eye. That, together with the upper mandible lacking any yellow, indicates that the type 
is in its first year. Young Grey Falcons initially lack any yellow or orange around the eye 
and upper mandible, but acquire such colour later (pers. obs.). I have found no evidence of 
any notes on the appearance of the plumage and bare parts, neither of the live bird nor of 
the fresh specimen. 

The text to the plate reads: 'Falco hypoleucus [see Name, spelling and citation], 
Gould. White-breasted Falcon. The only specimen of this genuine and noble Falcon in my 
collection, or indeed that has ever come under my notice', and continues 'to all appearance, 
my specimen, which is rather less than a male Jerfalcon, has the adult plumage.' and is 



2 Gilbert, J. (1839) Letter to John Gould, from Perth, Western Australia, 3 September 1839. En Papers of 
Gregory M. Mathews, 1900-49 [manuscript]. MS 1465, series 24, folder 7'. National Library of Australia, 
Canberra. 

3 The Burgess specimen was shipped on the Lord William Bentinck to England, in 1840. Gilbert's List of 
Specimens sent by [?]... to London from Sydney' contains '1 Falco (White)'. Source: Gilbert, John (Australia) 
8 ms booklets, c. 1841-45.' In 'John Gould (1804-81). Papers and correspondence, Z MSS GOU A and B [micro- 
form]: [M2888-2902]. Mfm M2902, No. 10'. Australian Joint Copying Project, Canberra. 



Jonny Schoenjahn 



105 



Bull. B.O.C. 2010 130(2) 



followed by a description of the specimen similar to the English text in Gould (1840), again 
omitting mention of the bare-parts colours. The sex is also not mentioned. 

Thus, it appears that the type is a juvenile, probably a female on wing measurement, 
and was collected by Lock Burgess near York, Western Australia, in 1839. It is the holotype 
being the only specimen available to Gould in describing the species; there are no 
paratypes. 

According to Mathews (1913), 'Gould figures the bird from West Australia beautifully 
in his Birds of Australia [part 5 of Gould 1840-48]. This plate he afterwards cancelled, and 
later [part 36 of Gould 1840-48] figured the birds collected by Captain Sturt at the Depot, 
South Australia. Those who, like myself, have the cancelled plate, can see the difference by 
comparing the two/ In that final part 36 (Gould 1848a), a new plate and new letter press 
were published. The new plate is entitled 'FALCO HYPOLEUCOS: Gould.', marked 'J. 
Gould and H. C. Richter del. et lith.', and shows two birds. Following the completion of the 
36 parts of The birds of Australia (1840-48), Gould published the material in seven volumes 
under the same title (Gould 1848b). He directed the binder that 'the Plate and Description 
... of Falco hypoleucus in Part V. are to be cancelled, and the Plate and Description of . . . 
Falco hypoleucus in Part XXXVI. inserted in lieu thereof/ (Sauer & Evans 1989). Hence the 
seven-volume edition also includes Richter's plate; it is plate 7 in volume 1. 

The four specimens mentioned by Gould. — Gould (1848a) stated: 'Up to the present time 
only four examples of this fine Falcon have been procured'. In the letter press to the Grey 
Falcon plate, he wrote: 'Of this rare and beautiful Falcon I have seen only four examples, 
three of which are in my own collection, and the fourth in that of the Earl of Derby. The 
specimen from which my description in the "Proceedings of the Zoological Society" was 
taken, was presented to Mr. Gilbert by Mr. L. Burgess, who stated that he had killed it over 
the mountains, about sixty miles from Swan River; subsequently it was obtained by Mr. 
Gilbert himself in the vicinity of Moore's River in Western Australia; and my friend Captain 
Sturt had the good fortune to secure a male and a female during his late adventurous 
journey into the interior of South Australia.' Gould did not clarify which of the four was in 
the collection of the Earl of Derby. We have only the certainty that Burgess' specimen was 
in Gould's collection. 

Gilbert's specimen. — In August 1842, during his second stay at Swan River Colony, 
Gilbert visited the Moore River, north of the settlement, with James Drummond, the 
Government Botanist of Western Australia. Gilbert had not been that far north before. On 29 
August, at or near a place called Nugadrine or Mugadrine (Drummond 1842, 1844), Gilbert 
shot a Grey Falcon. 

In a letter to Gould, dated Perth, 13 September 1842 (Sauer 1999), Gilbert reported his 
collection of 'a beautiful Specimen of Falco hypoleucus'. He wrote: 'we reached a large 
River & Lakes nearly forty miles farther North than the Moore's River, where I for the first 
time saw & Shot the beautiful species of Falcon mentioned above . . . The Falco hypoleucos 
which I killed differs a good deal from your Plate, perhaps in consequence of Age; It is of 
a uniform ashy grey, all over . . . with very narrow lines of black running down the Centre 
of each feather, not, as in your plate, a pure white; It may be a new species, I wish it may, I 
assure you I never gazed with more delight on any Specimen I ever Shot, than on this Bird 
. . . the rich orange-yellow of the whole of the Face, & Legs contrasting beautifully with its 
delicate plumage. To sum up all, it was one of the most beautiful Birds I ever gazed on.' 

He gave further details in another letter dated 9 October 1842, 'Falco hypoleucos. The 
following is the description of my Specimen before skinning. Its length was 15 Inches; Wing 
12 3/4, Tail 6 1/4; Bill 2 1/2; Tarsus 1 3/4; metatarsus 2 1/4; Irides dark-brown; cere, all 



Jonny Schoenjahn 



106 



Bull. B.O.C. 2010 130(2) 



of the naked space around the Eyes, gape and usual [erroneous transcription for 'basal'] 
portion of Bill & Legs & feet brilliant orange-yellow. The yellow from the base of the Bill 
becomes gradually lighter, as it approaches the black tip of both mandibles, claws black' 
(Sauer 1999). 

In a manuscript, Gilbert 4 mentioned that a 'mature specimen killed at the Moore's river 
was of much lighter colour than the foregoing description [a transcription of Gould 1840], 
and rather smaller in size, measured before skinned. Length, 15; wing, 12 1/2; tail, 6 1/2; 
bill, 2 1/4; tarsi, 1 3/4/ The discrepancies between Gilbert's two sets of measurements are 
not readily explained. 

Regardless of the discrepancies, the wing and tail measurements indicate a female. The 
bill length appears erroneous, and the tarsus measurement is inconclusive regarding sex. If 
Gilbert had determined the sex of his specimen, e.g. by examination of the gonads, there is 
no mention of it in his notes and correspondence. 

Nugadrine / Mugadrine (or Mugradine as misspelled by Whittell 1942) is unknown to 
me. A map of Gilbert's August route gives the final and northernmost point of the party's 
trip as the vicinity of Lake Dalaroo near the town of Moora, on the main (northern) branch 
of the Moore River (Whittell 1942). General direction and approximate distances from 
reference points given by Gilbert are consistent (Drummond 1842, 1844, Sauer 1999). 

In sum, this specimen might be female based on the wing and tail measurements, 
despite Gilbert's impression of its smaller size compared to the type. From the plumage 
it is undoubtedly an adult. Gilbert collected it in August 1842 at or near the Moore River, 
around Moora, Western Australia. 

Tlte specimens from Depot Glen. — The two remaining specimens, secured bv Captain 
Charles Sturt, 'were shot at the Depot on a Sunday in May 1845, just after service' (Gould 
1848a). Sturt (1849) wrote: 'This beautiful bird was shot at the Depot, at which place, during 
our long stay, Mr. Piesse, my storekeeper, was very successful with my gun. A pair, male 
and female, were observed by him one Sunday in May, whilst the men were at prayer, 
hovering very high in the air, soon after which he succeeded in killing both.' These two 
are, according to Mathews (1913), figured in The birds of Australia (Gould 1848a,c); the 
illustration shows an adult in the right foreground and a young bird at the rear. In reporting 
them 'hovering', Sturt most probably confused the term with soaring; the species is not 
known to hover but does soar very high (Schoenjahn in press). 

The adult fits the description of adult Grev Falcon (Marchant & Higgins 1993), except 
that the yellow cere, the base of the upper mandible, bare ocular skin, and the toes are paler 
than the bright orange-yellow of wild birds (pers. obs.). Sturt (1849) also noted the vivid 
yellow cere and legs of the two birds. This slight discrepancy might have resulted from 
post-mortem changes during the c.3 years between the bird's collection and the illustration. 
It is unknown whether Richter, the illustrator, was provided with Sturt's description. 

The plumage of the young bird in the illustration resembles both the description of 
juvenile (Marchant & Higgins 1993) and the description of the type (Gould 1840). However, 
the young bird in the illustration shows the same colour of the cere, upper mandible and 
skin around the eye as the adult bird in the illustration; that is consistent with Sturt's 
description (above). As previously mentioned young birds first have grey or light grey bills 
and grey skin around the eye; they acquire the yellow later. Therefore the young bird from 
Depot Glen is presumably older than the type. 

The sex of both birds from Depot Glen is unclear. In the letter press to the Grey Falcon 
plate, Gould (1848a) noted: 'The Plate represents the two sexes of the natural size'. Sturt also 



4 'Ornithological Notes — Gilbert.' p. 19. Queensland Museum Library, Brisbane. 



Jonny Schoenjahn 



107 



Bull. B.O.C. 2010 130(2) 



referred to 'a pair, male and female', but it is unknown how he reached that opinion. No 
measurements were recorded for the two specimens. 

In the letter press, Gould correctly described the differences between adults and 
juveniles. Unfortunately however, he neither mentioned the method used to sex the birds, 
nor did he inform which bird on the plate is, in his opinion, the male and which the female. 
Measurements taken from the illustration reveal that the two individuals are very similar 
in size, contra Meyer de Schauensee (1957). 

Depot Glen, on Evely Creek, was within the boundaries of New South Wales at the time 
of Sturt's expedition in 1845-46 (Archer 1847) as it still is today (cf. North 1912). 

Whereabouts of the four specimens. — In 1847-48, Gould's collection of Australian 
birds, including three specimens of F. hypoleucos, was sold to Philadelphia, after the British 
Museum had declined Gould's offer. The fourth specimen, being part of the collection of the 
13th Earl of Derby, was transferred to the Derby Museum at Liverpool (Gould 1865) after 
the earl's death in 1851. The identities of the four specimens are now discussed. 

Academy of Natural Sciences of Philadelphia (ANSP). — Gould sold his collection 
to Edward Wilson of Pembrokeshire, on behalf of his brother Dr Thomas B. Wilson of 
Philadelphia, a supporter and subsequent president of ANSP (Gould 1848c, Stone 1899, 
1913). Before they reached Philadelphia, the specimens were sent to the firm Maison E. 
Verreaux in Paris, an emporium and dealership in natural history specimens run by three 
brothers. The specimens were mounted and shipped to Philadelphia with a complete list 5 
handwritten by Jules Verreaux (Stone 1913). The three specimens of F. hypoleucos were listed 
as: 94, (Falco) Hypoleucus, (upside-down symbol for female, indicating male), W. Australia. 
95, dito dito, ?, S. Australia. 96, dito dito, (upside-down symbol for female, indicating 
male), W. Australia. The current designations are VN 94, etc. 

Maison Verreaux. — At the Maison Verreaux, the specimens were 'mounted on wooden 
standards according to the custom of the times.' 6 Unfortunately all labels were removed, 
information lost, misinterpreted, or transcribed incorrectly. Some specimens disappeared. 
At the end of the 19th century Witmer Stone catalogued the entire ANSP bird collection 
including Gould's birds. In a number of papers, Stone described the fate of the specimens, 
though somewhat inconsistently. 

Stone (1899) explained: 'Gould's collection, after purchase, was sent to Verreaux for 
mounting, and the original labels were removed, and their contents (or part of it) transcribed 
on the base of the stands, every specimen being marked "Type. Gould's Birds of Australia/' 
no matter whether the species was Gould's or not!' Later he wrote: 'Verreaux prepared a 
manuscript-catalogue of the collection based, as some memoranda show, on an original 
catalogue of Gould's, which was apparently never sent over to America. The information 
contained in this catalogue is transcribed on the bottoms of the stands, and consists of the 
number, name, sex and locality of each specimen, with the addition of the legend: "Type, 
Gould, Bds. of Australia" — every bird being so marked regardless of whether it was the 
type of the species or not. The localities are usually very general, and are abbreviated. . ."W. 
Australia," or "S. Australia." ... It is easy to see how a slight error in copying from the 
original catalogue would make "N. Australia" into "W. Australia," etc That a few errors 



5 In a handwritten catalogue (held at ANSP), presumably by Jules P. Verreaux, of the Maison E. Verreaux, 
Paris, and probably in 1848, the entire collection of Gould's Australian birds was listed. 

6 Academy of Natural Sciences of Philadelphia (undated). Verreaux, Jules, 1807-73. Catalogs of birds, 1846- 
47. 24 items. In 'Archive list of the Academy of Natural Sciences of Philadelphia', p. 36. Academy of Natural 
Sciences of Philadelphia, Philadelphia, PA. 



Jonny Schoenjahn 



108 



Bull. B.O.C. 2010 130(2) 



have resulted from these causes is evident' (Stone 1913). We may assume that those errors 
were made by the Verreaux brothers as well as by Stone himself. 

I could not verify the existence of an 'original catalogue of Gould's'. It might seem 
plausible that Gould would have kept such a catalogue, especially when offering the 
collection for sale. The 'memoranda' mentioned above by Stone could include a document 
prepared by J. E. Gray, Keeper of Zoology at the British Museum. When Gould offered his 
collection to the British Museum in a letter dated 9 April 1847 (Datta 1997), Gray wrote to 
the museum's trustees next day, stating that the museum already possesses 'full two thirds 
if not more of the specimens offered' (Datta 1997). However, judging by the impreciseness 
of his estimate and the extremely short time to prepare the memorandum, Gray had not 
made an accurate comparison of the two collections, whether Gould provided a catalogue or 
not, meaning that this should not be seen as evidence for the existence of such a catalogue. 
Recent extensive searches for it at libraries and archives in England, Paris and at ANSP were 
fruitless, although J.-F. Voisin (in lift. 2009) informed me that he was aware of the original 
catalogue. Furthermore, the wooden stands inscribed with data cannot now be traced at 
ANSP (L. Joseph pers. comm.). 

Dr T. B. Wilson formally presented the collection to ANSP in 1860 (Stone 1938). The 
specimens were initially exhibited as prepared by Verreaux, though later removed from 
their stands and relaxed as skins (N. Rice in litt. 2009). Stone (1913, 1938) pointed out that 
1,858 specimens arrived at the ANSP, and that only a few were lost. Gould mentioned to 
the British Museum that his Australian collection consisted of nearly 1,800 specimens (Datta 
1997). 

Two of the three Gould specimens sent to ANSP are extant, VN 95 and VN 96. They are 
mentioned in Ingersoll & Fisher (2006) as ANSP 2098 (VN 95) and ANSP 2099 (VN 96). The 
latter is listed as the holotype, following Stone (1913) and Meyer de Schauensee (1957). 

VN 94. — Meyer de Schauensee (1957) noted that VN 94 'cannot now be found and must 
have disappeared before 1890 for it was never entered in the Museum register when the 
collection was catalogued.' This was confirmed by a more recent search (Ingersoll & Fisher 
2006). It seems likely that the specimen disappeared prior to 1890 with no evidence that 
it ever left ANSP (N. Rice in litt. 2009). It might never have reached Philadelphia. It was 
claimed that the age of VN 94 was specified in Verreaux's manuscript catalogue as adult 
(Meyer de Schauensee 1957), though this was not the case 5 (cf. Stone 1913). 

ANSP 2098. — This specimen has one white label, bearing the imprint 'Academy of Nat. 
Sciences Philadelphia'. The label data are: 2098 Gould Coll. TYPE / ? Falco hypoleucus 
Gould / S. Australia Pres. by Dr. T. B. Wilson / and on the reverse, Verreaux catalogue 
number '95'. It is an adult. Measurements taken by N. Rice according to the specifications 
in Marchant & Higgins (1990) are: bill (C) 19.86 mm; wing (maximum chord) 318.5 mm; tail 
158.0 mm. All three measurements fall well inside the respective ranges given by Marchant & 
Higgins (1993) for adult females. The locality is given as 'S. Australia', meaning either South 
or southern Australia. Of the four specimens, only one adult is from southern Australia, that 
from Depot Glen. Given the circumstances of Sturt's expedition 'into the interior of South 
Australia', Gould presumably assumed that the location is in South Australia and labelled 
it accordingly. On the basis of the plate by Richter (Gould 1848a) the sex of the Depot Glen 
adult cannot be determined. It is clear that ANSP 2098 is an adult on plumage and a female 
on measurements. The specimen is, very probably, the adult collected by Sturt's storekeeper 
Piesse, at Depot Glen in May 1845. 

ANSP 2099. — Hitherto considered to be the holotvpe (Stone 1913, Meyer de Schauensee 
1957, Fisher 1992, Ingersoll & Fisher 2006), this specimen is VN 96 of the Verreaux 



Jonny Schoenjahn 



109 



Bull. B.O.C. 2010 130(2) 



catalogue. It bears two labels, white and red, both with the imprint 'Academy of Nat. 
Sciences Philadelphia'. The data on the white label are: Gould Collection TYPE / cf Falco 
hypoleucus Gould / W. Australia / and, on the reverse, the Verreaux catalogue number 
'96'. The data on the red label are: TYPE OF Falco hypoleucus Gould / P.Z.S. 1840. p.162. 
The plumage matches Gould's description of the type and fits a juvenile (Marchant & 
Higgins 1993), especially the bold black spots on the white underparts. Bare-parts colours 
are: cere yellow; maxilla and mandible rich orange-buff at the base, nearly black at the tips. 
The ocular skin is dark orange-buff, and the legs / toes are concolorous with the bill. The 
specimen was measured by N. Rice (Table 1) whose data are all well inside the respective 
ranges for juvenile females, and outwith those for juvenile and adult males. It was also 
measured by Meyer de Schauensee (1957) and by C. Fisher. Table 1, however, demonstrates 
the problems associated with such measurements and the uncertainties regarding technique 
and precision employed. But, VN 96 / ANSP 2099 is a young bird based on plumage and a 
female on measurements. 

National Museums Liverpool specimen. — One of the four specimens known to Gould 
was held in the collection of the 13th Earl of Derby. Concerning this bird, in 1865 Gould 
added in a footnote: The last-mentioned specimen is now in the Derby Museum at 
Liverpool, to which town his Lordship bequeathed his fine collection.' (Gould 1865). Gould 
omitted the origin of that specimen. 

Lord Stanley, who became the 13th Earl of Derby in 1834, died in 1851. The donation 
of his natural history collection to Liverpool led to the foundation of the Derby Museum, 
now part of the National Museums Liverpool. The Earl, President of the Zoological Society 
of London from 1831 until his death, was a great supporter of Gould (Fisher 1987). He 
subscribed to all of Gould's work and bought many specimens from him. In his preface, 
Gould (1848c) wrote 'the Earl of Derby, who has at all times most readily submitted to 
my inspection every collection of which he has become the possessor . . . allowed me the 
free use of any objects desirable for the enhancement of the "Birds of Australia"'. Mearns 
& Mearns (1998) noted that the Earl 'bought 230 of the bird and mammal specimens John 
Gilbert sent to Gould' and 'became one of Gould's best customers.' 

A letter from the Earl to Gould, dated April 1842, lists his desiderata, including 'F. 
hypoleucus' (Sauer 1999). At the time, the only specimen was Gould's holotype. Hence the 
Earl must have acquired his specimen thereafter. There is no indication from where it came. 
Gilbert collected only one specimen, and there is no reason to assume he did not send it 
to Gould, still awaiting Gould to confirm the species. Further, it is plausible that Gould 
acquired Sturt's two specimens together, possibly direct. We know that at least one had to 
be in Gould's collection. It seems unlikely that Sturt, assuming they were a pair, presented 
only one of his birds to Gould, and the other to the Earl. More plausible is that Gould, 
after receiving Gilbert's specimen but probably before receiving the two from Sturt, sold 
Gilbert's specimen from the Moore River to the Earl, knowing that he, Gould, would have 
access to it should he need. 

It also can be assumed that the Earl did not acquire a second Grey Falcon before his 
death, otherwise Gould would have known about it by 1865. In the Handbook to the birds of 
Australia (1865), Gould re-affirmed: Tn the folio edition of the 'Birds of Australia' I stated 
that four specimens were all that were then known; in the lengthened interval which has 
since elapsed, about the same number, and not one more, have come under my notice' 
(Gould 1865: 25). Although this sentence leaves room for misinterpretation, from the 
context it is clear that those early four specimens were the only ones Gould had seen when 
writing the Handbook. 



Jonny Schoenjahn 



110 



Bull. B.O.C. 2010 130(2) 



The National Museums Liverpool currently holds one specimen of Grey Falcon. 
The label data represent all known information: Talco hypoleucos cf Mus. Derbianum. 
Liverpool/ 'Mus. Derbianum' indicates the collection of the 13th Earl of Derby (C. Fisher in 
litt. 2009). This specimen was considered lost as recently as 2006, with no trace in the Earl's 
collection at Liverpool or any evidence of an exchange (Ingersoll & Fisher 2006). Fisher 
located the specimen in March 2009 upon my inquiry. It had been given in error a Derby 
Collection number, LIVCM D.4001c, which pertained to a missing cuckoo. A new accession 
number was assigned to the specimen in April 2009, LIV.2009.22 (C. Fisher in litt. 2009). 

Measurements, taken by C. Fisher in accordance with Marchant & Higgins (1990), are: 
bill (C) 17.8 mm; bill (front edge of feathers to tip) 20.3 mm; wing (natural and maximum 
chord) 285 mm for both wings; tail 157 mm, tip of longest tail feather very worn. These 
measurements of LIV.2009.22 must be considered inconclusive regarding the sex, although 
it is possibly female. From photographs, the specimen is an adult on plumage. 

C. Fisher (in litt. 2009) reports that the specimen did not 'feel' like a typical Gilbert skin, 
being too heavy, though it had been mended c.20 years ago. Whether the distinct neatness 
of the specimen today is a result of its first preparator's expertise or of recent conservation 
is unknown. 

We know with certainty the origin of the four specimens, and that the bird in the 
Earl's collection is one of the four. In the absence of any contrary evidence, it must be 
concluded that the Earl of Derby's specimen is LIV.2009.22, which is one of the two adults 
known to Gould, and either that collected by Gilbert or that secured by Sturt. The putative 
sex of Gilbert's bird (personally measured by him) is female, but that of LIV.2009.22 
(measured by C. Fisher) is considered uncertain (albeit possibly female). In the absence of 
any measurements for Sturt's bird, the origin of LIV.2009.22 cannot be determined from 
measurements. 

VN 95 / ANSP 2098 is an adult by plumage, a female on measurements and a female 
according to the Verreaux catalogue, and originates from 'S. Australia', again according to 
the Verreaux catalogue. Gilbert's specimen, however, also adult, is from Western Australia. 
This suggests that VN 95 / ANSP 2098 is the adult secured by Sturt. That leaves Gilbert's 
specimen, the only other adult known to Gould, to be that in the collection of the Earl of 
Derby and hence almost certainly LIV.2009.22. Because LIV.2009.22 is an adult, it can be 
deduced that both young birds were in Gould's collection. 

Stone's determination of Gould's types. — Stone (1899) wrote: 'By careful studv and 
comparison with the original descriptions it is possible to select the specimen which agrees 
in plumage, measurements and locality with the description in nearly every case, and 
such ones I have designated as the type/ With G. M. Mathews, Stone prepared a list of 
the Australian species described by Gould, noting the location of their types (Stone 1913). 
The type of F. hypoleucos is listed under no. 366. The no. 2099 of the ANSP catalogue is 
given, followed by the no. 96 of the Verreaux catalogue, the symbol <f, and the note 'West 
Australia=Type'. 

However, Stone's (1913) list is known to contain errors and inaccuracies (Fisher 
1992). Fisher (1992) wrote: 'This is emphasized by a revealing letter from Rudolf Meyer 
de Schauensee, Curator of Birds at the Academy in the 1950s, to Reg Wagstaffe, Keeper 
of Vertebrate Zoology at Liverpool in the same period. The letter, sent in October 1956, 
refers to Stone's (1913) manuscript: "I have always felt this list to be very unsatisfactory, 
for Stone, as far as I can see, merely selected a type from the Gould series without stating 
what the probability was that the specimen was really the one used by Gould to describe 
the species.'" In the case of the Grey Falcon, however, Stone was certain that he identified 
the type specimen correctly. He closed with the remark: This is unquestionably the bird 



Jonny Schoenjahn 



111 



Bull. B.O.C. 2010 130(2) 



described by Gould, although in his Handbook [Gould 1865] he says the type was a young 
female' (Stone 1913). 

Importantly, however, VN 94 was already missing when Stone catalogued the collection, 
meaning that he could only choose from two specimens, one adult and one juvenile, and 
he therefore chose the only juvenile available. Gould had two young Grey Falcons in his 
collection, VN 94 and VN 96. Both matched Gould's description of the plumage of a young 
bird in lacking any reference to the colour of the bare parts. With VN 94 missing, Stone felt 
certain of his choice. 

Meyer de Schauensee's type specimen. — Critical of Stone's work, Meyer de Schauensee 
(1957) compiled a list wherein he discussed Gould's types. However, there are grave errors 
in that work regarding F. hypoleucos. For F. hypoleucos he specified: 'Holotype. — d" imm. (= 
? imm.), No. 2099* (96), West Australia, Gould Collection. Measurements of type. — Wing 
326, tail 157, culmen 19, tarsus 49 mm.' He went on to claim that ANSP 2099 'agrees exactly 
in plumage and almost exactly in wing length (326 mm. = 12.6) with the bird described by 
Gould.' (Meyer de Schauensee 1957). 

Regarding plumage, it is undisputed that both Gould's type and ANSP 2099 are 
juvenile. As demonstrated above, Gould's description does not mention the colour of the 
bare parts. Meyer de Schauensee regretted that he had not seen Gould's plate published in 
1841 (Meyer de Schauensee 1957). 

The wing length reported by Meyer de Schauensee, 326 mm, is in fact equal to 12.8 
inches. Therefore, the wing length of Meyer de Schauensee's chosen type differs by one 
third of an inch, or c.8.5 mm, from Gould's measurement (Table 1). 

Meyer de Schauensee (1957) further mentioned the missing specimen VN 94, stating 
that it was listed by Verreaux as an adult. Ages, however, are not provided in Verreaux's 
catalogue. Meyer de Schauensee failed to draw any conclusion from what he decidedly 
had known — that two of the four specimens mentioned by Gould (1848c) were young. 
Evidently, Meyer de Schauensee's selection of the type is also flawed. 

Gould's type. — The type specimen was illustrated by Elizabeth Gould. The only other 
young bird among the four specimens is that from Depot Glen, illustrated by H. C. Richter. 
To draw conclusions from the difference of the colour of the bill and the ocular skin between 
the two illustrations, the artists' accuracy and the effect of post-mortem changes on the 
skins are discussed here. 

Both artists worked from skins. Although the plumage can generally be expected to be 
depicted fairly accurately, the soft parts and to some extent the bill may have undergone 
post-mortem changes (R. McGowan in litt. 2009). The holotype was illustrated by Mrs Gould 
within c.2 years of its collection. The two specimens from Depot Glen were illustrated by 
Richter 2-3 years after collection. 

To demonstrate Mrs Gould's accuracy at the time, I investigated her plate of four 
Satin Bowerbirds Ptilonorhynchns violaceus in Gould (1841a). That plate contains an 
example of a specimen available today that was illustrated by her. The plate is titled 
'PTILONORHYNCHUS HOLOSERICEUS: Kuhl', and marked 'J&E. Gould del. et lith.' 
Elizabeth lithographed the plate around the same time as the F. hypoleucns plate, during 
the last year of her life, i.e. after returning to London around 18 August 1840 from 
Australia (Datta 1999). She died on 15 August 1841. It appears evident that the illustration 
of the subadult male on the far left was taken from ANSP 3169 of the Gould collection at 
ANSP (L. Joseph in litt. 2009; cf. Ornithology at the Academy of Natural Sciences [online 
bird collection database], available at http://clade.ansp.org/ornithology/index.php). Of 
interest are that the colours of the bill and the soft parts of that specimen, as observed 



Jonny Schoenjahn 



112 



Bull. B.O.C. 2010 130(2) 



today, match the illustration very well. As for the accuracy of Richter's work, see the adult 
F. hypoleucos in Gould (1848a). I demonstrated above that this bird most probably is ANSP 
2098. The analogous bare-parts colours between the illustration and the specimen are 
discussed above. 

If VN 96 / ANSP 2099 was the type, its bill, since having been illustrated by Mrs Gould, 
must have changed from being basally grey to rich orange-buff. Furthermore, the bare 
ocular skin must have changed from dark grey to dark orange-buff. Post-mortem change in 
the colour of soft parts and, to some extent, of the bill can be expected, but it seems highly 
unlikely that the changes would be of the magnitude just described. Thus I conclude that 
VN 96 / ANSP 2099 is almost certainly not the holotype as hitherto assumed, instead the 
type specimen of Falco hypoleucos Gould, 1841, is probably VN 94, which is now missing. 
Recent extensive searches for it, by N. Rice at ANSP and by J.-F. Voisin at the Museum 
National d'Histoire Naturelle, Paris, have proven fruitless. 

Name, spelling and citation. — In the first publication concerning the species (Gould 
1840), the name was spelled Falco hypoleucos and was mentioned just once. According to the 
International code of zoological nomenclature (ICZN 1999) this is the 'correct original spelling' 
(Art. 32). The spelling of F. hypoleucos results from the combination of a Latin generic name 
with a Greek specific epithet. In Greek, the terminus -os is correct (W. Boles in litt. 2009). 
Although Gould (1840) named the species F. hypoleucos, he used -us subsequently (Gould 
1841b), which inconsistency was reflected in the literature until about the mid 1970s, since 
when the correct terminus -os has prevailed. However, -us was used by Gould (1841b), 
Mathews (1915-16), RAOU (1926), Serventy & Whittell (1948, 1976) and Gruson (1976). 
Gould (1848a, 1848c) and Cayley (1984) used hypoleucus in the text and hypoleucos in the 
title of the illustration. The suffix -os was used by RAOU (1913), Peters (1931), Whittell 
& Serventy (1948), Clements (1974), Condon (1975), Storr & Johnstone (1979), Howard & 
Moore (1980), Walters (1980), Sibley & Monroe (1993), Debus in del Hoyo et al. (1994), and 
Christidis & Boles (1994, 2008). According to the Code, the following citation is correct (Art. 
22): Falco hypoleucos Gould, 1841. If the date inscribed on the publication is of interest, Falco 
hypoleucos Gould, 1841 [1840] should be used. 

The English name used by Gilbert on his collection data sheet, c.1839, was 'White 
Falcon' (see footnote 1). Gould used 'White-breasted Falcon' in The birds of Australia (1841b). 
Both these names make effective reference to the type's juvenile plumage. It was only in 
part 36 of The birds of Australia (Gould 1848a) that the name Grey Falcon was introduced, by 
which time Gould had seen two adults. 

Gilbert also noted on the collection data sheet: 'Aboriginal name. Gwet"=el=bur 
(Mountain)'. Subsequently, he must have realised that 'G wet-el-bur' may be a general name 
and probably not specific to F. hypoleucos. On a list entitled 'The Birds of West Australia' 7 , 
item no. 5 is 'Falco melanogenys Gwet"=ul=bur. Aborigines generally.' The 'generally' may 
refer to its use for all falcons and medium-size raptors, or to its common usage by different 
language groups, or both. Gilbert also noted: 'Falco hypoleucos. Boor"=ga. Aborigines of 
Moore's river, in the interior.' This was repeated elsewhere 8 . 



7 The birds of West Australia [ms, presumably 1842]. In 'Gilbert, John (Australia) 8 ms booklets, c. 1841-43. In 
'John Gould (1804-81). Papers and correspondence, Z MSS GOU A and B [microform]: [M2888-2902]. Mfm 
M2902, No. 6'. Australian Joint Copying Project, Canberra. 

s The birds of Western Australia [ms, presumably 1842]. In 'Gilbert, John (Australia) 8 ms booklets, c. 184 1-45.' 
In 'John Gould (1804-81). Papers and correspondence, Z MSS GOU A and B [microform]: [M2888-2902]. 
Mfm M2902, No. 7' [a revision of 'No. 6']. Australian Joint Copying Project, Canberra. 



Jonny Schoenjahn 



113 



Bull. B.O.C. 2010 130(2) 



Discussion 

The type specimen of F. hypoleucos Gould, 1841, was previously considered to be VN 96 
/ ANSP 2099 (Stone 1913, Meyer de Schauensee 1957, Fisher 1992, Ingersoll & Fisher 2006). 
However, the evidence suggests that the holotype is VN 94, which is apparently no longer 
extant. Two major reasons for the false identifications are identified above. Firstly, none of 
the previous authors examined the plate by Elizabeth Gould illustrating the type (Gould 
1841b, first plate). Secondly, VN 94 was already missing when Stone selected the type. It is 
the holotype, there are no para types. 

Gould (1865) claimed that the holotype is female, but without explaining his rationale, 
although the measurements he had previously provided (Gould 1840) do suggest this 
probability. Verreaux's catalogue stated the sex of VN 94 as male. It can be safely aged as 
a juvenile, and the type locality is York, on the Avon River, Western Australia, and not the 
Moore River as stated by RAOU (1926). 

The specimen held at the National Museums Liverpool, LIV.2009.22, almost certainly 
is Gilbert's specimen collected in August 1842 near Moora on the Moore River, Western 
Australia. It is an adult. The sex of LIV.2009.22 cannot be determined with certainty, but it is 
possibly a female based on Gilbert's measurements. The label of LIV.2009.22 specifies male 
with no indication regarding the source of that information. 

The other two of the four specimens are held at the Academy of Natural Sciences of 
Philadelphia. They are most probably those collected by Sturt's storekeeper, Piesse, at 
Depot Glen, New South Wales, in May 1845. They were illustrated by H. C. Richter (Gould 
1848a,c). One, specimen VN 95 / ANSP 2098, is an adult. The second is younger, and is VN 
96 / ANSP 2099. Both are females on measurements, which is consistent with their similar 
sizes on Richter's plate, but contrary to Gould's statement in the letter press. The sex of VN 
95 is consistent with the Verreaux catalogue, but VN 96 is listed in the latter catalogue as 
male. 

Both young birds, VN 94 and VN 96, were listed by Verreaux as males but both are 
probably females. Because Verreaux did not specify ages it is unknown if he misinterpreted 
juvenile plumage as pertaining to males. 

Age-related variation in plumage and bare-parts coloration in Grey Falcon is poorly 
documented. Differences in the colour of the soft parts of the two young birds were crucial 
to the present investigation. Further age-related morphological variation will be discussed 
elsewhere. That the holotype of F. hypoleucos is a juvenile led Mathews (1913) to name a new 
subspecies, F. hypoleucos ashhyi, when presented with an adult specimen. That issue will also 
be discussed elsewhere. 

Acknowledgements 

This work would have been impossible without the kind help of many people and institutions. Especially 
I thank the following: Clemency Fisher, Nate Rice, Penny Olsen, Stuart Molloy, Ben Allen, Hugh Insley, 
Walter Boles, Ann Datta, Ron Johnstone, Philip Pain, Michael Brooker, Leo Joseph and Ian McAllan. The 
friendly and helpful staff at the following institutions often searched for non-existing items on my behalf: 
Lisa Wright at the Department of Environment & Conservation, Perth, Paul Cooper of the Natural History 
Museum, London, Alison Harding of the Natural History Museum, Tring, Dr Jean-Frangois Voisin of the 
Museum Nationale d'Histoire Naturelle, Paris, Alice Lemaire of the Bibliotheque Central du Museum 
Nationale d'Histoire Naturelle, Paris, Rose Jones of the Zoological Society of London, and staff at the Western 
Australian Museum, National Library Australia, State Library of Western Australia, Birds Australia, and 
University of Cambridge. Special thanks to Bob McGowan for his painstaking work with an earlier draft 
of this paper. Wayne Longmore is also thanked for his valuable comments and corrections. Field work was 
undertaken under ABBBS Licence Number 2484, and under all relevant licenses, permits and animal ethics 
approvals required for New South Wales, the Northern Territory, Queensland, South Australia and Western 
Australia, held since 2004. 



Jonnv Schoenjahn 



114 



Bull. B.O.C. 2010 130(2) 



References: 

Archer, J. 1847. 'Australia' [map, scale c.l:18,374,400]. Possibly from: 'Gilbert's college atlas for families and 
schools'. (James Gilbert, London.) http://nla.gov.au/nla.map-t666 (accessed 6 March 2009). 

Baldwin, S. P., Oberholser, H. C. & Worlev, L. G. 1931. Measurements of birds. Set. PubJ. Cleveland Mus. Nat. 
Hist. 2. 

Blake, E. R. 1949. Preserving birds for study. Fieldiana: Technique 7: 5-38. 

Cayley, N. W. 1984. Wlwt bird is that? Angus & Robertson, Sydney. 

Chisholm, A. H. 1938. John Gilbert and some letters to Gould. Emu 38: 186-199. 

Christidis, L. & Boles, W. E. 1994. Tlie taxonomy and species of birds of Australia and iis territories. Roval 

Australasian Ornithologists' Union, Melbourne. 
Christidis, L. & Boles, W. E. 2008. Systeinatics and taxonomy of Australian birds. CSIRO Publishing, 

Melbourne. 

Clements, J. 1974. Birds of the world: a checklist. Two Continents Publishing, New York. 

Condon, H. T. 1975. Checklist of the birds of Australia, pt. 1. Royal Australasian Ornithologists' Union, 
Melbourne. 

Datta, A. 1997. John Gould in Australia: letters and drawings. Miegunyah Press, Melbourne. 

Debus, S. J. 1994. Grey Falcon Falco hypoleucos. P. 270 in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.) Handbook 

of the birds of the world, vol. 2. Lynx Editions, Barcelona. 
Drummond, J. 1842. To the Editor of the "Inquirer". Tlie Inquirer 112: 4 (21 September 1842). 
Drummond, J. 1844. Extracts from letters of Mr. Jas. Druminond, relating to Swan River botanv. Lond. J. Bot. 

3: 300-309. 

Fisher, C. T. 1987. A previously unpublished drawing by John Gould and H. C. Richter. Australian Zool. 
24(2): 115. 

Fisher, C. T. 1992. The importance of early Victorian natural historians in the discoverv and interpretation of 

the Australian fauna, with special reference to John Gilbert. Ph.D. thesis. Liverpool Polytechnic, School 

of Natural Sciences, Liverpool. 
Gould, J. 1840. Mr. Gould resumed the exhibition of his new species of Australian birds, and characterized 

the following species. Proc. Zool. Soc. Lond. 1840: 159-165. 
Gould, J. 1840^8. Jlie birds of Australia. 36 parts. Privately published, London. 
Gould, J. 1841a. Tlie birds of Australia, pt. 4. Privately published, London. 
Gould, J. 1841b. Tlie birds of Australia, pt. 5. Privately published, London. 
Gould, J. 1848a. Tlie birds of Australia, pt. 36. Privately published, London. 
Gould, J. 1848b. Tlie birds of Australia. 7 vols. Privately published, London. 
Gould, J. 1848c. The birds of Australia, vol. 1. Privately published, London. 
Gould, J. 1865. Handbook to the birds of Australia, vol. 1. Privately published, London. 
Gruson, E. S. 1976. A checklist of the birds of the world. William Collins Sons, London. 
Howard, R. & Moore, A. 1980. A complete checklist of the birds of tlie world. Oxford Univ. Press. 
Higgins, P. J., Peter, J. M. & Cowling, S. J. (eds.) 2006. Handbook of Australian, Nezc Zealand & Antarctic birds, 

vol. 7. Oxford Univ. Press, Melbourne. 
International Commission on Zoological Nomenclature (ICZN). 1999. International code of zoological 

nomenclature. Fourth edn. The International Trust for Zoological Nomenclature, c/o The Natural 

History Museum, London. 

Ingersoll, A. W. & Fisher, C. T. 2006. Type specimens of birds in the Academy of Natural Sciences of 
Philadelphia, www.ansp.org/research/bioctiv/oirrithologv/pc^ (accessed 6 

March 2009). 

Marchant, S. & Higgins, P. J. (eds.) 1990. Handbook of Australian, New Zealand & Antarctic birds, vol. 1. Oxford 
Univ. Press, Melbourne. 

Marchant, S. & Higgins, P. J. (eds.) 1993. Handbook of Australian, Nezc Zealand & Antarctic birds, vol. 2. Oxford 
Univ. Press, Melbourne. 

Mathews, G. M. 1913. New species and subspecies of Australian birds. Austral Avian Rec. 2(4): 73-79. 
Mathews, G. M. 1915-16. The birds of Australia, vol. 5. H. F. & G. Witherby, London. 
Mearns, B. & Mearns, R. 1998. The bird collectors. Academic Press, San Diego, CA. 

Meyer de Schauensee, R. 1957. On some avian tvpes, principally Gould's, in the collection of the Academy. 

Proc. Acad. Nat. Sci. Philadelphia 109: 123-246. 
North, A. J. 1912. Nests and eggs of birds found breeding in Australia and Tasmania, vol. 3. Australian Mus., 

Sydney 

Peters,' J. L. 1931. Check-list of birds of the world, vol. 1. Harvard Univ. Press, Cambridge, MA. 
Royal Australasian Ornithologists' Union (RAOU). 1913. Official checklist of the birds of Australia. Emu 12 
(SuppL). 

Royal Australasian Ornithologists' Union (RAOU). 1926. The official checklist of the birds of Australia. Second 
edn. RAOU, Melbourne. 

Sauer, G. C. (ed.) 1999. John Gould the bird man: correspondence with a chronology of his life and zwrks, vol. 3. 
Martino Publishing, Eastford, CT. 



Jonny Schoenjahn 



115 



Bull. B.O.C. 2010 130(2) 



Sauer, G. C. & Evans, D. 1989. John Gould's Birds of Australia in the original 36 parts, with notes on the 
cancelled plates and text. Bull. Biblio. Soc. Australia & New Zealand 11(2): 67-69. 

Schoenjahn, J. In press. Field identification of the Grey Falcon Falco hypoleucos. Australian Field Orn. 

Serventy, D. L. & Whittell, H. M. 1948. A handbook of the birds of Western Australia (with the exception of the 
Kimberley Division). Patersons Press, Perth. 

Serventy, D. L. & Whittell, H. M. 1976. Birds of Western Australia. Fifth edn. Univ. Western Australia Press, 
Perth. 

Sibley, C. G. & Monroe, B. L. 1993. A world checklist of birds. Yale Univ. Press, New Haven, CT & London. 
Stone, W. 1899. A study of the type specimens of birds in the collection of the Academy of Natural Sciences 

of Philadelphia, with a brief history of the collection. Proc. Acad. Nat. Sci. Philadelphia 1899: 5-62. 
Stone, W. 1913. A list of the species of Australian birds described by John Gould, with the location of the 

type-specimens. Austral Avian Rec. 1: 129-180. 
Stone, W. 1938. The Gould Collection in Philadelphia. Emu 38: 231-233. 

Storr, G. M. & Johnstone, R. E. 1979. Field guide to the birds of Western Australia. West. Australian Mus., 
Perth. 

Sturt, C. 1849. Narrative of an expedition into central Australia, vol. 2. T. & W. Boone, London. 
Walters, M. 1980. The complete birds of the world. A. H. & A. W. Reed, Sydney. 

Whittell, H. M. 1938. Gould's Western Australian birds: with notes on his collectors. Emu 38: 175-186. 
Whittell, H. M. 1941. A review of the work of John Gilbert in Western Australia. Emu 41: 112-129. 
Whittell, H. M. 1942. A review of the work of John Gilbert in Western Australia, Part II. Emu 42: 216-242. 
Whittell, H. M. & Serventy, D. L. 1948. A systematic list of the birds of Western Australia. West. Australia Mus., 
Perth. 

Winker, K. 1998. Suggestions for measuring external characters of birds. Orn. Neotrop. 9: 23-30. 

Zoological Society of London. 1893. List of the dates of delivery of sheets of the 'Proceedings' of the 

Zoological Society of London, from the commencement in 1830 to 1859 inclusive. Proc. Zool. Soc. Lond. 

1893: 435-440. 

Address: 1 Elimatta Way, City Beach WA 6015, Australia, e-mail: jonnybird@bigpond.com 
© British Ornithologists' Club 2010 



R. F. Porter & Guy M. Kirvvan 



116 



Bull. B.O.C. 2010 130(2) 



Studies of Socotran birds VI. 
The taxonomic status of the Socotra Buzzard 

by R. F. Porter & Guy M. Kirwan 

Received 3 December 2009 

Summary. — The resident, short-winged Bitteo population on Socotra, despite 
having been known for over 110 years, has never been formally named. Now 
that it has been extensively studied in the field and its characters understood, 
we believe that it should be described. Like all other members of the B. buteo 
superspecies (sensu Kruckenhauser et al. 2003), it is relatively poorly differentiated 
genetically from most Old World buzzards, but is closest to B. (b.) bannermani of 
the Cape Verde Islands and the comparatively widespread Long-legged Buzzard 
B. rufinus of the southern Palearctic. It shares morphological features with several 
other Afrotropical buzzards, especially B. oreophilus, and B. buteo vulpinus, but is 
clearly well differentiated from B. rufinus and B. (b.) bannermani in this respect. 
Taxonomic judgements concerning this superspecies are inherently problematic 
because it represents an obviously recent radiation and because of difficulties in 
establishing which characters might be considered taxonomically informative. We 
elect to describe this population at species rank to highlight its highly unusual 
position within the superspecies, both genetically and morphologically. Finally, we 
present notes on its breeding biology (season September-April), population size 
(<250 pairs), behaviour (similar to Common Buzzard B. buteo), diet (reptiles and 
invertebrates), moult (November to April) and conservation prospects (the taxon 
should probably be ranked as Vulnerable according to IUCN criteria). 

Exclusively Old World representatives of the genus Buteo represent a relatively young 
and taxonomically complex radiation of raptors (Griffiths et al. 2007) that numbers at least 
nine species (Ferguson-Lees & Christie 2005). Relevant to the following discussion, Common 
Buzzard B. buteo is the most widespread species, occurring across temperate latitudes of 
the entire Palearctic. One race, B. b. vulpinus, breeds from northern and central Europe to 
Central Asia, and winters in eastern and southern Africa, as well as through southern Asia, 
and moves through the Middle East in large numbers, including across the Bab al Mandab 
strait to the Horn of Africa in autumn (Shirihai et al. 2000). Another race, B. b. bannermani, 
is endemic to the Cape Verde Islands. Long-legged Buzzard B. r. rufinus occurs from central 
Europe to Mongolia and northern India, with some northern populations migrating as far 
as sub-Saharan Africa, although only small numbers are observed on passage through the 
Middle East (Shirihai et al. 2000). The smaller B. r. eirtensis is largely sedentarv through 
North Africa and Arabia. The exclusively Afrotropical Mountain Buzzard B. oreophilus 
also comprises two subspecies (sometimes treated specificallv). Nominate oreophilus occurs 
from Ethiopia discontinuously south to Malawi, whilst B. o. trizonatus (Forest Buzzard) is 
restricted to South Africa (Clark 2007), from Transvaal to the Cape Peninsula (Dickinson 
2003). 

Despite lacking taxonomic recognition, the Buteo population on the ancient island 
of Socotra has attracted considerable interest, equal to or arguably greater than that 
devoted even to the majority of the archipelago's endemic bird species and subspecies. 
Our purpose here is to summarise existing and unpublished rationale for recognising this 
insular population taxonomically, to offer support for the ranking we propose, and to 



R. F. Porter & Guy M. Kirwan 



117 



Bull. B.O.C. 2010 130(2) 



name this population, at long last. But, first, a resume of this isolated population's history 
is warranted. 

History and background 

A breeding population of buzzards was initially discovered on the main island of Socotra 
during the course of the H. O. Forbes (British Museum) and W. R. Ogilvie-Grant (Liverpool 
Museum) expedition of 1898/99, the comprehensive ornithological results of which were 
published four years later (Ogilvie-Grant & Forbes 1903). This expedition secured four 
specimens of a Buteo, two of which are nowadays held in The Natural History Museum, 
Tring, and the other two in the National Museum and Galleries on Merseyside, Liverpool 
(cf. Frost & Siegfried 1970). Ogilvie-Grant & Forbes (1903) listed them as Buteo desertorum, 
although the two Liverpool specimens were labelled as being Buteo brachypterus, Hartlaub, 
1860, a name nowadays restricted to the buzzard of Madagascar (Dickinson 2003). Earlier 
visitors to the island had either overlooked the presence of a Buteo or had at least failed to 
collect it (the results of previous ornithological work were limited to lists of specimens, with 
descriptions of the novelties: Sclater & Hartlaub 1881, Hartlaub 1881). Thereafter, Hartert 
(1914: 1127) briefly mentioned that the Socotran birds merited taxonomic attention. Two 
further specimens, both taken by M. T. Boscawen and R. E. Moreau, in March 1934, are 
also held in Tring, since when only two further visitors to the island have collected birds: 
G. Popov in 1953 (whose research was principally devoted to desert locusts) and A. D. 
Forbes- Watson in 1964 (whose remit was almost entirely avifaunal). Neither collected any 
specimens of the Buteo; indeed, Forbes- Watson (1964) wrote in his unpublished expedition 
report that the buzzards 'had a genius for being wary when one had a gun'. Ogilvie-Grant's 
experiences had been similar (Ogilvie-Grant & Forbes 1903: 48). 

In writing up the results of Forbes- Watson's work, Ripley & Bond (1966) were unable 
to identify the buzzard to subspecies. Based on an examination of the British Museum 
material, nevertheless, they considered that the morphometries of at least three of the four 
birds were generally within the range of B. b. vulpinus, thereby hinting at the possibility 
of both resident and non-resident (perhaps simply passage migrant) populations. Forbes- 
Watson's (1964) unpublished report also suggested their identity as vulpinus, but admitted 
the need for additional work, and (in litt. 1969, quoted in Frost & Siegfried 1970) thought that 
two populations might exist on Socotra. However, he admitted that he had not witnessed 
any obvious migration during the spring he spent on the island. Brown et dl. (1980) actually 
mapped both Buteo buteo and B. oreophilus as occurring on Socotra, presumably in deference 
to the two-population theory; Frost & Siegfried (1970) had also postulated that one of the 
British Museum series might be B. b. vulpinus. These latter authors considered resident 
birds to be intermediate between oreophilus and vulpinus, albeit closer to the latter, and 
concluded that they might be treated as a separate race of B. buteo. However, they refrained 
from naming it, because they had only been able to examine one adult specimen. It is 
worth remarking that extensive field observations from at least seven months of the year, 
since 1993, have produced just one record of B. b. vulpinus on Socotra (see Distribution and 
population size) and none of B. rufinus or any other buzzard taxon. 

Thereafter, de Naurois (1973, 1987) drew attention to the apparently analogous 
situation of the buzzards on Socotra and those on the Cape Verde Islands, off the western 
coast of Africa, which latter had been named as Buteo b. bannermani Swann, 1919, and in this 
he was echoed by James (1986). De Naurois (1973) suggested that these Buteo populations 
might represent relics of a now-extinct pre-Pleistocene African buzzard, which had served 
as a prototype for Buteo populations that had colonised the Palearctic subsequently with 
the advent of favourable climatic conditions. This was more or less the reverse of the 



R. F. Porter & Guy M. Kirwan 



118 



Bull. B.O.C. 2010 130(2) 



theory espoused by Moreau (1966). However, de Naurois (1987) subsequently mooted that 
bannermani and the Socotran birds represent residual populations of a continental extinction 
that occurred as the African mainland became desertified, and suggested (quite correctly) 
that these insular populations were likely to prove closest to B. rufinus. Thus all three might 
be descended from a single ancestor that had inhabited the Saharan region prior to the last 
Wiirmian glaciation (i.e. the final and most extreme glacial epoch of the Pleistocene, which 
reached its peak c.18,000 B.P.). Thereafter, Hazevoet (1995) elevated bannermani, the Cape 
Verdean population, to species rank under the phylogenetic species concept, and Martins 
& Porter (1996), in noting Hazevoet's case, suggested that the Socotran population might 
be best treated similarly. Together with the nesting details presented by Clouet et at. (1994), 
observations made in April 1993 (Martins & Porter 1996) became the first detailed remarks 
on the Socotran population to be based solely on in-depth field experience. Additional field 
observations were published by Clouet et al. (1998). 

Clouet & Wink (2000) subsequently published the results of a small-scale genetic 
study, using mitochondrial DNA, of the buzzards of the Cape Verdes and Socotra. It found 
evidence to suggest that B. buteo and B. oreophilus are close relatives, and that B. bannermani, 
B. rufinus and the Socotran Buteo, which they referred to as 'B. socotrae' , clustered closely. 
Because genetic distances between virtually all of the taxa sampled were not large — a 
finding echoed by Schreiber et al.'s (2001) and Kruckenhauser et al/s (2004) studies of B. 
buteo subspecies, and the much broader study of Lerner et al. (2008) — the relatively small 
differences between the latter three were interpreted by Clouet & Wink (2000) as support 
for either two or three species, with Socotran birds either to be 'named bannermani (because 
of the identical nucleotide sequence) or alternatively Buteo socotrae owing to its isolated and 
remote situation.' Londei (2003) remarked that his field observations of bannermani in the 
Cape Verdes also suggested that the insular population possesses more traits in common 
with rufinus than buteo, thereby providing additional support for Clouet & Wink's (2000) 
conclusions. 

Most recently, the molecular study of the genus Buteo published by Riesing et al. (2003) 
and Kruckenhauser et al. (2004), which also used mitochondrial markers (coupled with 
analyses of morphometries and morphology), found that amongst the very recent radiation 
defined by the B. buteo superspecies, Socotran birds again clustered closer to B. rufinus 
(including B. r. cirtensis) than B. buteo. However, in the Kruckenhauser et al. (2004) analysis 
of morphological and morphometric characters, Socotran and Cape Verdean buzzards 
grouped with B. b. rothschildi of the Azores, presumably as a result of convergent adaptation 
to dry-country habitats. Kruckenhauser et ah (2004) recommended that the B. buteo 
superspecies be treated as three allospecies, namely B. buteo, B. rufinus and B. oreophilus, 
whilst admitting that (a) it would be defensible under the Biological Species Concept to treat 
all of the constituent taxa as a single species, and (b) the situation concerning bannermani 
and 'socotrae' was almost a matter of choice. Because genetic differentiation is apparently 
small amongst members of the B. buteo superspecies, even between taxa traditionallv 
ranked as species (e.g. between B. buteo vs. B. rufinus, and B. oreophilus vs. either of the other 
two taxa), and because morphologically the Socotran population shares more traits with B. 
buteo vulpinus and B. oreophilus sensu lato (especially B. o. trizonatus; see Diagnosis and Table 
3), we circumscribe it here as a new species under the Biological Species Concept (sensu 
Helbig et al. 2002). Although Clouet & Wink (2000) introduced 'socotrae' as a potential name 
for this population, and in referring to the Socotran population thus they were followed by 
Riesing et al. (2003) and Kruckenhauser et al. (2004), this name is a nomen nudum and has no 
validity because its initial use cannot be considered a valid nomenclatural act according to 
the International code of zoological nomenclature (ICZN 1999, Arts. 13. LI, 16.1, 16.4 and 72.3). 



R. F. Porter & Guy M. Kirwan 



119 



Bull. B.O.C. 2010 130(2) 



Buteo socotraensis, sp. nov. 
Socotra Buzzard 

Holotype. — The Natural History Museum (formerly British Museum of Natural 
History), Tring (NHM 99.8.11.10). Adult (unsexed) collected by W. R. Ogilvie-Grant and H. 
O. Forbes at 'Elhe' (locality not precisely traced), on the Hadibu Plain, in the north of the 
main island of Socotra, on 28 January 1899 (Fig. 1); no other label data. 

Par atypes.— The Natural History Museum, Tring. Adult male, NHM 1934.8.12.2, 
collected 9 March 1934, by Colonel M. T. Boscawen at Momi (altitude c.450 m) on the main 
island of Socotra; juvenile female, NHM 1934.8.12.3, collected on 9 March 1934, by Colonel 
M. T. Boscawen, at Momi (altitude as previous), on the main island of Socotra; juvenile 
female, NHM 99.8.11.11, collected on 22 January 1899, by W. R. Ogilvie-Grant and H. O. 
Forbes, at Homhil (altitude c.900 m), in the east of the main island of Socotra. No other label 
data. Measurements of the holotype and paratypes are presented in Table 1. 

TABLE 1 

Measurements of endemic Buteo taxa on Socotra and the Cape Verde Islands, based on specimens held 
at The Natural History Museum, Tring, taken by GMK according to standard parameters (i.e. flattened 
wing, bill to skull, and tarsus to last complete scale before the toes diverge), using a metal wing-rule with 
perpendicular stop at zero (accurate to 0.5 mm) and, for culmen and tarsus, digital callipers 

(accurate to 0.01 mm). 





Locality 


Date (collector) 


Age / sex 


Wing 


Tail 


Culmen 
(tip to 
skull) 


Tarsus 


Buteo socotraensis 


NHM 99.8.11.10 
(holotype) 


Elhe, 

Hadibu 

Plain 


28 January 1899 
(Ogilvie-Grant 
& Forbes) 


Adult 

unsexed 


350 mm 


189 mm 


33.33 mm 


66.34 mm 


NHM 1934.8.12.2 
(paratype) 


Momi 


9 March 1934 
(Boscawen) 


Adult male 


366 mm 


188 mm 


38.19 mm 


64.05 mm 


NHM. 1934.8.12.3 
(paratype) 


Momi 


9 March 1934 
(Boscawen) 


Juvenile 
female 


341 mm 


190 mm 


33.98 mm 


63.67 mm 


NHM 99.8.11.11 
(paratype) 


Homhil, 

east 

Socotra 


22 January 1899 
(Ogilvie-Grant 
& Forbes) 


Juvenile 
female 


267 mm 
(not fully 
developed) 


135 mm 
(not fully 
developed) 


33.08 mm 


74.68 mm 


Buteo (buteo) bannermani 


NHM 1919.8.15.148 
(holotype) 


Sao Vicente 


26 September 
1913 

(Bannerman) 


Female 


367 mm 


194 mm 


38.4 mm 


74 mm 


NHM 

1911.12.23.436* 


'Santiago' 
(= Boavista; 
cf. Hazevoet 
1995) 


February 
1897 (Boyd 
Alexander) 


Female 
(by label, or 
immature 
male: 


385 mm 


177 mm 


36.9 mm 


75 mm 



Hazevoet 
1995) 



""Identified as Long-legged Buzzard Buteo rufinus cirtensis by James (1984, cf. Hazevoet 1995), a species otherwise 
unknown from the Cape Verde Islands, but its measurements appear to preclude this possibility (see Table 2). 

Description of holotype. — Colour codes (in parentheses) follow Smithe (1976). See 
also Fig. 1. Forehead, crown, nape, ear-coverts and moustachial area pale Fuscous (21) 
with narrow white streaking on ear-coverts and moustachial area. Chin, throat, breast and 
upper belly white with Burnt Umber (22) streaking, finest on chin and throat, broadening 



R. F. Porter & Guy M. Kirwan 



120 



Bull. B.O.C. 2010 130(2) 



on breast and heaviest on belly, where the brown becomes more solid, especially on body- 
sides and flanks. This streaking is the result of dark (midway between Fawn Color [25] and 
Clay Color [26]) arrowhead-shaped centres to the off-white feathers. Lower belly off-white 
barred or vermiculated warm Drab (27), the broadest bars being 8 mm, narrowing to 2 
mm at tip of feathers. Undertail-coverts predominately white with very sparse, narrow 
vermiculations, of a Clay Color (26) and even sparser Burnt Umber (22) shaft-streaks. 
Thighs and tarsal feathering predominately chestnut-tinged Raw Umber (23), with barely 
perceptible whitish-buff tips to feathers, closest to Buff (24). Underwing: axillaries white, 
barred Raw Sienna (136), with Burnt Umber (22) shaft-streaks and variable whitish feather 
tips; the entire coverts having a rather chequered pattern. Carpal extensive Dark Grayish 
Brown (20), the outer margin tending to pale Sepia (119). Primaries off-white with Sepia 
(119) webs and broad tips. Secondaries and tertials off-white with narrow, diffuse Vandyke 
Brown (121) barring and extensive broad tips, the outermost band (of some 23 mm in width) 
the darkest; thus forming a distinct band along hindwing. Scapulars, wing-coverts, tertials 
and back pale Fuscous (21) with dark Burnt Umber (22) shaft-streaks. Mantle Fuscous (21) 
with some Amber (36) and whitish feather-fringes. Primaries and small tertial Fuscous 
(21); secondaries and larger tertials pale Fuscous (21) with darker shaft-streaks. Rump pale 
Fuscous (21); uppertail-coverts brown, closest to Olive-Brown (28) with whitish tips and 
very pale Amber (36) vermiculations. Uppertail overall Pale Neutral Gray (86) with pale 
Vandyke Brown (121) vermiculated barring; basal bars 5-6 mm in width, narrowing to 
2-3 mm over distal portion, except for subterminal band of 7 mm (Fig. 2). Note, however, 
that the distal third of all rectrices show warm elements close to Mikado Brown (121c), 
concentrated on the shaft region, but barely perceptible on the central feathers. Undertail 
dirty white with narrow pale to very pale Vandyke Brown (121) barring. 

Diagnosis. — Because of the relatively few available specimens of the new taxon, the 
following analysis is complemented by our and fellow observers' field observations since 
1993. During seven days in March-April 1993, RFP & GMK et ah observed a total of 31 
individuals, including three juveniles (Kirwan et at. 1996). Subsequently, during nine visits 
spanning six months between 1996 and 2008, RFP et at. observed a total of 181 individuals. 
Of these 43 were aged (33 adults and ten juveniles). Field descriptions were taken of 12 
birds and photographs of 21 (15 adults / subadults and six juveniles). These data were 
supplemented by reference to other photographs by co-workers and some published 
images, e.g. in Clouet et al. (1994), all of which were studied carefully. Our sample of B. 
(b.) bannermani specimens was also very small and was therefore also supplemented by 
reference to field photographs. Of the five taxa to which it has been linked taxonomically, 
Buteo socotraensis is slightly larger than B. oreophilus and probably slightly smaller than B. 
bannermani (Table 2; cf. Ferguson-Lees & Christie 2001: 693), although the small sample 
sizes of the first- and last-named must be borne in mind. It is thus a small to mid-sized 
Buteo with brown upperparts and pale underparts, which are barred and blotched brown 
on the breast, belly and underwing-coverts. Individual plumage variation in both adult and 
juvenile plumages is less than in any of the other members of the B. buteo superspecies, as 
might be expected in an insular taxon. In adult plumage the brown upperparts are relieved 
only by pale bases to the outer primaries, which form a diffuse but noticeable panel (Fig. 3), 
which this species shares with B. rufinus and some B. b. nil pin us, but not with B. oreophilus 
or B. bannermani. The uppertail is narrowly barred as it is in most B. b. buteo and some B. 
b. vulpinus. In socotraensis, nevertheless, the pale greyish tail, often showing a gingery hue, 
especially distally, has 10-12 narrow, dark bands, with the subterminal the broadest. In the 
morphologically most similar taxa, specimens of oreophilus at NHM have 6-7 dark bands 
of equal width to the pale bands, whilst bannermani has 8-11 bands, also of equal width to 



R. F. Porter & Guy M. Kirwan 



121 



Bull. B.O.C. 2010 130(2) 



the pale bands, which are less grey than in socotraensis. However, W. S. Clark (in litt. 2010) 
reports that oreophilus typically has a dark tail with narrow pale bands and a broad dark 
tip, thus resembling the pattern in B. b. buteo. Furthermore, in bannermani it appears that 
the subterminal band is of similar width to the other bands (see Fig. 2). Adults of the larger 
ruflnus have a distinctly orange-toned, unbarred tail. 

Below socotraensis is white (very slightly tinged buff) with fine brown streaking on 
throat and heavier dark brown streaking on the breast, belly, flanks and thighs, becoming 
most solid, albeit variably, there (Figs. 1, 4 and 5). This pattern is quite different from that 
in all B. rufinus (Fig. 6), except some dark birds including B. r. cirtensis. The warm brown 
/ chqstnut-brown under wing-coverts in socotraensis are rather irregularly streaked and 
chequered dark brown, most intensely on the greater coverts. The large carpal patch is solid 
dark brown. The variation in the strength or intensity of these underbody and underwing- 
covert markings is slight (Figs. 7-8). Some individuals possess a whiter throat, upper breast 
and thighs. The large dark carpal patch is shared with typical rufinus, but not by B. b. 
buteo and B. b. vulpinus in which it is far less pronounced, especially in those birds that are 
darker below (Fig. 9). In such birds, unlike socotraensis, the chin, throat and upper breast are 
streaked dark brown, often bordered by a pale horseshoe below; this is a feature apparently 
never found in socotraensis. In this respect, moreover, bannermani is patterned more like B. b. 
buteo and B. b. vulpinus (Fig. 10). The underside of the primaries and secondaries is similar to 
that of the other Buteo taxa, showing a wide dark band on the hindwing typical of adults. 

Juveniles (Fig. 11) differ from adults in having a warm buff suffusion over the breast 
and thighs on otherwise creamy white underparts, as well as less extensive brown streaking, 
this being concentrated on the lower breast and breast-sides; the belly itself has barely any 
streaking and there is only sparse spotting on the thighs. The underwing-coverts are creamy 
white with a warmer suffusion on the forewing-coverts, which are finely streaked brown; 
the greater coverts are coarsely streaked brown, creating a diffuse band that extends into a 
much-reduced dark surround to the carpal patch, compared to the adult. The primaries and 

TABLE 2 

Range of measurements (in mm) of adult Buteo taxa, with means (where recorded) in parentheses: 
B. socotraensis and B. (b.) bannermani from NHM specimens (taken by GMK; for protocols see Table 1); 
all other taxa from Brown et al. (1982). The small sample sizes of 
B. socotraensis and B. (b.) bannermani must be kept in mind. 



Taxon 


Wing length 


Tail length 


Tarsus length 




(flattened chord from 


(from base of central 


(from notch on heel to lower edge 




shoulder to tip) 


rectrices to tip) 


of last complete scale before toes 






diverge) 


B. socotraensis (n = 2,cf$) 


350-366 (m = 358) 


188-189 (m = 188.5) 


64.36-66.05 (m = 65.19) 


B. (o.) oreophilus 


332-336 


174-183 


61-72(a"?) 


B. (o.) oreophilus (?¥) 


345-356 


180-196 




B. (o.) trizonatus (c?c?) 


318-352 






B. (o.) trizonatus (??) 


330-362 






B. b. buteo (cv) 


350-418 


194-223 


69-83 (tf¥) 


B. b. buteo (? ?) 


374-432 


193-236 




B. b. vulpinus (oV) 


338-387 (m = 359) 


170-207 (m = 185) 


69-82 (cf?) 


B. b. vulpinus (¥?) 


352-400 (m = 374) 


175-209 {m = 191) 




B. (b.) bannermani (n = 2? ¥) 


367-385 (m = 376) 


177-194 (m = 185.5) 


74-75 (m = 74.5) 


B. rufinus (oV) 


418-447 (m = 436.6) 


224-240 (m = 231.7) 


83-92 (m = 85.9) 


B. rufinus (??) 


450-487 (m = 462.1) 


240-289 (m = 261.2) 


86-95 [m = 89.8) 


B. r. cirtensis (<?&) 


345-384 


188-197 


72-78 


B. r. cirtensis (??) 


380-425 


196-201 


74-79 



R. F. Porter & Guy M. Kirwan 



122 



Bull. B.O.C. 2010 130(2) 



TABLE 3 

Morphological characters useful in separating adults of the key Buteo taxa covered in this paper, based 
on specimen analysis supplemented by reference to literature (e.g. Ferguson-Lees & Christie 2001, 2005), 
especially for B. oreophilus trizonatus (James 1986, Clark 2007), and field photographs, 
especially for B. (b.) bannermani. 



Character — 

Taxon 

1 

B. socotraensis 
(sedentary) 



B. o. oreophilus 
(sedentary) 



B. o. trizonatus 

(largely 

sedentary) 



B. buteo 
vulpinus 
(migratory) 



B. b. 

bannermani 
(resident) 



Overall structure Tail pattern 



Pale 
panel in 
upperwing 



B. rufinus 
(resident and 
migratory) 



small to mid-sized, 
with relatively short, 
compact wings 



generallv smaller 
than B. buteo 
vulpinus, with 
shorter and 
narrower wings 
and tail 

similar to B. o. 
oreophilus, but 
reported to be even 
narrower-winged 
than the latter with a 
less rounded wingtip 
(Clark 2007) 

typically appears 
relativelv compact 
with broad wings 
and a rather short 
tail 

sfructurally similar 
to B. b. vulpinus 



relative!}" large, with 
long, broad wings, 



pale greyish, often with 
a gingen 7 hue, and 
10-12 narrow, dark 
bands; subterminal 
broadest 

olive-brown to pale 
brown with 6-7 black 
bands of equal width 
to the pale bands 



brown washed rufous, 
either with many 
narrow dark brown 
bands (subterminal 
broadest) or vague dark 
bands and a clear dark 
subterminal band 

cream-coloured to 
grevish, with many 
vague dark bands, and 
the subterminal band 
broadest and darkest 
gre\ish, with 8-11 
dark bands of equal 
width to the pale 
bands (including the 
subterminal band at 
least on the uppertail), 
but less grey than in 
socotraensis 

typically orange- 
coloured and unbarred 
or virtually so 



variable 



Breast pattern 



no pale 
horseshoe 



no pale 
horseshoe 



pale horseshoe, 
except very 
palest birds 



pale horseshoe 
sometimes 
present, but in 
paler morphs 
only 

pale horseshoe 
is apparently 
always present 
and usually 
obvious 



entire breast 
and throat 
usually paler 
than rest of 
underparts 



Dark carpal patch 
on the underwing 

usually solid 
and dark brown, 
contrasting rather 
strongly with the 
coverts, but less so 
than in B. rufinus 

dark brown and 
relativelv solid, but 



coverts 
dark 

comma-shaped 
mark, most of 
carpal patch is pale 



dark to blackish 
comma-shaped 
mark does not 
contrast strongly 
with coverts 

dark brown to 
blackish, but seems 
rather diffuse and 
small, and offers 
little contrast with 
the coverts 



usually solid 
black and Very 
prominent, 
contrasting strongly 
with the rufous 
underwing-coverts 



secondaries are off-white, narrowly barred darker (more obvious than in the adult) with a 
broad dark terminal band, but never as broad or clearly defined as in adults. As shown in 
Fig. 12, juveniles possess narrow orange-buff fringes to the wing-coverts and an orange-buff 
suffusion to the cheeks, supercilium and nape. In flight, the juvenile lacks the pale panel at 
the base of the primaries, the wings appearing all brown. 

Variation in the series— The juveniles (NHM 99.8.11.11 and 1934.8.12.3) differ from 
the adult in having creamy-white underparts, heavily suffused Warm Buff (118), especially 
on the breast and thighs, (this suffusion gradually fading with age). Ventrally, the dark 
streaking, between Burnt Umber (22) and Raw Umber (23) is less extensive than on the 
adult holotvpe and is concentrated on the lower breast and breast-sides; the belly has barely 



R. F. Porter & Guy M. Kirwan 



123 



Bull. B.O.C. 2010 130(2) 



any streaking and only sparse, diamond-shaped spotting on the thighs. Undertail-coverts 
unmarked. The underwing-coverts are predominately Warm Buff (118) with irregular dark 
markings and a diffuse band across the greater coverts. The dark carpal patch (again Burnt 
Umber) is greatly reduced. Primaries and secondaries off-white, becoming whiter with age, 
narrowly barred darker and with a broad dark terminal band. Primary tips Burnt Umber 
(22). Compared to adults the dark carpal-patch is greatly reduced, the underwing-coverts 
are much paler with a dark band on the greater coverts, and the barring on the secondaries 
is more obvious. 

Based on our field observations (see Diagnosis), it is clear that there is little variation 
in either adult or juvenile plumage, apart from the degree and intensity of streaking on the 
underparts. This ranges from lightly streaked to more heavily so, but most adults conform 
to the patterns shown in Figs. 5 and 7, and juveniles to that in Fig. 11. The base colour of the 
tail can vary slightly, with some birds possessing a gingery hue, which can be accentuated 
when backlit. B. socotraensis appears to be less variable in plumage than either B. buteo and 
B. oreophilus and probably B. (b.) bannermani. 

Distribution and population size. — B. socotraensis is found only on the main island 
of Socotra (Fig. 13), where it is a widespread, but not common, resident breeder. Surveys 
undertaken between 1999 and 2008 suggest that the population is <250 pairs (Porter & 
Suleiman in prep.). There is no evidence of any movement away from Socotra, doubtless 
because of the long sea crossing (>100 km from the closest part of Somalia, Cape Guardafui, 
and c.380 km south of the Yemen coast) that such soaring birds typically avoid. Indeed, 
migrant broad-winged raptor species are vagrants to Socotra. There is just one definite 
record of Steppe Buzzard B. buteo vulpinus (a dark-morph individual on 26 November 
1999: RFP pers. obs.), which is the commonest migrant bird of prey in Arabia (Shirihai et 
al. 2000) and was immediately recognised as distinct from the resident Socotra buzzards. 
There are too few historical data to determine whether there has been any change in the 
status or population of the Socotra Buzzard since the first ornithological visits to the island 
in the 1880s. It is probably the rarest of the island's endemic birds and detailed studies of 
its population and ecology are urgently required. 

Habitat. — Socotra Buzzard is resident in the foothills and plateaux, mostly where 
there are deep ravines, from sea level to at least 1,370 m, but principally at 150-800 m. It 
does not appear to be dependent on trees, but steep cliffs would seem to be prerequisite for 
nesting (RFP pers. obs.). No seasonal altitudinal movements have been observed, and it is 
reasonable to assume that if there are any, they are not significant. Competition for nesting 
sites has not been studied, but with Egyptian Vulture Neophron percnopterus, Peregrine 
Falcon Falco peregrinus and Brown-necked Raven Corvus ruficollis all using similar cliff- 
ledges for nesting on Socotra, this might be a limiting factor to the buzzard population. 
This could be especially true with respect to Egyptian Vulture as Socotra probably holds the 
highest concentration of this species in the world, with a population of c. 1,700 individuals 
(Porter & Suleiman in prep.). 

Behaviour. — Similar to other Old World Buteo species, especially to that of Common 
B. b. buteo and Steppe Buzzards B. b. vulpinus. Much time is spent perched on rocks, cliff 
ledges, trees and bushes, which are presumably used as scanning posts to search for food. 
In all months, birds have been observed soaring high above plains and hills, sometimes in 
loose groups of up to five, often with spells of calling. In this respect behaviour is similar 
to that of B. b. buteo and B. b. vulpinus. During a total of 25 weeks of observation (spanning 
seven months in nine years) RFP has never observed socotraensis hovering. 



R. F. Porter & Guy M. Kirwan 



124 




Figure 1. Unsexed adult holotype Socotra Buzzard 
Buteo socotraensis (left; NHM 99.8.11.10) and female 
holotvpe of Cape Verde Buzzard B. (buteo) bannermani 
(NHM 1919.8.15.148), held in The Natural History 
Museum, Tring (R. F. Porter / © The Natural History 
Museum, Tring) 

Figure 2. Uppertail patterns of Mountain Buzzard Buteo 
oreophilus (left), Cape Verde Buzzard B. bannermani 
(centre) and Socotra Buzzard B. socotraensis (R. F. 
Porter / © The Natural History Museum, Tring) 

Figure 3. Adult Socotra Buzzard Buteo socotraensis, 
Socotra, 18 February 2006 (R. F. Porter) 
Figure 4. Adult Socotra Buzzard Buteo socotraensis, 
Socotra, with centipede, probably Scolopendra balfouri, 
November 2008 (R. F. Porter) 

Figure 5. Adult Socotra Buzzard Buteo socotraensis. 
Socotra, October 2007 (R. F. Porter) 

Figure 6. Adult Long-legged Buzzard Buteo rufinus, 
Iraq, date unknown (A. F. Omar / Nature Iraq) 



R. F. Porter & Guy M. Kirwan 



125 



Bull. B.O.C. 2010 130(2) 




Figure 7. Adult Socotra Buzzard Buteo MM 
socotraensis, in wing moult, Socotra, October HHj 
2007 (R. F. Porter) 

Figure 8. Adult Socotra Buzzard Buteo 
socotraensis, Socotra, January 2006 (Hanne & 
Jens Eriksen) 

Figure 9. Adult Steppe Buzzard Buteo buteo 
vulpinus, southern Israel, March 1989 (Paul 
Doherty) 

Figure 10. Cape Verde Buzzard Buteo 
(buteo) bannermani, Cape Verde Islands, date | 
unknown (Vaughan Ashby) 

Figure 11. Juvenile Socotra Buzzard, Buteo 
socotraensis, Socotra, 28 February 2007 (R. F. 
Porter) 

Figure 12. Juvenile Socotra Buzzard, Buteo 
socotraensis, Socotra, 12 February 2004 (R. F. 
Porter) 





R. F. Porter & Guv M. Kinvan 



126 



Bull. B.O.C. 2010 130(2) 



Socotra Buzzard Buteo socotraensis 

Breeding distribution on Socotra 


















































































• 


• 






• 


• 


• 


• 


• 


















• 


• 


• 


• 


• 




• 








12.50 














• 


# 










• • 




















• 
















































• 

• 


Breeding 
proven 




















— i — 
i 














Probatory 


































12.00 




53.00 










53.50 










54.00 








54.50 





Figure 13. Socotra Buzzard Buteo socotraensis breeding distribution on Socotra (Socotra Conservation and 
Development Programme / BirdLife International) 



Breeding. — Data presented here are summarised from Porter & Jerrnings (in press). 
Display, notably aerial tumbling and talon grappling, has been observed in October- 
December and February, and copulation in November. Nest building has been observed in 
late October and a nest with a chick (c.15 days old), being tended by both adults, was found 
on 28 October; in this case egg laying would have been in mid September. A nest with two 
eggs was found on 16 November (egg dimensions were presented by Clouet et al. 1998), and 
nests with young observed in January (young c.l month old) and in early April, to which 
adults were bringing food. A juvenile in captivity on 2 March was just a few weeks out of the 
nest, suggesting egg laying in January; discussions with the 'owners' of three other captive 
juveniles suggested laying dates in October-January. Two other juveniles in captivitv had 
apparently been taken from a nest in November, thus indicating egg laving commences in 
October. One instance of a pair nest building in April and May was not followed by egg 
laying. Fully-fledged young, still with a strong parental bond, have been observed from 
mid February to early April. All the above observations suggest that the breeding season 
extends from September-April (perhaps into May), with egg laying in September-January. 
It is probably important for this buzzard to have completed its breeding cycle before the 
onset of the monsoon winds in late May, which could hamper its ability to hunt and find 
food for the young. Broods of only one or two nestlings have been recorded on single 
occasions, but there is one record of a pair with three fledged young, indicating that clutch 
size can be larger. The few nests observed have been constructed of sticks on a cliff-ledge 
or crevice, sometimes with a tree, small bush or vegetation for protection or support. 
Live branches with leaves have been observed being brought to the nest. No tree nests 
have been reported. Once a pair appeared to be preparing to breed again in the previous 
season's nest (Clouet et al. 1994). Nests have been noted at 150-650 m. It was suggested by 
Clouet et al. (1994) that nests might be sited to provide shade during the day. Whilst there 
is no information on the role of the sexes in nest building or incubation, both have been 
observed tending young in the nest and are present during the post-fledging period. There 



R. F. Porter & Guy M. Kirwan 



127 



Bull. B.O.C. 2010 130(2) 



is a record of repeated attacks on an Egyptian Vulture by a pair of buzzards, when their nest 
was approached, and another observer reported an adult becoming agitated by a Peregrine 
Falcon near a possible cliff nest site. 

Food. — Diet almost certainly exclusively comprises reptiles and invertebrates. 
Individuals are often seen perched on a prominent rock or tree, and the method of foraging 
appears to be to wait for prey to come into range and then pounce. However, there is 
no detailed information on the diet of either adults or juveniles, but food being taken 
and consumed has included a snake, small lizard, locusts, at least once a large centipede 
(probably Scolopendra balfouri) and a large caterpillar (RFP). This 'passive' hunting method 
is not effective for catching birds. The centipedes in question reach up to 18 cm long and, 
together with the larger crabs, are the largest terrestrial invertebrates on the island. The 
head is poisonous and the tail has two pincers, both of which were, in the case observed, 
apparently removed and discarded by the buzzard. Socotra has a very depauperate 
mammalian fauna (Cheung & DeVantier 2006), consisting of one tiny shrew, four bats, and 
two human commensal rodents, House Mouse Mus musculus and Black Rat Rattus rattus, 
both of which are found near settlements, where this buzzard rarely occurs. As the rodents 
are thought to be historically recent arrivals on the island, it has been assumed that the bulk 
of the buzzard's prey must be lizards, large insects and possibly nestlings; the birds have 
never been observed feeding on carrion. Clarification of its diet will be an important factor 
in guaranteeing its survival. 

Moult. — Adults in active wing moult have been observed in November- April. By 
February-March most adults observed had recently moulted their primaries, thus most 
have freshly moulted flight feathers during the period when most juveniles are fledging. 
This differs from the moult sequence typical of B. b. buteo, which does not commence 
primary and tail moult until late April / early May, or B. b. vulpinus, which commences 
moulting both the primaries and tail in early May (see Cramp & Simmons 1980, Martins & 
Porter 1996). However, it must be remarked that in widespread species, differences in moult 
timing can be expected in different regions and we have attached no taxonomic significance 
to these differences. 

Vocalisations. — The calls of Buteo rufinus, B. buteo, B. oreophilus (sensu stricto) and B. 
socotraensis are very similar. Sound-recordings of socotraensis were made in 1999-2004 but 
only one could be assigned to an adult, made in November, which is at the start of the 
breeding season. Although it transpired that this recording was distorted, it was nevertheless 
compared with the calls of known adults of the other taxa. Because of the distortion and 
the small sample (n=l), this brief analysis should be treated as highly provisional. It is 
included to encourage further study and has not been used in the taxonomic assessment of 
the Socotra Buzzard. Sonogram comparisons suggest the inter-note intervals in oreophilus 
and rufinus are very similar, with longer gaps between calls (c.5 seconds in the former vs. 
c.3.5 seconds in the latter), whereas such intervals in buteo (c.1-2 seconds) and socotraensis 
(<1 second) are considerably shorter. Note structure differs between all four taxa, but again 
socotraensis with its much less wavering form is perhaps most similar to B. buteo, although 
it should be added that the latter's note structure is still closer to either oreophilus or rufinus 
than to socotraensis. Of the four taxa sampled socotraensis shows the smallest frequency 
range, its calls being almost entirely concentrated at around 2.2 kHz, especially compared 
to oreophilus (total range c.1-6 kHz) and rufinus (c.1-4 kHz), although all four, including B. 
buteo, show the same emphasis around c.2.0 kHz. 

Etymology. — We have employed the name socotraensis to reflect the provenance of this 
new taxon, but have intentionally formed it as an arbitrary combination of letters in the form 



R. F. Porter & Guy M. Kirwan 



128 



Bull. B.O.C. 2010 130(2) 



of a word to ensure that its spelling remains fixed (ICZN 1999, Arts. 11.3, 26 and 31.2.3). The 
English name 'Socotra Buzzard' agrees with the recommendation of the IOC (Gill & Wright 
2006) that noun usage, because it is already established for other birds endemic to the island 
group, e.g. Socotra Bunting Emberiza socotrana and Socotra Sparrow Passer insidaris, should 
be preferred over an alternative adjectival form, in this case Socotran. 

Taxonomic rank. — As noted in the introductory paragraphs, various authors have 
wrestled with the taxonomic position of the Socotra Buzzard. Indeed, it might be stated, 
with no pretence to originality, that in the Palearctic region the problems posed by Old 
World Buteo in general are amongst the thorniest in avian taxonomy. The results of two 
genetic studies, although sampling only non-nuclear DNA, have suggested that the insular 
populations of the Cape Verde Islands and Socotra are most closely related to Buteo 
rufinus, a taxon that has been universally accorded specific rank in all recent literature. 
Three options therefore are open: (i) to treat all three as members of a single species; (ii) 
to recognise two, mainland and insular, species; and (iii) to recognise three species. In all 
three cases, the genetic, morphological and morphometric evidence combined, presented 
herein and in the papers discussed in the introduction, clearly indicate that Socotra Buzzard 
is a discrete taxon, and needs to be named under the articles of the Code. We agree with 
Kruckenhauser et al. (2004) that, to some extent, the taxonomic rank given to that name is 
a matter of personal preference. However, even for those working within the constraints 
of the Biological Species Concept, we do not consider it to be a reasonable option to treat 
Socotran birds as conspecific or consubspecific with the Cape Verdes buzzard, bannermani 
because of their level of morphological differentiation and widely disjunct ranges which 
prohibit genetic interchange. 

Nonetheless, one of the authors of this latter study, A. Gamauf (in lift. 2009) has pointed 
out that the genetic data available for Socotran buzzards suggest that they do not form a 
monophyletic group with bannermani, and are of separate origin. In her opinion, it cannot 
be excluded that they represent a stabilised hybrid population between ancestral B. rufinus 
and B. b. vulpinus. The geographic position of Socotra (and the Cape Verde Islands) at the 
border of the migration routes and winter quarters of these highly mobile raptors does need 
to be considered. Additional genetic data for both these insular populations are certainly 
required to reach more robust conclusions concerning their phylogeographic history. 

Despite the notable lack of genetic differentiation amongst Old World Buteo in general 
(Kruckenhauser et al. 2004, Lerner et al. 2008), and even though they are now understood 
to be a relatively youthful radiation arriving from the New World perhaps via a single 
dispersal event (Griffiths et al. 2007, Amaral et al. 2009), recent workers have taken an 
increasingly expansive view oi Buteo taxonomy in Afro-Eurasia. Given that Socotra became 
separated from surrounding landmasses at least 31 MYA (Braithwaite 1987), the colonising 
proto-Buteo population must have arrived over water. 

In line with Helbig et al.'s (2002) recommendation that decisions on species limits 
among allopatric taxa be guided by comparisons with degrees of difference in sympatric 
taxa that behave as species, we offer the following remarks. As long ago as the 1950s, 
when all of the relevant taxa were generally considered subspecies of B. buteo, Rudebeck 
(1958) had already briefly mooted the possibility that B. oreophilus (Mountain Buzzard) 
and B. trizonatus (Forest Buzzard) might be better treated as separate species, rather than 
subspecies. It was a supposition given a more thorough review by James (1986), even 
though Dowsett & Dowsett-Lemaire (1993) cited James's reticence to 'split' as part of their 
rationale for maintaining one species. Clark (2007) further supported Rudebeck's view 
based on his field and museum observations of differences in plumage and wing shape. 
According to Kruckenhauser et al. (2004) these two taxa are not monophyletic. 



R. F. Porter & Guy M. Kirwan 



129 



Bull. B.O.C. 2010 130(2) 




16,500 33,000 



Scale 1:1,200,000 
Maps produced by Information section - SCDP 2005 



IMeters 
132J000 



Legend 

Zones 

General Use Zone 
National Park 
Nature Sanctuary 
Resource Use Reserve 



Figure 14. Terrestrial nature reserves and national parks on Socotra created by the government of Yemen in 
2000 under the Zoning Plan. 



Brooke (1975) then concluded that Buteo rufofuscus (Jackal Buzzard) and B. augur (Augur 
Buzzard) are separate species, and although Brown et al. (1982) treated them as conspecific, 
Brooke's view has now been universally adopted. Thus, authors as diverse as Prigogine 
(1984), James (1986), Sibley & Monroe (1990), Short et al (1990), Dowsett & Dowsett-Lemaire 
(1993), Kemp (1994), Ferguson-Lees & Christie (2001) and Dickinson (2003) all treated augur 
as a separate species, despite a lack of molecular data at the time to support or dispute 
this supposition. Incidentally, Amaral et al. (2009) recently demonstrated the two to be 
only very marginally separated genetically. Indeed, recently published mitochondrial and 
nuclear gene data for rufofuscus and augur demonstrate them to be firmly nestled within the 
same clade of Old World buzzards as B. buteo, B. oreophilus and B. rufinus, close to the latter 
(Lerner et al. 2008, Amaral et al. 2009), despite dissimilarities in plumage. In this respect, 
Siegfried's (1970) suggestion that rufofuscus might be allied to Palearctic stock represented 
by rufinus appears far-sighted. 

In the light of these examples, we consider that the Socotra Buzzard should also 
be treated as a full species. Its position is unique: genetically it is closest to rufinus and 
bannermani, but in plumage nearer to trizonatus / oreophilus and to a lesser extent vulpinus, 
whilst mensurally it resembles other short-winged taxa, especially bannermani. 

Conservation. — Given the species' overall small population, probably numbering 
<1,000 individuals (see Distribution and population size), it seems that socotraensis would 
be accorded the IUCN category of Vulnerable, under criterion Dl (very small population), 
should the taxon be recognised specifically by BirdLife International. There is no evidence 
of a decline at present, but should a decrease in numbers become apparent in the future 
this could trigger its upgrading to a higher threat category. Buzzards are not infrequently 
taken from the nest in the mistaken belief that they can be sold into the falconry trade. Such 
birds end up being retained in captivity on the island. How many are taken is unknown, 
nor is the impact of this activity on the bird's population. However, because of the rarity 
of this buzzard, any such theft from the wild must be actively discouraged. In this respect, 
the recent laws governing the removal of biological material from the island should have 
the effect of diminishing the number of birds taken in future, as these laws will impact the 



R. F. Porter & Guy M. Kirwan 



130 



Bull. B.O.C. 2010 130(2) 



demand for falcons and thus other raptors. Enforcement of laws to prevent the taking of 
young birds from nests is the highest priority. The terrestrial nature reserves and national 
parks created by the government of Yemen in 2000 under the Zoning Plan (Ministerial 
Decree no. 275) encompass c.75% of the total area of the island (Fig. 14). These protect all the 
major vegetation types and areas of greatest importance for flora and fauna. Comparing the 
distribution map for Socotra Buzzard (Fig. 13) and those areas protected under the Zoning 
Plan reveals there is a legal framework to protect its main breeding and feeding areas 
within this recently designated World Heritage Site. The enforcement of the Zoning Plan is 
therefore essential not only for the buzzard but for the other Socotra endemics. 

Acknowledgements 

RFP is grateful for the help given by Ahmed Saeed Suleiman of the Socotra Conservation and Development 
Programme (SCDP) and to Mike Evans, David Flumm, Rod Martins and, especially, Simon Aspinall, all of 
whom joined him during SCDP / BirdLife International surveys and who contributed greatly to discussions. 
Acknowledgement is also made to the UK's Darwin Initiative and the Wetland Trust for sponsoring surveys. 
At the Natural History Museum, Tring, we are, as ever, indebted to the staff, especially Robert Prys-Jones, 
Mark Adams and Alison Harding, for invaluable assistance with specimens and tracing relevant literature. 
Normand David proffered comments on scientific nomenclature. Kay van Damme provided some dietary 
information, and Pete Leonard and Paul Doherty assisted with sourcing relevant photographs. Pieter 
Wessels assisted with the provisional vocalisation analysis and Magnus Robb proffered cautionary advice 
on our interpretation. Valery Schollaert, Kees Hazevoet, Vaughan & Svetlana Ashby, and Jan van der 
Laan provided information and photographs on B. (b.) bannermani. We thank Carl Edelstam and especially 
Ian Sinclair for helpful discussions concerning this buzzard. Our referees, Bill Clark, Nigel Collar, Martin 
Collinson, Anita Gamauf and Dick Schodde, provided invaluable comments that helped us to finalise the 
paper, despite that our conclusions do not always entirely reflect their own. RFP dedicates this work to the 
islands of Socotra, and Ahmed Saeed Suleiman and Nadim Taleb and all of the other people he has worked 
with over the years in the SCDP. 

References: 

Amaral, F. R., Sheldon, F. H., Gamauf, A., Haring, E., Riesing, M., Silveira, L. F. & Wajntal, A. 2009. Patterns 

and processes of diversification in a widespread and ecologically diverse avian group, the buteonine 

hawks (Aves, Accipitridae). Mol. Phyl. & Evol. 53: 703-715. 
Braithwaite, C. J. R. 1987. Geology and palaeogeography of the Red Sea Region. Pp. 22^44 in Edwards, A. J. 

& Head, S. M. (eds.) Key environments: Red Sea. Pergamon Press, Oxford. 
Brooke, R. K. 1975. The taxonomic relationship of Buteo rufofuscus and B. augur. Bull. Brit. Orn. CI. 95: 

152-154. 

Brown, L. H., Urban, E. K. & Newman, K. 1982. The birds of Africa, vol. 1. Academic Press, London. 
Cheung, C. & DeVantier, L. 2006. Socotra: a natural history of the islands and their people. Odyssey Books, Hong 
Kong. 

Clark, W. S. 2007. Taxonomic status of the Forest Buzzard Buteo oreophilus trizonatus. Ostrich 78: 99-102. 
Clouet, M., Canu, J. G. & Lipinski, F. 1994. Sur la nidification de la Buse de Socotra. Alauda 62: 144-145. 
Clouet, M., Goar, J.-L. & Barrau, C. 1998. Contribution a l'etude ornithologique de Pile de Socotra. Alauda 
66: 235-246. 

Clouet, M. & Wink, M. 2000. The buzzards of Cape Verde Buteo (buteo) bannermani and Socotra Buteo (buteo) 
spp.: first results of a genetic analysis based on nucleotide sequences of the cvtochrome b gene. Alauda 
68: 55-58. 

Cramp, S. & Simmons, K. E. L. (eds.) 1980. The birds of the Western Palearctic, vol. 2. Oxford Univ. Press. 
Dickinson, E. C. (ed.) 2003. The Howard and Moore complete checklist of the birds of the world. Third edn. 

Christopher Helm, London. 
Dowsett, R. J. & Dowsett-Lemaire, F. 1993. Comments on the taxonomy of some Afrotropical bird species. 

Pp. 323-389 in Dowsett, R. J. & Dowsett-Lemaire, F. (eds.) A contribution to the distribution and taxonomy 

of Afrotropical and Malagasy birds. Tauraco Research Rep. 5. Liege, Tauraco Press. 
Ferguson-Lees, J. & Christie, D. A. 2001. Raptors of the world. Christopher Helm, London. 
Ferguson-Lees, J. & Christie, D. A. 2005. Raptors of the world: a field guide. Christopher Helm, London. 
Forbes-Watson, A. D. 1964. Report on the Smithsonian Institution Ornithological Expedition to Socotra 1964. 

Unpubl. ms. Smithsonian Institution, Washington DC 
Frost, P. G. H. & Siegfried, W. R. 1970. Notes on the plumage of buzzards from Socotra. Bull. Brit. Orn. CI. 

90: 136-142. 

Gill, F. & Wright, ML 2006. Birds of the world: recommended English names. Christopher Helm, London. 



R. F. Porter & Guy M. Kirwan 



131 



Bull. B.O.C. 2010 130(2) 



Griffiths, C. S., Barrowclough, G. F., Groth, J. G. & Mertz, L. A. 2007. Phylogeny, diversity, and classification 
of the Accipitridae based on DNA sequences of the RAG-1 exon. /. Avian Biol. 38: 587-602. 

Hartert, E. 1914. Die Vogel der paldarktischen Fauna, Bd. 2(3), Heft 9. R. Friedlander & Sohn, Berlin. 

Hazevoet, C. J. 1995. The birds of the Cape Verde Islands. BOU Check-list No. 13. British Ornithologists' Union, 
Tring. 

Helbig, A. J., Knox, A. G., Parkin, D. T., Sangster, G. & Collinson, M. 2002. Guidelines for assigning species 
rank. Ibis 114: 518-525. 

International Commission on Zoological Nomenclature (ICZN). 1999. International code of zoological 
nomenclature. Fourth edn. International Trust for Zoological Nomenclature, c/o The Natural History 
Museum, London. 

James, A. H. 1984. Geographic variation in the Buzzard Buteo buteo (Linnaeus: 1758): Mid-Atlantic and West 

Mediterranean islands (Aves, Accipitridae). Beaufortia 34: 101-116. 
James, A. H. 1986. Review of taxonomic characters in African buzzards (genus Buteo). Beaufortia 36: 1-12. 
Kemp, A. C. 1994. Afrotropical Accipitridae species accounts. Pp. 107-205 in del Hoyo, J., Elliott, A. & 

Sargatal, J. (eds.) Handbook of the birds of the world, vol. 2. Lynx Edicions, Barcelona. 
Kirwan, G. M., Martins, R. P., Morton, K. M. & Showier, D. A. 1996. The status of birds in Socotra and 'Abd 

Al-Kuri and the records of the OSME survey in spring 1993. Sandgrouse 17: 83-101. 
Kruckenhauser, L., Haring, E., Pinsker, W., Riesing, M. J., Winkler, H., Wink, M. & Gamauf, A. 2004. Genetic 

vs. morphological differentiation of Old World buzzards (genus Buteo, Accipitridae). Zool. Scripta 33: 

197-211. 

Lerner, H. R. L., Klaver, M. C. & Mindell, D. P. 2008. Molecular phylogenetics of the Buteonine birds of prey 

(Accipitridae). Auk 125: 304-315. 
Londei, T. 2003. Field observation of the Cape Verde Buzzard, Buteo (buteo) bannermani, confirms close 

relationship with the Long-legged Buzzard, Buteo rufinus. Riv. Hal. Orn., Milano 73: 173-177. 
Martins, R. P. & Porter, R. F. 1996. The Buteo population in Socotra. Sandgrouse 17: 134-137. 
Moreau, R. E. 1966. The bird faunas of Africa and its islands. Academic Press, London. 

Naurois, R. de. 1973. Recherches sur la Buse (Buteo buteo L.) de l'archipel du Cap Vert. Pp. 157-175 in Livro de 
homenagem ao Professor Fernando Frade. Junta de Investigacoes do Ultramar, Lisbon. 

Naurois, R. de. 1987. Les oiseaux de l'archipel du Cap Verd: peuplements, adaptations, endemisme. Bull. Soc. 
Zool. France 112: 307-326. 

Ogilvie-Grant, W. R. & Forbes, H. O. 1903. Birds of Sokotra and Abd-el-Kuri. Pp. 21-63 in Forbes, H. O. (ed.) 

The natural history of Sokotra and Abd-el-Kuri. R. H. Porter, London. 
Porter, R. F. & Jennings, M. C. In press. Species account: Socotra Buzzard Buteo buteo ssp. Pp. 265-268 in 

Jennings, M. C. (ed.) The atlas of breeding birds of Arabia. Fauna of Arabia, Frankfurt & King Abdulaziz 

City for Science & Technology, Riyadh. 
Porter, R. F. & Suleiman, A. S. In prep. The population and distribution of the breeding birds of Socotra. BirdLife 

International, Cambridge, UK & Socotra Governance & Biodiversity Project, Sana'a. 
Prigogine, A. 1984. Speciation problems in birds with special reference to the Afrotropical Region. Mitt. Zool. 

Mus. Berlin 60, Suppl. Ann. Orn. 8: 3-27. 
Riesing, M. J., Kruckenhauser, L., Gamauf, A. & Haring, E. 2003. Molecular phylogeny of the genus Buteo 

(Aves: Accipitridae) based on mitochondrial marker sequences. Mol. Phyl. & Ecol. 27: 328-342. 
Ripley, S. D. & Bond, G. M. 1966. The birds of Socotra and Abd-el-Kuri. Smithsonian Misc. Coll. 151(7): 1-37. 
Rudebeck, G. 1958. Some additional notes on the buzzard, Buteo buteo trizonatus. Bull. Brit. Orn. CI. 78: 

54-56. 

Sclater, P. L. & Hartlaub, G. 1881. On the birds collected in Socotra by Prof. I. B. Balfour. Proc. Zool. Soc. Fond. 
1881: 165-175. 

Smithe, F. B. 1976. Naturalist's color guide. Amer. Mus. Nat. Hist., New York. 

Screiber, A., Stubbe, A. & Stubbe, M. 2001. Common Buzzard (Buteo buteo): a raptor with hyperpolymorphic 

plumage morphs but low allozyme heterozygosity. /. Orn. 142: 34-48. 
Shirihai, H., Yosef, R., Alon, D., Kirwan, G. M. & Spaar, R. 2000. Raptor migration in Israel and the Middle East: 

a summary of 30 years of field research. International Birding & Research Center, Eilat. 
Short, L. L., Home, J. F. M. & Muringo-Gichuki, C. 1990 Annotated check-list of the birds of East Africa. Proc. 

West. Found. Vert. Zool. 4: 61-246. 
Sibley, C. G. & Monroe, B. L. 1990. Distribution and taxonomy of birds of the world. Yale Univ. Press, New 

Haven, CT. 

Siegfried, W. R. 1970. Affinities of the small African and Palaearctic buteos. Ostrich Suppl. 8: 41^t6. 

Addresses: Richard Porter, c/o BirdLife International, Wellbrook Court, Girton Road, Cambridge CB3 ON A, 
UK, e-mail: richardporter@dialstart.net. Guy M. Kirwan, 74 Waddington Street, Norwich NR2 4JS, UK, 
e-mail: GMKirwan@aol.com 



© British Ornithologists' Club 2010 



Hadoram Shirihai & Vincent Bretagnolle 



132 



Bull. B.O.C. 2010 130(2) 



First observations at sea of Vanuatu Petrel 

Pterodroma (cervicalis) occulta 

by Hadoram Shirihai & Vincent Bretagnolle 

Received 21 March 2010 

Summary. — We present the first observations at sea of Vanuatu Petrel Pterodroma 
(cervicalis) occulta, as well as briefly reviewing the history of this poorly known 
seabird. A comprehensive review of the field characters of Vanuatu Petrel is 
provided, along with a discussion of its relative size differentiation from White- 
necked Petrel P. cervicalis. The feeding behaviour of this petrel is described, and 
suggested ways of finding this rare petrel at sea — off one of the most remote 
tropical Pacific islands — are also given. 

In recent years, pelagic trips have led to repeated rediscoveries of long-lost taxa, 
e.g. New Zealand Storm Petrel Oceanites maoriana (Saville et ah 2003) and Beck's Petrel 
Pseudobulweria becki (Shirihai 2008), and have also yielded the first documented at-sea 
observations of Fiji Petrel P. macgillivrayi (Shirihai et al. 2009). The same is now true for 
Vanuatu Petrel Pterodroma (cervicalis) occulta, which was initially collected by Rollo Beck 
during the Whitney South Sea Expedition, on 28-29 January 1927, off the Banks Islands, 
Vanuatu. Six specimens, now held in the American Museum of Natural History (AMNH), 
New York, were taken 30 nautical miles east of the Banks archipelago. For almost 60 years, 
due to taxonomic uncertainty and the undetected differences between Juan Fernandez P. 
externa and White-necked Petrels P. cervicalis, these specimens were labelled P. externa. 
Subsequently, they were referred to the smaller P. cervicalis (Falla 1976). Recently, Imber 
& Tennyson (2001) elected to describe these distinctly smaller specimens as a new species. 
However, R. C. Murphy, in an unpublished manuscript, was first to postulate that the 
Vanuatu birds might represent something 'new', and in 1962 Bill Bourne planned to name 
them as a subspecies for Robert (later Sir Robert) Falla, but was unable to complete his idea 
(W. R. P. Bourne in litt. 2010). 

The first sign that Vanuatu Petrel was still extant came when a specimen was found 
(apparently roadkilled) in eastern Australia in April 1983 (Boles et al. 1985). The specimen 
is held in the Sydney museum (examined by VB). Boles et al. (1985) correctly assigned the 
specimen to the smaller form of White-necked Petrel from Vanuatu by matching its size 
with the AMNH specimens. 

As part of our ongoing tubenoses project (Shirihai & Bretagnolle in prep.) we 
have visited New Caledonian and southern Vanuatu waters on several occasions since 
December 2005. On 2 January 2006, between New Caledonia and Vanuatu (20°16'24.73"S, 
168°10'39.69"E), a single Vanuatu Petrel was seen. On 29 January 2007, two (possibly three) 
birds were again seen off southern Vanuatu (19°27'20.80"S, 168°28 , 19.36"E). They were 
tentatively identified as Vanuatu Petrel based on their apparently relatively smaller size, in 
side-by-side comparisons with Tahiti Petrel Pseudobulweria rostrata, and more solidly black 
tips to the underwing. Furthermore, in January 2006, HS visited the Kermadec Islands 
to study variation in White-necked Petrels (see below). These records provided indirect 
evidence that a breeding population of Vanuatu Petrel existed somewhere, probably in 
Vanuatu. Because no documentation was obtained, these records were not published, and 
we elected to obtain new evidence in Vanuatu in December 2009, when a special expedition 



Hadoram Shirihai & Vincent Bretagnolle 133 Bull. B.O.C. 2010 130(2) 























^^^^^^^^^^^ 





Distribution of Pterodroma cervicalis as given for White-necked P. cervicalis and Vanuatu Petrels P. (c.) occulta 
combined, with the numbered arrows indicating the three breeding grounds: (1) on Vanua Lava, Banks 
Islands, Vanuatu, where Vanuatu Petrel breeds (population unknown, but possibly a few tens to a few 100s 
of pairs); the main breeding island of White-necked Petrel on (2) Macauley Island, Kermadec Islands (with 
c.50,000 pairs in 1988, possibly increasing); and the second small colony on (3) Phillip Island, off Norfolk 
Island (a few pairs only). Migrates to the North Pacific Ocean with the estimated range shown. (Adapted 
from the BirdLife International species factsheet online at www.birdlife.org, based on Marchant & Higgins 
1990, Imber & Tennyson 2001 and Totterman 2009.) 

to study Vanuatu Petrel was arranged. During this visit (to the Banks Islands) we obtained 
43 sightings of Vanuatu Petrel on 25-27 December, and 14 individuals were photographed; 
the first photographically documented records of this poorly known species at sea. 

In February 2009, Totterman (2009) located the species' breeding area atop a volcanic 
cone on the east side of Vanua Lava island, in the Banks group. This breeding colony was 
well known to the islanders, especially those from Vanua Lava and the nearby Mota Lava 
Islands, who formerly harvested the fledglings in the burrows. VB visited this colony in 
December 2009. 

Finally, on 7-9 February 2010, P. Harrison recorded 21 Vanuatu Petrels off northern 
Vanuatu (during a voyage between New Zealand and Papua New Guinea); some of these 
were photographed and can be seen on the Zegrahm Expeditions website (www.zeco. 
com). 

Although some sources already consider Vanuatu and White-necked Petrels as separate 
species (e.g. Onley and Scofield 2007), it should be mentioned that neither Brooke (2004) 
nor BirdLife International (www.birdlife.org/datazone/species/index.html) recognises P. 
occulta specifically. For now, we prefer to complete our own genetic and acoustic work on 
this matter before commenting on the taxonomy of Vanuatu Petrel. 

Vanuatu Petrel is virtually unknown to science, but birders and researchers are 
increasingly seeking information as to its separation from White-necked Petrel. Here, we 



Hadoram Shirihai & Vincent Bretagnolle 



134 



Bull. B.O.C. 2010 130(2) 



TABLE 1 

Comparison of measurements (specimens from breeding islands onlv; AMXH and Australian Museum 
at Sydney) of Vanuatu Pterodroma (ceruicalis) occulta and White-necked Petrels P. ceruicalis. Note oyerlap 
in extreme yalues in all measurements except bill height at hook. Tail is longer in Vanuatu in relation 
to wing. Bill size appears to be the best separating character, but this is very difficult to appreciate in 
the field. Although sample sizes are small, there are statistical differences but oyerlap in extreme yalues 

(eyen in wing). 





Wing 








Tail 






Tarsus 










Mean 


SD 


Min. 


Max. 


Mean SD 


Min. 


Max. 


Mean 


SD 


Min. 


Max. 


P. ceruicalis (n=22) 


303.45 


6.12 


292.0 


315.0 


126.27 5.68 


117.00 


137.00 


39.76 


1.27 


37.6 


42.7 


P. (c.) occulta (/2=5) 


288.4 


4.8 


281.0 


294.0 


124.2 8.17 


117.00 


137.00 


36.21 


1.66 


33.9 


37.9 




Culmen 






Bill height 






Bill width 








Mean 


5D 


Min. 


Max. 


Mean SD 


Min. 


Max. 


Mean 


SD 


Min. 


Max. 


P. ceruicalis (n=22) 


35.60 


1.16 


33.5 


37.30 


13.14 0.50 


12.3 


14.30 


17.17 


0.79 


15.4 


18.5 


P. (c.) occulta (n=5) 


32.17 


1.07 


31.0 




11.40 0.77 


10.1 


12.10 


14.58 


0.90 


13.6 


15.8 




occulta 
(n=5) 



Figure 1. Biometrics of Vanuatu Petrel Pterodroma (ceruicalis) occulta (based on four of the six AMXH 
specimens and that held at the Australian Museum, Sydney) and White-necked Petrel P. ceruicalis (AMXH 
specimens). Data shotvn are means (empty circles), SD (yertical bars) and extreme yalues (black dots). Xote 
that wing length differs (although there is some oyerlap), whilst tail length is closer matched. 



will focus on the differences between the two forms at sea and discuss their separation. We 
also utilise specimen data, based on our examination of the six individuals at AMXH, as 
well as the Australian bird, completed bv studies of White-necked Petrels at several major 
museums. 



Identification of Vanuatu Petrel at sea 

Vanuatu Petrel is smaller than White-necked Petrel, but virtually identical in plumage 
(see Imber & Tennvson 2001, Totterman 2009). As such, pelagic identification depends 
almost exclusively on a correct evaluation of size, and to a lesser extent of underlying 
pattern. These characters and their reliability are now discussed. 

Size and proportion. — At sea, the overall impression is that, on average, Vanuatu 
Petrel is at most c.10% smaller (but usually much less) and slighter than White-necked 
Petrel. Published biometrics (Imber & Tennvson 2001) and our own data (Table 1) suggest 
that there is little overlap between them, but this depends on the character investigated. 
Our biometric data (Fig. 1) suggest that Vanuatu Petrel is smaller onlv bv c.5% in wing 
length and c.2°o in tail length than White-necked Petrel (8% and 9°o, respectively, in Imber 



Hadoram Shirihai & Vincent Bretagnolle 135 



Bull. B.O.C. 2010 130(2) 



TABLE 2 

Comparison of the amount of white on the exposed primary bases and inner webs of the underwing in 
White-necked Pterodroma cervicalis (from the Kermadec Islands) and Vanuatu Petrels P. (c.) occulta (from 
Mota and Vanua Lava, Banks Islands). Scores for plumage characters (mostly underwing) were made by 

direct observations at sea and by checking images from each individual; to prevent double-counts we 
studied the photographs to confirm individual identification based on the underwing and head markings, 
which differ individually. In birds scored 1-2 the exposed white is prominent in the field. The white on 
birds scored 3 is small but still visible at sea, especially in photographs. On birds scored 4-5 the white is 
at most very limited (and best seen on photographs) and the wingtip usually looks almost solid black and 
sharply defined from the white coverts. The latter categories collectively represent 60% of Vanuatu Petrels, 
but only 9% of White-necked Petrels, while score 2 is very infrequent in Vanuatu Petrel but scores 1-3 
account for 71% of White-necked Petrels. No Vanuatu Petrels scoring 1 have been found to date. 



Degree of white in 


Score 1: 


Score 2: 


Score 3: 


Score 4: 


Score 5: 


primaries -> 


extreme white 


substantial white 


limited white 


insignificant white 


no white 


P. cervicalis (n=120) 


26.5% 


44.5% 


20% 


6.5% 


2.5% 


P. (c.) occulta (n=33) 




9% 


30.5% 


39.5% 


21% 



& Tennyson 2001). Although our biometric data for Vanuatu Petrel are almost identical 
to those of Imber & Tennyson (2001), there is some discrepancy for P. cervicalis, probably 
related to the age of specimens. Because all our measurements of P. cervicalis were taken 
at AMNH, from birds collected at approximately the same time as Vanuatu Petrel, we feel 
confident in our data. Based on these, Vanuatu Petrel is proportionately longer tailed than 
White-necked Petrel, with their wing/tail ratios being 2.3 and 2.4, respectively. Totterman 
(2009) suggested a 20% difference in wingspan, but his wing measurements were incorrect. 
Bill dimensions are more diagnostic, with Vanuatu Petrel being 9-15% smaller in length, 
depth and width, with no overlap in bill height (though the sample is limited). However, 
these differences appear too subtle for use at sea, meaning that there no clear-cut differences 
in shape, proportions and jizz useful for field identification. Overall, Vanuatu Petrel is only 
slightly smaller, but often appears slighter than White-necked Petrel, with some but not all 
birds appearing longer / slimmer tailed. Concerning size differences, three obstacles must 
be considered by field observers. 1: there is much individual size variation in both taxa. The 
smallest White-necked can appear confusingly small and lighter built than average-sized 
individuals — thus the species can frequently appear relatively small and slender. In turn, 
Vanuatu Petrel often looks as large and chunky as White-necked. 2: the correct evaluation 
of size differences at sea is realistic only in side-by-side comparisons, or if compared with 
another familiar petrel species nearby. 3: sea conditions affect flight mode and hence the 
impression of overall size and structure (thus jizz), whilst changes in light conditions also 
exert a strong influence on size appreciation. Our conclusion is that such fine estimates of 
size at sea (or in photographs) are difficult, and generally impossible to reliably detect. 

Underwing pattern. — The two taxa differ by the amount of the white on the exposed 
primary bases toward the tips (as already suggested by Imber & Tennyson 2001, and 
tentatively illustrated in Onley & Scofield 2007), with Vanuatu Petrel generally tending to 
have more restricted white (i.e. more solid black wingtips — see Fig. 2). In contrast, White- 
necked tends to have a broader white area on the exposed bases and inner webs of the 
primaries (especially from the second or third outermost primary towards the seventh 
primary — see Fig. 3). The nature of these differences mirrors the case between two taxa of 
Cory's Shearwater Calonectris diomedea in the Atlantic (Gutierrez 1998, Howell & Patterson 
2008). However, our observations and photographs from the breeding islands of both forms 
reveal the presence of substantial individual variation in both taxa, and thus significant 



Hadoram Shirihai & Vincent Bretagnolle 



136 



Bull. B.O.C. 2010 130(2) 



overlap and intermediate birds, which prevent using this feature as absolutelv diagnostic 
(see Table 2). 

Unfortunately, variation in White-necked Petrel includes 9°o of birds with extensive 
black wingtips, like typical Vanuatu Petrels. Fig. 8 shows almost the extreme ends of the 
spectrum of variation in White-necked Petrel, whilst Fig. 4 shows a Vanuatu Petrel with 
some white in the primaries (score 3). Evaluating the degree of white in the primaries on 
the underwing is often made more difficult by the angle of view and wing movements, e.g. 
if the primaries are held more tightly or more spread out, or the extent of any shade. Fig. 9 
demonstrates that even in the same bird or a single image, it is possible to acquire different 
impressions of this feature, making it essential that multiple photographs of the same bird 
are evaluated. 

In addition, Vanuatu Petrel may tend to have the dark leading edge to the underwing, 
the diagonal bar and the trailing edge broader and more solidlv black than most White- 
necked Petrels. Again, however, we found considerable individual variation in both forms 
(and thus complete overlap between them). Nevertheless, in both, there is a tendency 
for paler birds (or birds with whiter primary bases) to have weaker / narrower dark 
markings, whilst, on average, darker individuals tend to have broader black linings to the 
underwing. 

Separation by range? — Range maps are presented in Marchant & Higgins (1990, also 
reproduced by BirdLife International) and Brooke (2004), but these authors lump Vanuatu 
Petrel under P. cervicalis. Brooke (2004) indicated that in the non-breeding season there is a 
generally broad-front movement to the north-west Pacific. Any dispersal range differences 
between Vanuatu Petrel and P. cervicalis away from the breeding islands are wholly 
unknown, but study of photographed birds from the western Pacific, including off eastern 
Australia, clearly suggests that P. cervicalis is frequent in these waters, and it is therefore 
likely that the ranges of the two forms overlap somewhere between Australia and Vanuatu, 
at least at some seasons. Brooke (2004) estimated the world population of White-necked 
Petrel (which nests almost exclusively on the Kermadec Islands) at c. 50,000 pairs, or at 
least 150,000 birds, though current numbers are apparently even larger. The population of 

Legend to figures on opposite page 

Figure 2. Vanuatu Petrel Pterodroma (cervicalis) occulta, off Mota Lava, Banks Islands, December 2009; note the 
slightly more spread primaries on the right (top) wing with some white primary bases exposed (Hadoram 
Shirihai, © Tubenoses Project) 

Figure 3. White-necked Petrel Pterodroma cervicalis, Kermadec Islands, January 2006, showing obyious white 
on the bases of the primaries (score 2), which occur in nearly 50% of birds in the Kermadec Islands (see Table 
2), but is rare in Vanuatu Petrel P. occulta (<10%) (Hadoram Shirihai, © Tubenoses Project) 

Figures 4-5. Comparison between Vanuatu Petrel Pterodroma (cervicalis) occulta, off Mota Laya, near Vanua 
Lava, Banks Islands, December 2009 (left) and White-necked Petrel P. cervicalis, Kermadec Islands, January 
2006 (right). The two have virtually identical underwing patterns making them impossible to assign to 
species away from the breeding islands. Both show some white on the primary bases and their inner webs 
(score 3), with the Vanuatu Petrel showing fractionally more but insufficient to score 2 (see Table 2). Such 
birds constitute 20% of White-necked Petrels and 30% of Vanuatu Petrels. The smaller bill of Vanuatu 
Petrel is not apparent when comparing these two images, in which both seem to have the same-sized bill, 
albeit perhaps even slightly shorter and more slender still in the White-necked Petrel (Hadoram Shirihai, © 
Tubenoses Project) 

Figure 6. White-necked Petrel Pterodroma cervicalis, Kermadec Islands, January 2006, showing extensive white 
on the primary bases (score 1), which type has to date not been found in Vanuatu Petrel P. (c.) occulta, and 
might reliably identify White-necked Petrel (Hadoram Shirihai, © Tubenoses Project) 

Figure 7. Vanuatu Petrel Pterodroma (cervicalis) occulta, off Mota Lava, Banks Islands, December 2009; some 
appear chunkier like this bird, and seem to hardly differ in size and proportions from White-necked Petrel 
P. cervicalis (Hadoram Shirihai, © Tubenoses Project) 



Hadoram Shirihai & Vincent Bretagnolle 138 



Bull. B.O.C. 2010 130(2) 




Figure 8. White-necked Petrels Pterodroma cervicalis, Kermadec Islands, January 2006, showing the extreme 
spectrum of variation, with the right bird having an underwing type similar to many Vanuatu Petrels P. (c.) 
occulta. Note the general tendency for those with whiter wingtips to also have a weak dark leading edge 
and diagonal bar (left bird) whereas birds with more solid dark wingtips also have the black border to the 
underwing better developed (right). Note also how these birds vary in size. Our study revealed that all 
stages of variation in the underwing pattern exist in White-necked Petrels in the Kermadec Islands (Hadoram 
Shirihai, © Tubenoses Project) 

Figure 9. White-necked Petrel Pterodroma cervicalis, Kermadec Islands, January 2006; the left (top) wing 
appears to have more contrasting and blacker primary tips than the right wing, due to the slightly different 
angle of the light (Hadoram Shirihai, © Tubenoses Project) 

Figures 10-11. Comparison between Vanuatu Petrel Pterodroma (cervicalis) occulta, off Mota Lava, near Vanua 
Lava, Banks Islands, December 2009 (left) and White-necked Petrel Pterodroma cervicalis, Kermadec Islands, 
January 2006 (right), showing the lack of any obvious differences in bill size and structure; the tail of Vanuatu 
Petrel appears slightly longer and more pointed, but this is due to the angle and flight mode (Hadoram 
Shirihai, © Tubenoses Project) 



Hadoram Shirihai & Vincent Bretagnolle 



139 



Bull. B.O.C. 2010 130(2) 



Vanuatu Petrel is unknown, but almost certainly much smaller, perhaps just 1% of that of 
White-necked. Thus, over much of the Pacific, even close to Australia and further north, the 
probability of seeing White-necked is far greater than that of Vanuatu Petrel. 

Identification recommendations. — To conclude, the identification process is clouded 
by much individual variation and overlap between the two forms. In practice, birds away 
from their respective breeding islands cannot be reliably identified to one form or the other. 
However, this should not prevent observers from recording and photographing birds, and 
this may eventually lead to the discovery of an area where most birds show more solidly 
black underwing tips and generally lighter / smaller size. 

At-sea behaviour of Vanuatu Petrel 

During three days (25-27 December 2009) we spent considerable time observing 
Vanuatu Petrels off Vanua Lava and Mota Lava. Late in the afternoon, petrels gathered at 
sea before flying to Vanua Lava, and in the morning they were regularly seen close to Mota 
Lava (although they probably returned to the ocean before dawn). They were seen especially 
around 13°32.506'S, 167°42.431'E and 13°34.257'S, 167°37.417 , E. Later in the evening, a few 
birds were seen just a few miles off Mota Lava at 13°35.287'S, 167°37.751'E. During the 
day we found few Vanuatu Petrels (max. 5 in one location) with feeding 'frenzies' of other 
seabirds, mostly between 13°24.285'S, 167°40.982'E and 13°23.689'S, 167°46.996'E. The 
species obviously specialises in taking flying fish and squid, and is usually found either 
at the sides or in front of the feeding 'frenzies' of boobies (Sula spp.) and noddies (Anous 
spp.), targeting flying fish by gliding at high speed to catch their prey in the air. Some aerial 
pursuits lasted up to 300 m (with sharp turns and zigzags) and up to two minutes. Future 
observations may elucidate ecological differences between the two forms, but the smaller 
size of Vanuatu Petrel seems to match its range at lower, warmer latitudes. 

Observing Vanuatu Petrel 

We found that one could travel around the Banks Islands for days and not see 
any Vanuatu Petrels. At least in December, Vanuatu Petrel is very locally distributed, 
apparently being mainly found along a very narrow corridor to the north-east of Vanua 
Lava. Our work off Vanua Lava was mostly in a small (7-m) boat with a single engine, 
but this proved dangerous in the usually very rough ocean to the north. Field observers 
could visit Mota Lava and watch off the north coast, from where they would be almost 
guaranteed to see Vanuatu Petrels arriving from the north-east in late afternoon / evening, 
in December-May at least. 

Acknowledgements 

We thank all our fellow members of the Banks Expedition in December 2009: Audrey Sternalski, Orian 
Shirihai, Jakob Wikstrom, Eyal Jacobson and Maya Dvori-Jacobson. We also thank the many great people 
from the islands Vanua Lava, Mota Lava and Ureparapara, for their logistical help and welcome during our 
visit to the Banks. Also thanks to Francois Levionnois (New Caledonia) for helping HS organise his pelagic 
work in 2005-07, and to Bill Bourne for interesting discussions and encouragement. Particular thanks to 
Walter Boles, Curator of Birds at the Australian Museum, Sydney, for access to the Vanuatu Petrel specimen, 
and to the collections in New York (Paul Sweet), Tring (Robert Prys-Jones) and Paris (E. Pasquet). 

References: 

Boles, W. E., Bartram, K. & Clancy, G. P. 1985. First Australian specimen of the White-necked Petrel. 

Australian Birds 19: 51-54. 
Brooke, M. 2004. Albatrosses and petrels across -the world. Oxford Univ. Press. 

Falla, R. A. 1976. Notes on the gadfly petrels Pterodroma externa and P. e. cervicalis. Notornis 23: 320-322. 
Gutierrez, R. 1998. Flight identification of Cory's and Scopoli's Shearwaters. Dutch Birding 20: 216-225. 



Hadoram Shirihai & Vincent Bretagnolle 



140 



Bull. B.O.C. 2010 130(2) 



Howell, S. N. G. & Patterson, J. B. 2008. Variation in Cory's and Scopoli's Shearwaters. Alula 14: 12-21. 
Imber, M. J. & Tennyson, A. J. D. 2001. A new petrel species (Procellariidae) from the south-west Pacific. 
Emu 101: 123-127. 

Marchant, S. & Higgins, P. J. (eds.) 1990. Handbook of Australian, New Zealand & Antarctic birds, vol. 1. Oxford 
Univ. Press, Melbourne. 

Murphy, R. C. 1928. Birds collected during the Whitney South Sea Expedition. IV. Amer. Mus. Novit. 322. 
Murphy, R. C. & Pennoyer, J. M. 1952. Larger petrels of the genus Pterodroma. Whitney South Sea Expedition 

of the American Museum of Natural History (1920-1941). Amer. Mus. Novit. 1580. 
Onley, D. & Scofield, P. 2007. Albatrosses, petrels and shearwaters of the world. Christopher Helm, London. 
Saville, S., Stephenson, B. & Southey, I. 2003. A possible sighting of an 'extinct' bird — the New Zealand Storm 

Petrel. Birding World 16: 173-175. 
Shirihai, H. 2008. Rediscovery of Beck's Petrel Pseudobulweria becki, and other observations of tubenoses from 

the Bismarck archipelago, Papua New Guinea. Bull. Brit. Orri. CI. 128: 3-16. 
Shirihai, H. & Bretagnolle, V. In prep. Albatrosses, petrels and shearwaters of the world: a handbook to their 

taxonomy, identification, ecology and conservation. Christopher Helm, London. 
Shirihai, H., Pym, T., Kretzschmar, J., Moce, K., Taukei, A. & Watling, D. 2009. First observations of Fiji Petrel 

Pseudobulweria macgillivrayi at sea: off Gau Island, Fiji, in May 2009. Bull. Brit. Orn. CI. 129: 129-148. 
Totterman, S. 2009. Vanuatu Petrel (Pterodroma occulta) discovered breeding on Vanua Lava, Banks Islands, 

Vanuatu. Notornis 56: 57-62. 

Addresses: Hadoram Shirihai, c/o Ausserdorfstrafie 6, 8052 Zurich, Switzerland, e-mail: albatross_shirihai@ 
hotmail.com. Vincent Bretagnolle, CEBC-CNRS, 79360, Beauvoir sur Niort, France. 



© British Ornithologists' Club 2010 



Vitor de Q. Piacentini et al. 



141 



Bull. B.O.C. 2010 130(2) 



The name Ramphastos piperivorus Linnaeus revisited 

by Vitor de Q. Piacentini, Jose Fernando Pacheco & Bret M. Whitney 

Received 31 May 2009; final revision accepted 26 April 2010 

Discussion of the proper name for the Guianan Toucanet (a member of the ramphastid 
genus Selenidera) first appeared in ornithological literature when Hellmayr (1907) commented 
on the indeterminacy of Ramphastos piperivorus Linnaeus, 1758. Pacheco & Whitney (2006) 
suggested that the name R. piperivorus Linnaeus, 1766, has priority over Pteroglossus Culik 
Wagler, 1827 [= Selenidera culik (Wagler, 1827)] for this species. Thereafter, several colleagues 
questioned the rationale presented in favour of piperivorus, arguing that Ramphastos 
piperivorus Linnaeus, 1766, is better considered a homonym of the apparently indeterminate 
Ramphastos piperivorus Linnaeus, 1758. A synthesis of these arguments was published by 
Walters (2007). That led us to re-examine the case and our conclusion, presented here, 
agrees with Pacheco & Whitney (2006) that R. piperivorus Linnaeus is the applicable name 
according to the International code of zoological nomenclature (ICZN 1999; hereafter, the Code). 
Its date of publication, however, must be corrected to 1758. 

Availability of the name of 1758 and possible homonymy 
of the name of 1766 

Linnaeus (1758) described Ramphastos piperivorus in the tenth edition of the Systema 
Naturae, p. 103, as follows: 'piperivorus 1. R[amphastos] rostro nigro: carina crassisima. 
Habitat in America meridional!.' 

Peters (1930) stated that the species is 'absolutely unidentifiable'. However, the Code 
does not state that indeterminacy provides reason to reject a name. The Code presents 
only 'criteria of availability'. Chapter 4 (Arts. 10-20) deals with them. It is clear to us that 
Ramphastos piperivorus Linnaeus, 1758, satisfies all these criteria and therefore is an available 
name. The explanation for the nomen nudum in the Glossary of the Code (p. Ill) permits 
additional interpretation of what constitutes an unavailable name and must be considered 
(Art. 89.1). For names published before 1931, nomina nuda would simply be those that 'fail 
to conform to article 12'. That article deals with the 'requirement' (Art. 12.1) for 'names 
published before 1931' to be available, stating that they 'must be accompanied by a 
description or a definition of taxon that it denotes, or by an indication'. Neither Art. 12.1 
nor the Glossary for nomen nudum stipulates that the description / definition must allow 
unequivocal identification of the taxon denoted. Because there is a description associated 
with Ramphastos piperivorus in Linnaeus, 1758, the name cannot be considered a nomen 
nudum. More importantly, were the name of 1758 to be considered unavailable as such, then 
the principle of homonymy would in any case not apply, and the name of 1766 would be 
automatically validated, as discussed by Pacheco & WTvitney (2006). 

Peters (1930) considered that, given the brief and unidentifiable description of R. 
piperivorus in 1758, the 1766 usage of piperivorus (with its longer description) would relegate 
it to primary homonymy and thus unavailable. We cannot agree with his conclusions. The 
'Principle of Homonymy' (Art. 52.1) applies only 'when two or more taxa are distinguished 
from each other' and are denoted by the same name. Thus there is a key question to answer: 
is Ramphastos piperivorus Linnaeus, 1758 a different taxon from Ramphastos piperivorus 
Linnaeus, 1766? 



Vftor de Q. Piacentini et al. 



142 



Bull. B.O.C. 2010 130(2) 



The complete history of Ramphastos piperivonis Linnaeus 

In 1741, the French naturalist and physician Pierre Barrere described a bird from 
'Equinoctial France' (= Cayenne, where he lived for five years) as 'Pica minor, rostro 
denticulato, vario' and gave it two vernacular names: Gros Bee and Queue de rat. Four years 
later, Barrere (1745) described the four toucans and allies known by him at the time in the 
'genus' Rostrata. The bird called Gros Bee and Queue de rat was then described as 'Rostrata 
americana viridans, rostro partim rubro nigro' . According to Brisson (1760), Barrere was the 
first naturalist to describe such a bird. 

Following Barrere, Linnaeus (1748) described a bird in the sixth edition of the Sy sterna 
Naturae using almost the same words: 'Rostrata viridans, rostro nigro partim rubro'; the source 
given by Linnaeus (1748) is 'Barr 51'[= Barrere, p. 51], which unquestionably indicates that 
they were dealing with the same species. Ten years later, in the critically binominal tenth 
edition of the Systema Naturae, Linnaeus (1758) described R. piperivonis in just a few key 
words {^rostro nigro') without any reference to other publications or figures (see above). 

Brisson (1760) then described and illustrated (PI. XXXII, Fig. 2) a toucan, and referenced 
it as being the same as described in Barrere (1741, 1745) and in Linnaeus (1748). Edwards 
(1764) also illustrated the species and his painting, as well as that of Brisson, is clearly 
assignable to the Guianan Toucanet. 

Finally, in the 12th edition of the Systema Naturae, Linnaeus (1766: 150) gives a longer 
description of his R. piperivonis: ' R[amphastos] viridis antice niger, crisso femoribusque rubris' 
and referenced it to the works of Brisson (1760) and Edwards (1764). 

It is thus clear to us that the R. piperivorus described briefly in Linnaeus (1758) is the 
same bird species described (without a name and prior to the starting point of zoological 
nomenclature) in Linnaeus (1748) and that named R. piperivorus in Linnaeus (1766). The 
words used in the descriptions connect the birds from the works of 1758 and 1748 (which 
explicitly refers to Barrere); the name piperivorus connects the birds of the works of 1758 
and 1766; and the references cited by Linnaeus connect the bird of the work of 1766 again 
to Barrere (through Brisson, 1760) and to the unquestionably identifiable bird illustrated 
by Edwards (1764). There is no reason to believe that the name of 1766 denotes a nominal 
taxon different from that of 1758, quite the contrary. Thus, the burden of proof must fall 
on those who assert that an author (Linnaeus), in two editions of a single work (Systema 
Naturae), applied the same name (R. piperivorus) to different species. It is important to note 
that this interpretation was not provided by Pacheco & Whitney (2006) and awareness of 
it by Walters (2007) is based on correspondence between E. Dickinson, M. Walters, us, and 
other colleagues. 

Application of the Code 

Ramphastos piperivorus Linnaeus, 1758, is an available name and the taxon it denotes 
is precisely identifiable based on an unambiguous combination of external references. The 
name therefore applies strictly to the Guianan Toucanet and has priority over Pteroglossus 
culik Wagler, 1827. Using a similar approach, Peters (1930) employed external evidence 
(a plate in Petiver, 1709) to identify another toucan, Ramphastos tucanus Linnaeus, 1758, a 
similar procedure already accepted. 

Walters (2007), as well as other colleagues in favour of the name P. culik (through 
private correspondence), gave Peters' (1930) opinion much gravity. Although a minor 
semantic question, it must be stressed that Peters' 'decision' was merely his interpretation 
of the case and has no special value. Thus, contrary to Walters (2007), the 'convincing 
evidences' in favour of one name or another must address the objective availability of 



Vftor de Q. Piacentini et al. 



143 



Bull. B.O.C. 2010 130(2) 



the name R. piperivorus Linnaeus rather than trying to 'negate Peters' decision to reject 
Ramphastos piperivorus Linnaeus'. 

Finally, because Selenidera is feminine and piperivorus is an adjective, the correct 
combination of piperivorus Linnaeus, 1758 in the genus Selenidera is S. piperivora. 

Acknowledgements 

We are very grateful to Edward Dickinson, Alan Peterson and numerous colleagues who have taken part in 
fruitful e-mail discussions concerning avian nomenclature during recent years. We also thank Mary LeCroy 
and Dr Dick Schodde for reviewing the manuscript. VQP is supported by Fundacao de Amparo a Pesquisa 
do Estado de Sao Paulo (FAPESP grant no. 06/60300-1). 

References: 

Barrere, P. 1741. Essai sur I'histoire naturelle de la France equinoxiale. Chez Piget, Paris. 

Barrere, P. 1745. Ornithologiae Specimen novum. Regis Typographum Perpiniani, Paris. 

Brisson, M. J. 1760. Ornithogia sive synopsis methodica. Joannem-Baptistam Bauche, Paris. 

Edwards, G. 1764. Gleanings of natural history, pt. 3. Royal College of Physicians, London. 

Hellmayr, C. E. 1907. Another contribution to the ornithology of the lower Amazon. Novit. Zool. 14: 1-39. 

International Commission on Zoological Nomenclature (ICZN). 1999. International code of zoological 

nomenclature. Fourth edn. The International Trust for Zoological Nomenclature, c/o The Natural 

History Museum, London. 
Linnaeus, C. 1748. Systema Naturae. Sixth edn. Emendata et Aucta. Kiesewetter, Stockholm. 
Linnaeus, C. 1758. Systema Naturae. Tenth edn. Laurentius Salvius, Stockholm. 
Linnaeus, C. 1766. Systema Naturae. Twelfth edn. Laurentius Salvius, Stockholm. 

Pacheco, J. F. & Whitney, B. M. 2006. Mandatory changes to the scientific names of three Neotropical birds. 

Bull. Brit. Orn. CI. 126: 242-244. 
Peters, J. L. 1930. The identity of the toucans described by Linnaeus in the 10th and 12th editions of the 

Systema Naturae. Auk 47: 405^08. 
Petiver, J. 1709. Catalogus Classicus & Topicus . . . sen Primo Volumine Gazophylacii Naturae & Artis. Decas Prima, 

London. 

Wagler, J. G. 1827. Systema Avium. Pars Prima. J. G. Cottae, Stuttgart & Tubingen. 

Walters, M. 2007. The correct name of the Guianan Toucanet: Selenidera culik (Wagler) not S. piperivorus [sic] 
(Linnaeus). Bull. Brit. Orn. CI. 127: 247-248. 

Addresses: Vitor de Q. Piacentini, Pos-Graduacao em Zoologia, Instituto de Biociencias, Universidade de 
Sao Paulo, Rua do Matao travessa 14 no. 321, Sao Paulo, CEP 05508-090, Brazil & Comite Brasileiro de 
Registros Ornitologicos, e-mail: vitor.piacentini@gmail.com. Jose Fernando Pacheco, Comite Brasileiro 
de Registros Ornitologicos, Rua Bambina 50, apto. 104, Rio de Janeiro, RJ, CEP 22251-050, Brazil. Bret 
M. Whitney, Museum of Natural Science, 119 Foster Hall, Louisiana State University, Baton Rouge, LA, 
USA. 

© British Ornithologists' Club 2010 

Authorship of the broadbill genus name 
Calyptomena and the correct citations for this and 
Calyptomena viridis Raffles 

by D. R. Wells & Edward C. Dickinson 

Received 21 September 2009 

The Green Broadbill Calyptomena viridis occurs or has occurred recently throughout 
lowland Borneo, Sumatra, and far-western mainland Southeast Asia from the Thai-Malay 
Peninsula north to latitude c.16°N (Wells 2007). First-described member of the genus, its 
names have long been attributed to T. S. Raffles (Raffles 1822), including by us (Dekker 
& Dickinson 2000, Wells 2007). However, a coloured plate, anatomical drawings and text 
all titled Calyptomena viridis also appeared in the fourth part of T. Horsfield's Zoological 



D. R. Wells & Edward C. Dickinson 



144 



Bull. B.O.C. 2010 130(2) 



researches in Java, and the neighbouring islands, issued apparently in June 1822, whereas 
the part of the Transactions of the Linnean Society carrying the relevant section of Raffles' 
Descriptive catalogue was not delivered before November 1822 (Raphael 1970). Zoological 
researches issue dates were unravelled by C. W. Richmond and, based on his findings, 
Oberholser (1921) used the discrepancy to propose that genus and species authorships 
both revert to Horsfield. Peters' Check-list (Peters 1951) made no mention of this revision, 
but Mees (1989) rejected it on the grounds that Horsfield had attributed his description of 
species viridis directly to Raffles under a heading 'Calyptomena viridis, Sir T. S. Raffles's 
Cat. of a Zool. Coll. made in Sumatra, Tr. Linn. Soc. XIII. p. 295, 1822', below which Raffles' 
wording was given verbatim, in quotation marks, with a page number that could only have 
been taken from the Descriptive catalogue proof sheets. 

Thus far, Mees' interpretation has not been challenged but a re-inspection of Horsfield's 
text shows the latter's quote from Raffles to be preceded by a separate diagnosis, in Latin, 
under an independent heading 'Calyptomena, Raffles. Act. Soc. Linn. Lond.' ('Acta' here an 
apparent latinisation of Transactions', denoting the Linnean Society's only serial publication 
at this date), i.e., without mention of the species. Even though Raffles' name featured in that 
heading, too, no text from or direct allusion to the Catalogue was included and nothing 
about this passage implies that it came other than from Horsfield's own pen. Note also that 
Horsfield included anatomical drawings not found in the Catalogue and that his coloured 
plate is not a copv of the onlv illustration of a Green Broadbill directlv attributable to Raffles 
(not published in the Catalogue but one of a collection of natural historv drawings shipped 
by him from Sumatra in mid 1820: now British Library cat. no. XHD 4/661). As the first- 
published describer of Calyptomena, notwithstanding wording in the Catalogue that he must 
have been aware of, it follows that Horsfield is the author of the generic name. The correct 
citation for this name, contra Peters (1951: 12), thus is: 

Calyptomena Horsfield, 1822 (July), Zoological researches in Java, and the neighbouring 
islands pt. 4, unnumbered plate and text page. 

As Mees implied, but for the inclusion of quotation marks Oberholser would have 
been correct to argue that the name Calyptomena viridis must also be cited from Horsfield's 
publication. This punctuation makes clear that the description came from Raffles, hence 
the species name viridis is still to be credited to Raffles. It nevertheless now follows that 
the proper citation is to Raffles in Horsfield, 1822, full wording as given above for the 
generic name, although in the usual way still contractable to 'Raffles, 1822'. It is also worth 
mentioning that on independent evidence of surviving specimen material (Wells in prep.) 
Horsfield's coloured plate of viridis has no type status. 

In passing, we note that, with more information at his disposal than available to 
Richmond or Oberholser, Bastin (1990) has re-studied the issue dates of the eight parts of 

TABLE 1 



The eight parts of Horsfield's Zoological researches in Java and their dates. 





Latest date on the plates 


Date in Bastin (1990) 


Comments 


1 


July 1821 


July 1821 






November 1821 


November 1821 






February 1822 


April 1822 


Two of the four bird plates are dated January 1822 


4 


June 1822 


July 1822 




5 


October 1822 


January 1823 


Note delay into next year 


6 


April 1823 


June 1823 






October 1823 


January 1824 


Note delav into next year 


8 


April 1824 


September 1S24 





Philip D. Round & Desmond Allen 



145 



Bull. B.O.C. 2010 130(2) 



Zoological researches. Table 1 compares his findings with the dates published on the plates, 
and we draw these to the attention of ornithologists who may not have seen Bastin's 
work. 

Acknowledgements 

DRW thanks Alison Harding of the Natural History Museum, Tring, for access to the Rothschild Library's 
copy of Horsfield's book, and the staff of the Asian and African Studies Department of the British Library for 
allowing an inspection of the Raffles drawings. ECD thanks Judith Magee and others at the General Library 
of the Natural History Museum, South Kensington, London, for access to the 1990 facsimile of Horsfield's 
Zoological researches, shelf reference 77 Ab f HOR, which contains Bastin's introduction. We thank Alan 
Peterson for constructive comments on two manuscripts here combined. 

References: 

Bastin, J. 1990. The natural history researches of Dr. Thomas Horsfield (1773-1859). Pp. 3-97 in Horsfield, 
T. Zoological researches in Java, and the neighbouring islands. Facsimile reprint. Oxford University Press, 
Singapore. 

Dekker, R. W. R. J. & Dickinson, E. C. 2000. Systematic notes on Asian birds. 2. A preliminary review of the 

Eurylaimidae. Zool. Verh. Leiden 331: 65-76. 
Horsfield, T. 1821-24. Zoological researches in Java, and the neighbouring islands. Kingsbury, Parbury & Allen, 

London. 

Mees, G. F. 1989. Remarks on the ornithological parts of Horsfield's 'Zoological Researches in Java'. Proc. 

Koninkl. Ned. Akad. van Wetens. 92: 367-378. 
Oberholser, H. C. 1921. Notes on Horsfield's 'Zoological Researches in Java'. Proc. Biol. Soc. Wash. 34: 

163-166. 

Peters, J. L. 1951. Check-list of birds of the world, vol. 7. Mus. Comp. Zool., Cambridge, MA. 

Raffles, T. S., Sir. 1822. Second part of the Descriptive Catalogue of a Zoological Collection made in the island 

of Sumatra and its vicinity. Trans. Linn. Soc. Lond. 13: 277-340. 
Raphael, S. 1970. The publication dates of the Transactions of the Linnean Society, Series 1, 1791-1875. Biol. 

J. Linn. Soc. 2: 61-76. 

Wells, D. R. 2007. The birds of the Thai-Malay Peninsula, vol. 2. Christopher Helm, London. 

Wells, D.R. in prep. Identity of the type material of Calyptomena viridis, and taxonomic consequences. 

Addresses: D. R. Wells, Serendip, Old Farm, Illington, Thetford, Norfolk IP24 1RP, UK, e-mail: davidrwells. 
wellsl@gmail.com. Edward C. Dickinson, Flat 3, Bolsover Court, 19 Bolsover Road, Eastbourne, East 
Sussex BN20 7JG, UK, e-mail: edward@asiaorn.org 

© British Ornithologists' Club 2010 

A record of active moult in the Streaked Reed Warbler 

Acrocephalus sorghophilus 

by Philip D. Round & Desmond Allen 

Received 5 October 2009 

Streaked Reed Warbler Acrocephalus sorghophilus is a globally threatened species, the 
breeding grounds of which are not known with certainty, but presumed to be in north-east 
Asia ('probably Manchuria': Vaurie 1959; or 'a very limited area of Liaoning and Hebei': 
Brazil 2009). Most previous records are of birds either seen or collected on migration in 
east and north-east China, and from the Dalton Pass, Nueva Vizcaya Province, Luzon, 
the Philippines. The only wintering records come from the Philippines, most at a single 
site, Candaba Marsh, Pampanga Province, Luzon (BirdLife International 2001). Numbers 
detected have declined markedly in the past three decades. There were 18 sightings totaling 
69 birds in 1981-90, compared with only 11 sightings of 22 individuals in 1991-2007. All but 
three of these were at Candaba (T. H. Fisher in Hit. 2009). 



Philip D. Round & Desmond Allen 



146 



Bull. B.O.C. 2010 130(2) 



We conducted a mist-netting survey for A. sorghophihis at Candaba Marsh and other 
wetland sites in central Luzon on 9-22 March 2009. The only A. sorghophihis found during 
this period was caught in the bottom shelf of a mist-net, set at the edge of a small patch of 
Phragmites, in a wet, Polygonum- filled ditch, on 10 March. It was ringed and examined, and 
was found to be moulting the inner primaries. PI (descendent numbering) was less than 
l / 3 grown (moult score 2) and p2 was missing, giving a primary moult score of 3, following 
Ginn & Melville (1983). All other flight feathers and contour feathers were old, unmoulted 
and so heavily worn that it was impossible to determine whether the bird was an adult or 
a first-year. This appears to be the first published record of moult in A. sorghophihis. The 
bird weighed 7.2 g and had muscle and fat scores of 2 and 0 respectively (following Bairlein 
1995). 

If the single 2009-trapped bird was typical, it appears that the timing of moult in A. 
sorghophilus may be roughly comparable with, e.g., Pallas's Grasshopper Warbler Locustella 
certhiola and Middendorff's Grasshopper Warbler L. ochotensis, in which most individuals 
undergo a complete moult in late winter to early spring, shortly before northbound 
migration. Asian-wintering Acrocephalus species exhibit a range of moult strategies 
with some (e.g., Oriental Reed Warbler A. orientalis and Black-browed Reed Warbler A. 
bistrigiceps) having a complete post-nuptial moult on the breeding grounds, whilst others 
(e.g., Blyth's Reed Warbler A. dumetorum, Paddyfield Warbler A. agricola and Manchurian 
Reed Warbler A. tangorum) apparently commence moult soon after arriving in their winter 
quarters, or at least in the early part of the winter (Svensson 1992, Round & Rumsey 2003). 

The plumage of a single A. sorghophihis photographed at Muraviovka Park, near 
Blagoveschensk, Amurskaya Oblast, Russian Federation, on 21 June 2004 (F. Pekus in lift. 
2009) (reported as 22 June 2004 in Round 2009), appeared relatively fresh, with prominent, 
clearly streaked upperparts, and broad, pale, unabraded fringes to its tertials, primaries, 
secondaries and rectrices, providing further support for a complete late winter or early 
spring moult. 

Our single A. sorghophihis was caught among 235 birds (including 122 other Acrocephalus 
warblers) mist-netted in marshy, mainly Phragrnites-dommated, wetland habitats at six 
discrete sites in central Luzon during the 9-22 March period (Round 2009). Thus the 
species appears to be genuinely scarce, presumably due (at least, in part) to the widespread 
conversion of former wetland vegetation to rice paddy. It is also possible that its preferred 
wintering habitat is wetland vegetation other than Phragmites that had been removed, or 
was not encountered, during the survey. Additionally, if Streaked Reed Warblers were 
moulting during the period of the survey this may have inhibited their mobility, reducing 
the probability of capture. Obtaining more information on the ecology, distribution and 
status of this threatened bird is an urgent requisite for its future conservation. 

Acknowledgements 

This work was carried out jointly by Wild Bird Club of the Philippines (WBCP) and The Wetland Trust (UK). 
We thank Carmela Espanola and Jon Villasper for their assistance in the field; Arne Jensen, Michael Lu, and 
other WBCP collaborators, and Mayor Jerry Pelayo and his staff at Candaba for their generous hospitality 
and assistance. Director Mundita Lim and Carlo Custodio of the Protected Areas and Wildlife Bureau, 
Department of Environment and Natural Resources, kindly expedited issue of permits. We thank Tim Fisher, 
Peter Kennerley, Paul Leader and Stephen Rumsey for their encouragement and advice; additionally Peter 
Kennerley, Paul Leader and Lars Svensson for commenting on the manuscript; and Fabieri Pekus for making 
details of his sighting available. The survey was funded by a grant to WBCP by The Wetland Trust, UK. 

References: 

Bairlein, F. 1995. European-African songbird migration network; manual of field methods. Institut fur Vogelforschung, 
Wilhelmshaven. 



Donald W. Buden et al. 



147 



Bull. B.O.C. 2010 130(2) 



BirdLife International. 2001. Threatened birds of Asia: the BirdLife International Red Data book. BirdLife 

International, Cambridge, UK. 
Brazil, M. 2009. Field guide to the birds of East Asia. Christopher Helm, London. 
Ginn, H. B. & Melville, D. S. 1983. Moult in birds. British Trust for Ornithology, Tring. 

Round, P. D. 2009. The latest search for Streaked Reed Warbler Acrocephalus sorghophilus in the Philippines. 
BirdingASIA 11: 15-16. 

Round, P. D. & Rumsey, S. 2003. Habitat use, moult and biometrics in the Manchurian Reed Warbler 

Acrocephalus tangorum wintering in Thailand. Ring. & Migr. 21: 215-221. 
Svensson, L. 1992. Identification guide to European passerines. Fourth edn. British Trust for Ornithology, 

Thetford. 

Vaurie, C. 1959. The birds of the Palearctic fauna: Passer if ormes. H. F. & G. Witherby, London. 

Addresses: Philip D. Round, Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, 
Bangkok 10400, Thailand, e-mail: frpdr@mahidol.ac.th. Desmond Allen, 97 Sussex Way, London N7 
6RU, UK, e-mail: dnsallen@ukonline.co.uk 

© British Ornithologists' Club 2010 

First record of Nicobar Pigeon Caloenas nicobarica in the 
Federated States of Micronesia 

by Donald W. Buden, John Wichep & Gibson Santos 

Received 22 November 2009 

Nicobar Pigeon Caloenas nicobarica exhibits a spotty distribution from the Andaman 
and Nicobar islands (India) east to the Philippines and Republic of Palau (south-western 
Micronesia), and south through Indonesia and the New Guinea region to the Solomons 
(Baptista et al. 1997). It has a predilection for small, remote, and relatively undisturbed 
islands for breeding, sometimes in dense colonies, but the species disperses widely 
to larger islands and adjacent mainland areas to feed, often making lengthy oversea 
flights (Gibbs et al. 2001, BirdLife International 2009). Nicobar Pigeon is considered Near 
Threatened, with declining numbers throughout most of its range because of over-hunting, 
exploitation for the pet trade, habitat destruction, and predation by introduced mammals 
(BirdLife International 2008). However, the distinct Palau subspecies C. n. pelezvensis has 
increased dramatically in recent years, possibly because of a local ban on shotguns, after 
being close to extinction immediately following World War II (Baker 1951, Pratt & Etpison 
2008). Although it forages mostly on the ground, Nicobar Pigeon is a powerful flyer 
(Delacour 1959, Goodwin 1983, Gibbs et al. 2001), and highly nomadic (Baptista et al. 1997), 
thus making the species predisposed to reach distant islands outside its normal range. 
Observations on Tench Island, in the northern Bismarck archipelago, indicated that Nicobar 
Pigeons commuted daily to forage on the larger islands to the south (Coates 1977; G. Dutson 
in litt. 2009), and, according to local reports (in Coates 1977), they leave the island altogether 
at certain times of the year but where they go is unknown. 

A Nicobar Pigeon (Figs. 1-2) captured alive in Pohnpei (Fig. 3) on 3 November 2009 
is the first documented record for the Federated States of Micronesia (FSM). Members of a 
local family working in a patch of agroforest in Nanmand Village, Kitti Municipality, in the 
south-west of the island first observed the bird then captured it by hand in the same area 
later in the day after seeing the bird run along a forest trail. They brought it to GS, who 
then showed it to JW who photographed the bird. GS kept the pigeon in captivity for a 
short time in an attempt to rehabilitate it, but the bird died on 5 November and the remains 



Donald W. Buden et al. 



148 



Bull. B.O.C. 2010 130(2) 




Figures 1-2. Nicobar Pigeon Caloenas nicobarica captured on Pohnpei, Federated States of Micronesia, 3 
November 2009 (J. Wichep) 



\ 1 ^t^' 



■ Myanmar Xj. 



( Thailand^ ^ 



I V ^ it 

i »# Hi 



Philippines 




Palau 



Indonesia 



4. 



500 km 



Pohnpei 



Bismarck 
Archipelago 



Solomon 
Islands 



Australia 



Figure 3. Range of Nicobar Pigeon Caloenas nicobarica; modified, with permission, from BirdLife International 
(2008). 

were discarded in a compost heap. JW sent the photographs to DWB for identification, 
and GS subsequently retrieved the carcass on 9 November and brought it to the College of 
Micronesia, where the skeleton was preserved and is currently held. 

The nearest population from which the Pohnpei bird could have originated is in north- 
eastern Melanesia, c. 1,500 km to the south across mostly open ocean. The only resident 
population of C. nicobarica in the Caroline Islands, of which Pohnpei is a part, is in Palau, 



Donald W. Buden et al. 



149 



Bull. B.O.C. 2010 130(2) 



c.2,500 km to the west (but with numerous islands as potential intermediary stops). The 
endemic Palau subspecies differs from the nominate form in the rest of the range by its 
smaller size, shorter, less attenuated neck hackles (some with bifurcate tips), and bluer 
(less green and coppery) iridescent dorsal feathers (Baker 1951, Goodwin 1983, Gibbs et al. 
2001). (Note that Baptista et al. 1997 incorrectly depict C. n. pelewensis with all of the hackles 
bifurcate.) Compared with a series of specimens of the nominate subspecies and single 
examples each of adult C. n. pelewensis in the Smithsonian Institution, Washington DC (S. 
L. Olson in litt. 2009) and the American Museum of Natural History, New York (M. LeCroy 
in litt. 2009), the coloration in the photographs of the Pohnpei bird is closer to that of C. n. 
nicobarica than C. n. pelewensis. Also, the neck hackles of the Pohnpei bird were longer and 
narrower than those shown in published photographs of C. n. pelewensis (Pratt & Etpison 
2008) and none were bifurcate. Measurements (in mm) of the coracoid (greatest length 
47.8, least shaft width 4.2, sternal facet width 11.2, sternal facet depth 4.8) of the Pohnpei 
specimen all fall near or at the upper range limits of C. n. nicobarica reported in Balouet & 
Olson (1989) [skeletal material of C. n. pelewensis not available], and the measurements of 
the humerus (distal width 13.8), and length of radius (67.8), exceed the range limits (12.5- 
13.4 and 58.4-64.3, respectively, n = 21). However, the skeletal material of C. n. nicobarica 
examined by Balouet & Olson (1989) included many zoo birds and their measurements 
may differ somewhat from wild-caught birds. Whether the larger and longer wing bone 
measurements in the Pohnpei bird represent extreme individual variation, or if they are 
characteristic of the local population whence it came is unknown, but they eliminate 
derivation from Palau. 

Acknowledgements 

We thank Stuart Butchart and BirdLife International for permission to modify the IUCN range map for C. 
nicobarica, Shaun Suliol, IT Office, College of Micronesia for the modifications, Mary LeCroy and Storrs Olson 
for comparing the photographs of the Pohnpei bird with specimens in the American Museum of Natural 
History and the National Museum of Natural History, Smithsonian Institution, respectively, M. LeCroy, 
Alison Pirie and S. Olson for providing literature sources, and Doug Pratt and Guy Dutson for reviewing 
the manuscript. 

References: 

Baker, R. H. 1951. The avifauna of Micronesia, its origin, evolution, and distribution. Univ. Kansas Publ., Mus. 
Nat. Hist. 3: 1-359. 

Balouet, J. C. & Olson, S. L. 1989. Fossil birds from late Quaternary deposits in New Caledonia. Smithsonian 
Contrib. Zool. 469: 1-38. 

Baptista, L. F., Trail, P. W. & Horblit, H. M. 1997. Family Columbidae (pigeons and doves). Pp. 60-243 
in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.) Handbook of the birds of the world, vol. 4. Lynx Edicions, 
Barcelona. 

BirdLife International. 2008. Caloenas nicobarica. In: IUCN Red List of threatened species. Version 2009.2. 

www.iucnredlist.org (accessed 6 November 2009). 
BirdLife International. 2009. Species factsheet: Caloenas nicobarica. www.birdlife.org (accessed 6 November 

2009). 

Coates, B. 1977. Observations of the birds of Tench Island. New Guinea Bird Soc. Newsletter 136: 8-10. 
Delacour, J. 1959. Wild pigeons and doves. All-Pets Books, Fond du Lac, WI. 

Gibbs, D., Barnes, E. & Cox, J. 2001. Pigeons and doves: a guide to the pigeons and doves of the world. Yale Univ. 

Press, New Haven & London. 
Goodwin, D. 1983. Pigeons and doves of the world. Cornell Univ. Press, Ithaca, NY. 
Pratt, H. D. & Etpison, M. T. 2008. The birds and bats of Palau. Mutual Publishing, Honolulu. 

Addresses: Donald W. Buden, Division of Natural Sciences and Mathematics, College of Micronesia, P.O. Box 
159, Kolonia Pohnpei FM 96941, e-mail: don_buden@comfsm.fm. lohn Wichep, Quarantine Services, 
Agriculture Unit, Department of Resources and Development, FSM National Government, P.O. Box 
PS-12, Palikir, Pohnpei FM 96941, e-mail: jwichep@dea.fm. Gibson Santos, USDA Natural Resources 
Conservation Services, P.O. Box 206, Kolonia, Pohnpei FM 96941, e-mail: gibson.santos@pb.usda.gov. 

© British Ornithologists' Club 2010 



Jin Mlikovsky 



150 



Bull. B.O.C. 2010 130(2) 



Authorship and type specimens of Uria mandtii (Alcidae) 

by Jiff Mlikovsky 

Received 5 December 2009 

Black Guillemots of the northern Arctic seas are usually separated subspecifically as 
Cepphus grylle mandtii (e.g. Vaurie 1965, Cramp 1985, Nettleship 1996, Dickinson 2003). 
Citation of the author and date of the original description of this form are confused in the 
literature. The species-group name was attributed to Lichtenstein (1823) by most early 
authors (e.g. Keyserling & Blasius 1840: xcii, Schlegel 1844: cviii, Schlegel 1867: 18, Coues 
1868: 72, Rey 1872: 157, Giebel 1877: 741). Coues et al (1886: 82, 1895: 10) and Coues (1896; 
see also Ogilvie-Grant 1898: 584, and Sherborn 1928: 3849) suggested that the name should 
be attributed to Lichtenstein (in Mandt 1822). For unknown reasons, their correct view has 
been abandoned, and 20th-century authors (e.g. Allen et al. 1910: 30, Ridgway 1919: 739, 
Hartert 1921: 1776, Austin 1934, Peters 1934: 354, Dement'ev 1951: 203, Kozlova 1957: 73, 
Vaurie 1965: 514, Glutz von Blotzheim & Bauer 1982: 1091, Cramp 1985, Nettleship 1996: 
711, Dickinson 2003: 154, Stepanyan 2003: 269) generally attributed the name to Mandt 
(1822) himself. 

The name mandtii, as published in the binomen Uria mandtii, first appeared in the printed 
version of a dissertation defended at Berlin University in 1822 by Martin Wilhelm Mandt 
(1800-58; latinised as Martinus Guilelmus Mandt), then a student of medicine in Berlin and 
subsequently physician at the court of Emperor Nicholas I (1796-1855) in St. Petersburg, 
Russia (see Mandt 1917, Erichsen 1936). Copies of this book survive at least in the following 
libraries: Deutsche Staatsbibliothek, Berlin, Germany (two copies); Cambridge University 
Library, Cambridge, MA, USA; Kobenhavn Universitets Bibliotek, Copenhagen, Denmark; 
Natural History Museum, London, UK; and Smithsonian Institution Libraries, Washington, 
DC, USA. The book thus meets the criteria for publication under Art. 8.1 of the International 
code of zoological nomenclature (ICZN 1999). The section in question reads as follows (/ / 
= new paragraph): 'Avium quae quum nihil non cognitum exhibere videantur, hie 
tantum de ea quaedam subiiciam, quam ill Lichtenstein tanquam novam speciem, nomine 
designavit / / Uriae Mandtii. / / Humantissime mecum sequentes notas communicavit 
characteristicas quibus insignitur: . . .' (Mandt 1822: 30). The colon is followed by a diagnosis 
of the species. Mandt mentions explicitly in the text reprinted above, that 'Lichtenstein', 
i.e. Martin Hinrich Carl Lichtenstein (1780-1857), professor of zoology and Mandt's tutor 
at the Berlin University and also head of the Zoological Museum in Berlin, supplied him 
with both the name and the diagnosis of the new species. Following the International code of 
zoological nomenclature (ICZN 1999, Art. 50.1), Lichtenstein is thus the author of this nominal 
taxon, although the name was published in another author's work. Correct citation of the 
name is thus Uria mandtii M. H. C. Lichtenstein in Mandt, 1822, and its current taxonomic 
position: Cepphus grylle mandtii (M. H. C. Lichtenstein in Mandt, 1822). 

Lichtenstein (1823: 88) apparently did not consider Mandt's (1822) dissertation a 
publication and described the species anew, with the same name and a diagnosis very 
similar to that printed in Mandt (1822), but without reference to that work. Being based 
on the same type series as Uria mandtii Lichtenstein in Mandt (see below for relevant 
specimens), Uria mandtii Lichtenstein, 1823, is both a junior objective synonym and a junior 
homonym of Uria mandtii Lichtenstein in Mandt, 1822. 

Both Uria Mandtii Lichteinstein /'// Mandt, 1822, and Uria Mandtii Lichtenstein, 1823, 
were based on three specimens collected by Mandt in 1821 at Spitsbergen (exact locality 



Jin Mlfkovsky 



151 



Bull. B.O.C. 2010 130(2) 



unknown) and brought to Berlin (see Mandt 1822, Lichtenstein 1823: 88). Lichtenstein 
(1854: 105) listed three specimens of Uria Mandtii from 'Spitzbergen' in the Museum fiir 
Naturkunde (ZMB), Berlin, Germany. Only two of these were registered in the Sammlungs- 
Katalog of the ZMB under inventory nos. ZMB 14416-417. 1 found only one of these syntypes 
(ZMB 14416) in the ZMB in 2007, the other being probably lost. The third syntype was 
forwarded by Lichtenstein to the Rijksmuseum van Natuurlijke Historie (now: Naturalis; 
RMNH), Leiden, Netherlands, between 1854 and 1867, when this specimen was already 
mentioned by Schlegel (1867: 19; cf. Coues 1868: 72). It was not listed in the relevant 
catalogue of avian types at the RMNH (Hoek Ostende et al. 1997), because the specimen 
was not recognised as a type at the time, but is still present there (catalogued as RMNH. 
AVES.91009; S. van der Mije in lift. 2009). 

Acknowledgements 

I am obliged to Sylke Frahnert (ZMB, Berlin) for permission to work in collections under her care in 
November 2007, to Hein J. van Grouw, Steven van der Mije and Christiane Quaisser (RMNH, Leiden) for 
information on material at RMNH, and to Edward Dickinson, Guy Kirwan, Richard Schodde and Frank 
Steinheimer for comments on the manuscript. This paper was supported in part by grants from the Ministry 
of Culture of the Czech Republic (MK 06P04OMG008 and MK 00002327201). 

References: 

Allen, J. A., Richmond, C. W., Brewster, W., Dwight, J., Merriam, C. H., Ridgway, R. & Stone, W. 1910. Check- 
list of North American birds. Third revised edn. American Ornithologists' Union, New York. 
Austin, O. L. 1934. The races of Cepphus grylle (Linn.). Bull. Northeastern Birdbanding Assoc. 1934: 1-6. 
Coues, E. 1868. A monograph of the Alcidae. Proc. Acad. Nat. Sci. Phil. 20: 2-81. 
Coues, E. 1896. Mandt's inaugural dissertation. Auk 13: 266. 

Coues, E., Allen, J. A., Ridgway, R., Brewster, W. & Henshaw, H. W. 1886. The code of nomenclature and check- 
list of North American birds adopted by the American Ornithologists' Union. American Ornithologists' Union, 
New York. 

Coues, E., Allen, J. A., Brewster, W., Merriam, C. H. & Ridgway, R. 1895. Check-list of North American birds. 

Second revised edn. American Ornithologists' Union, New York. 
Cramp, S. (ed.) 1985. The birds of the Western Palearctic, vol. 4. Oxford Univ. Press. 

Dement'ev, G. P. 1951. [Order auks Alcae or Alciformes]. Pp. 169-240 in Dement'ev, G. P. & Gladkov, N. A. 

[Birds of the Soviet Union], vol. 2. Nauka, Moscow. [In Russian.] 
Dickinson, E. C. (ed.) 2003. The Howard and Moore complete checklist of the birds of the world. Third edn. 

Christopher Helm, London. 
Erichsen, F. C. 1936. Martin Wilhelm Mandt. Abh. Geschichte Medizin Naturwiss. 10: 1-183. 
Giebel, C. G. 1877. Thesaurus ornithologiae, vol. 3. F. A. Brockhaus, Leipzig. 

Glutz von Blotzheim, U. & Bauer, K. M. 1982. Handbuch der Vogel Mitteleuropas, Bd. 8(2). Akademische 

Verlagsgesellschaft, Wiesbaden. 
Hartert, E. 1921. Die Vogel der paldarktischen Fauna, Bd. 3(15). R. Friedlander & Sohn, Berlin, 
van den Hoek Ostende, L. W., Dekker, R. W., R. J. & Keijl, G. 0. 1997. Type-specimens of birds in the National 

Museum of Natural History, Leiden. Part 1. Non-Passerines. NNM Tech. Bull. 1: 1-248. 
International Commission on Zoological Nomenclature (ICZN). 1999. International code of zoological 

nomenclature. Fourth edn. The International Trust for Zoological Nomenclature, c/o The Natural 

History Museum, London. 
Keyserling, A. & Blasius, J. H. 1840. Die Wirbelthiere Europa's. Friedrich Vieweg und Sohn, Braunschweig. 
Kozlova, E. V. 1957. [Fauna of the USSR. Vol. 2. Waders. Part 3. Auks]. Nauka, Moscow. [In Russian.] 
Lichtenstein, H. 1823. Verzeichniss der Doubletten des zoologischen Museums der Konigl. Universitat zu Berlin nebst 

Beschreibung vieler bisher unbekannter Arten von Saugethieren, Vogeln, Amphibien und Fischen. T. Trautwein, 

Berlin. 

Lichtenstein, H. 1854. Namenverzeichniss der in der zoologischen Sammlung der Koniglichen Universitat zu Berlin 
aufgestellten Arten von Vogeln nach den in der neueren Systematik am meisten zur Geltung gekommenen Namen 
der Gattungen und ihrer Unterabtheilungen. Konigliche Akademie der Wissenschaften, Berlin. [Often cited 
with the Latin title Nomenclator avium musei zoologici berolinensis.] 

Mandt, M. W. [M. G.] 1822. Observationes in historiam naturalem et anatomiam comparatam in itinere Groenlandico 
factae. Bruescheck, Berlin. 

Mandt, M. W. 1917. Fin deutscher Arzt an Hofe Kaiser Nikolaus' I. von Rufiland: Febenserinnerungen. Duncker & 
Humblot, Miinchen. 

Nettleship, D. N. 1996. Family Alcidae (auks). Pp. 678-722 in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.) 
Handbook of the birds of the world, vol. 3. Lynx Edicions, Barcelona. 



jiff MHkovsky 



152 



Bull. B.O.C. 2010 130(2) 



Ogilvie-Grant, W. R. 1898. Order XIX. Alcae. Pp. 559-622 in Sharpe, R. B. & Ogilvie-Grant, W. R. Catalogue of 

the birds in the British Museum, vol. 26. Trustees of the Brit. Mus., London. 
Peters, J. L. 1934. Check-list of birds of the world, vol. 2. Harvard Univ. Press, Cambridge, MA. 
Rey, E. 1872. Synonymik der Europaischen Brutvogel und G'dste. G. Schwetschke'scher Verlag, Halle. 
Ridgway, R. 1919. The birds of North and Middle America. Part 8. Bull. US Natl. Mus. 50(8): 1-852. 
Schlegel, H. 1844. Kritische Ubersicht der europaischen Vogel. A. Arnz u. Comp., Leiden. 

Schlegel, H. 1867. Museum d'Histoire Naturelle des Pays-Bas. Revue methodique et critique des collections deposees 

dans cet etablissement. Vol. 6. Monographic 33: Urinatores. E. J. Brill, Leiden. 
Sherborn, C. D. 1928. Index animalium, vol. 2 (Pt. 15). Brit. Mus. (Nat. Hist.), London. 

Stepanyan, L. S. 2003. \Conspectus of the ornithological fauna of Russia and adjacent territories (within the borders 

of the USSR as a historical region)]. Akademkniga, Moscow. [In Russian.] 
Vaurie, C. 1965. The birds of the Palearctic fauna. Non-Passseriformes. H. F. & G. Witherbv, London. 

Address: Department of Zoology, National Museum, Vaclavske namesti 68, CZ-115 79 Praha 1, Czech 
Republic; e-mail: jiri_mlikovsky@nm.cz 



© British Ornithologists' Club 2010 



BOC Office 

P.O. Box 417, Peterborough PE7 3FX, UK 
E-mail: boc.office@bou.org.uk. Website: www.boc-online.org 
Tel. & Fax: +44 (0) 1733 844 820. 

MEMBERSHIP 

Subscriptions for 2010 will be due for renewal from 1 January 2010. 

Please note that a single subscription rate of £20 applies regardless of whether the subscriber is a member of 
the BOU or not. The US$ alternative is no longer available. 

All paid-up members receive (postage free) four issues of the Bulletin (including index). 

Membership correspondence and applications for membership, changes of address and all other membership 
related items should be addressed to the BOC Office (above). No registered items should be sent to the PO 
Box. Contact BOC Office for direct mail of such items. For general Club correspondence see below. 

INSTITUTIONAL SUBSCRIBERS & APPLICATIONS FOR BACK NUMBERS 
OR OTHER CLUB PUBLICATIONS 

The Bulletin, together with annual index, may be purchased (postage free) by Institutional Subscribers, on 
payment of an annual subscription of £40 to the BOC Office (above) or via the BOC website (www.boc-online. 
org). Please note that the US$ option is no longer available. Back issues of the Bulletin are available from the 
BOC Office (above). BOC Occasional Publications and other BOC publications are available from the BOC 
Office or online from the BOC website (www.boc-online.org). 

Ideas for future publications and policy should be referred direct to the BOC: Dr D. R. Wells, BOU/BOC 
Commissioning Editor, c/o BOC Office, P.O. Box 417, Peterborough, PE7 3FX, UK. 



PAYMENTS 

All amounts quoted are net, should be paid in £ Sterling and sent to the BOC Office (above). Other currencies 
are not accepted. Other currency users can pay by credit card from which the Sterling amount will be 
deducted and the amount in your local currency will be indicated on your card statement. All cheques or 
drafts should be made payable to British Ornithologists' Club. Direct bank transfers can be made to Barclays 
Bank, Wavertree Boulevard, Liverpool L7 9PQ. Sort Code: 20-00-87. Account no: 10211540, with confirmation 
to the BOC Office (above). 



CLUB CORRESPONDENCE 

Correspondence on all general Club matters should be addressed to: The Hon. Secretary, S.A.H. (Tony) 
Statham, Ashlyns Lodge, Chesham Road, Berkhamsted, Herts. HP4 2ST, UK. E-mail: boc.sec@bou.org.uk. See 
inside front cover for details of Club meetings. 



COMMITTEE 

Miss H. Baker {Chairman) (2009) D. J. Fisher (Hon. Website Manager) (2007) 

Dr R. P. Prys-Jones [V ice-Chairman) (2009) S. M. S. Gregory (2009) 

S. A. H. Statham {Hon. Secretary) (2004) K. Heron Jones (2009) 

D. J. Montier {Hon. Treasurer) (1997) C. W. R. Storey (2009) 

M. J. Walton (2008) 

Ex-officio members 

Hon. Editor: G. M. Kirwan (1 January 2004) 

Chairman of BOU/BOC Joint Publications Committee (JPC): Revd. T. W. Gladwin 
Administration Manager: S. P. Dudley (2005) 
BOU/BOC Commissioning Editor: Dr D. R. Wells (2009) 



Registered Charity No. 279583 



Bulletin of the British Ornithologists' Club 

ISSN 0007-1595 
Edited by Guy M. Kirwan 

Volume 130, Number 2, pages 73-152 



CONTENTS 

Club Announcements 73 

RYAN, P. G., NUPEN, L., ROSE, B. & SULEIMAN, A. S. Geographic variation in Socotra Sparrows 

Passer insularis 75 

KIRWAN, G. M. & GRIEVE, A. How many subspecies of Coal Tit Periparus ater are there in Iran? 83 

TOMKOVICH, P. S. Assessment of the Anadyr Lowland subspecies of Bar-tailed Godwit Limosa 

lapponica anadyrensis 88 

COLLINS, C. T. A review of natal pterylosis of passerines: useful information or avian marginalia?.. 96 

SCHOENJAHN, J. The type and other early specimens of Grey Falcon Fako hypoleucos 102 

PORTER, R. F. & KIRWAN, G. M. Studies of Socotran birds VI. The taxonomic status of the Socotra 

Buzzard 116 

SHIRIHAI, H. & BRETAGNOLLE, V. First observations at sea of Vanuatu Petrel Pterodroma 

(cervicalis) occulta 132 

PIACENTINI, V. Q., PACHECO, J. F. & WHITNEY, B. M. The name Ramphastos piperivorus Linnaeus 

revisited . 141 

WELLS, D. R. & DICKINSON, E. C. Authorship of the broadbill genus name Cahjptomena and the 

correct citations for this and Calyptomena viridis Raffles 143 

ROUND, P. D. & ALLEN, D. A record of active moult in the Streaked Reed Warbler Acrocephalus 

sorghophilus . 145 

BUDEN, D. W., WICHEP, J. & SANTOS, G. First record of Nicobar Pigeon Caloenas nicobarica in the 

Federated States of Micronesia 147 

MLIKOVSKY, J. Authorship and type specimens of Uria mandtii (Alcidae) 150 



EDITORIAL BOARD 

Murray Bruce, R. T. Chesser, Edward C. Dickinson, Francoise Dowsett-Lemaire, Steven M. S. Gregorv, Jose 
Fernando Pacheco, Robert B. Payne, Pamela C. Rasmussen, Cees Roselaar, Thomas S. Schulenberg, Lars 
Svensson 

Authors are invited to submit papers on topics relating to the broad themes of taxonomy and distribution of 
birds. Descriptions of new species of birds are especially welcome and will be given prioritv to ensure rapid 
publication, subject to successful passage through the normal peer review procedure, and wherever possible 
should be accompanied by colour photographs or paintings. On submission, manuscripts, double-spaced and 
with wide margins, should be sent to the Editor, Guy Kirwan, preferablv by e-mail, to GMKirwan@aol.com. 
Alternatively, two copies of manuscripts, typed on one side of the paper, mav be submitted to the Editor, 
74 Waddington Street, Norwich NR2 4JS, UK. Where appropriate half-tone photographs may be included 
and, where essential to illustrate important points, the Editor will consider the inclusion of colour figures (if 
possible, authors should obtain funding to support the inclusion of such colour illustrations). 

As far as possible, review, return of manuscripts for revision and subsequent stages of the publication 
process will be undertaken electronically. 

For instructions on style, see the inside rear cover of Bulletin 130(1) or the BOC website. 



Registered Charity No. 279583 
© British Ornithologists' Club 2010 

www.boc-online.org 



Printed on acid-tree paper. 
Published by the British Ornithologists' Club 
I ypeset by Alcedo Publishing of Arizona, USA, and printed by Latimer Trend, UK 



102. 



British Ornithologists' Club 



THE NATURAL 
HISTORY MUSEUM 

- 8 SEP 2010 



PRESENTED 
TRING LIBRARY 




Volume 130 No. 3 
September 2010 



MEETINGS are normally held in the ground floor of the Sherfield Building of Imperial College, South 
Kensington, London, SW7. This suite is now called the Tower Rooms and meetings normally take place in 
Section A with the entrance opposite the Queen's Tower in the main quadrangle. The nearest Tube station is 
at South Kensington; a map of the area will be sent to members, on request. (Limited car parking facilities can 
be reserved [at a special reduced charge of £5.00], on prior application to the Hon. Secretary.) 

The cash bar is open from 6.15 pm, and a buffet supper, of two courses followed by coffee, is served at 
7.00 pm. (A vegetarian menu can be arranged if ordered at the time of booking.) Informal talks are given on 
completion, commencing at about 8.00 pm. 

Dinner charges are £22.50 per person. 

FORTHCOMING MEETINGS 
See also BOC website: http://www.boc-online.org 



21 September — Dr Andrew Gosler — Eggs dressed and undressed 

Dr Gosler (Edward Grey Institute, Oxford University) is well known for the studies he has carried out over 
many years on the tit populations in Wytham Woods, near Oxford. His talk will provide an overview of 
recent research he has been conducting into the functional ecology of eggshell pigmentation, which includes 
novel ideas regarding the selective factors underlying variation in the external appearance of eggs. 

Applications to Hon. Secretary (address below) by 7 September 2010 



2 November — Michael Jennings — Birds of Arabia 

Mike Jennings has been interested in the birds of Arabia since 1969, when he worked in Bahrain, and later 
in Riyadh, Saudi Arabia in 1975. In the early 1980s he started a programme to collect bird distribution data 
for the Atlas of the Breeding Birds of Arabia (ABBA) project, which has taken him on 41 targeted field 
surveys to every corner of Arabia. The ABBA project has also involved contributions from 500 observers 
past and present, and a review of the published literature on the birds of the peninsula and examination 
of many specimens in museums. The atlas is due for publication in summer 2010 and will include species 
accounts, maps and drawings for 273 birds known to have bred in Arabia and shorter notes on a further two 
dozen thought likely to breed. He will talk about the aspects that make ornithology and birdwatching in 
Arabia so interesting. These include its zoogeographical position, with elements of the avifauna of the 
Palearctic, the Afrotropical and the Indo-Malayan regions; the high incidence of endemism (23 species in 
the peninsula and Socotra); Arabia's pivotal position on migration routes from Africa to Eurasia and India 
to Eurasia, and for a few species Africa to India; the large number of introduced, feral breeding species 
(20+); and its diverse topography, climate and vegetation. 

Applications to Hon. Secretary (address below) by 19 October 2010 



Overseas Members visiting Britain are especially welcome at these meetings, and the Hon. Secretary would 
be very pleased to hear from anyone who can offer to talk to the Club giving as much advance notice as 
possible — please contact: S. A. H. (Tony) Statham, Ashlyns Lodge, Chesham Road, Berkhamsted, Herts. HP4 
2ST, UK. Tel. +44 (0)1442 876995 (or e-mail: boc.sec@bou.org.uk). 



BOC Office 

P.O. Box 417, Peterborough PE7 3FX, UK 
I mail: boc.office@bou.org.uk. Website: www. boc-online.org 
Tel. & Fax: +44 (0) 1733 844 820. 



Club Announcements 



153 



Bull. B.O.C. 2010 130(3) 



Bulletin of the 

BRITISH ORNITHOLOGISTS' CLUB 



Vol. 130 No. 3 Published 14 September 2010 



CLUB ANNOUNCEMENTS 

Members are reminded that subscriptions were due for renewal on 1 January 2010 and are again respectfully 
requested to check that any Standing Orders are correctly lodged with their banks. Subscriptions are £20 p. a. 
regardless of whether the subscriber is a member of the BOU or not. 



The 960th meeting of the Club was held on Tuesday 16 March 2010 in the Sherfield Building, Imperial 
College, South Kensington, London, SW7. Thirteen members and three guests were present. 

Members attending were: Miss H. BAKER (Chairman), Cdr. M. B. CASEMENT, RN, S. E. CHAPMAN, 
S. M. S. GREGORY, D. GRIFFIN, K. HERON JONES, Dr J. P. HUME, R. R. LANGLEY, Dr C. F. MANN, D. J. 
MONTIER, Dr R. P. PRYS-JONES, S. A. H. STATHAM and C. W. R. STOREY. 

Guests attending were: Mrs J. HERON JONES, Mrs M. MONTIER and Mrs A. J. McDONALD. 

After dinner, Dr Julian Hume gave an informative and well-illustrated talk on the Birds of the Comoros 
Islands. The Comoros comprise four main volcanic islands, Mayotte, Moheli, Anjouan and Grand Comore, 
situated between Mozambique and Madagascar. They have been inhabited since the fifth century, so 
human-induced environmental change has continued for the last 1.5 millennia. Despite this, 146 species 
have been recorded, of which 14 endemic species and subspecies of bird survive, albeit some are very rare, 
and they are mainly concentrated in the remnant forests. The birds have strong biogeographical connections 
with Madagascar and Africa, and only one species, Homblot's Flycatcher Humblotia flavirostris, belongs to an 
endemic genus. Moheli, the smallest island, still harbours many bird species, most notably four sympatric 
species of pigeon, unique within the south-west Indian Ocean islands. The birds are easily detected but 
human disturbance is high. Anjouan is under the greatest threat of encroachment, with almost all of its 
forests degraded to some degree and even these continue to be cut for firewood. Many of the bird species 
are confined to the remnant montane forests and are only viewable after steep hikes. Grand Comore is the 
largest and youngest island, and its main volcano, Mount Karthala, boasts one of the largest active craters in 
the world. Most of the endemic birds are concentrated around the crater, and after a long hike it is possible 
to see most birds comparatively easily in the stunted forests. Unlike the other islands, which are a United 
Arab Republic, France administers Mayotte and standards of living are high. It still retains forest and has 
suffered less human disturbance than the other islands, despite good roads, and most of the birding areas 
are reached easily. Other than Mayotte, the Comoros have lagged behind in terms of tourism, are poverty 
stricken, and logistically difficult to travel around, not only between islands, but intra-island as well. The 
remaining forests are under extreme pressure from human encroachment, thus the long-term future of the 
avifauna is unfortunately rather tenuous. 



Henry Seebohm 

Tim Milsom is preparing a book on the ornithological achievements of Henry Seebohm (1832-95), who was 
a founder member of BOC. If any BOC members possess Seebohm manuscripts, including letters, books or 
papers interleaved with comments by Seebohm, or annotated copies of his works, and would be willing 
to share the information that these items contain, please contact him: Dr Tim Milsom (e-mail tpmilsom® 
btinternet.com), Orchard House, Flawith, York Y061 1SF, UK. 



THE NATURAL 
HISTORY MUSEUH 

-8 SEP 2010 

PRESENTED 
TR1NG LIBRARY 



Mochamad Indrawan et al. 



154 



Bull. B.O.C. 2010 130(3) 



Rediscovery of the Critically Endangered Banggai Crow 
Corvus unicolor on Peleng Island, Indonesia, 
part 1: ecology 

by Mochamad Indrawan, Yunus Masala, Dadang Diviputra, Fachry Nnr 
Mallo, Ayub Maleso, Agns Salim, Frangky Masala, Idris Tinulele, 
Leffrendy Pesik, Daniel Simson Katiandagho & Sunosol 

Received 31 March 2009; final revision accepted 9 May 2010 

Summary. — Following searches initiated in 1991, the Critically Endangered Banggai 
Crow Corvus unicolor, a species previously known solely from specimens, was 
rediscovered in 2004. It has proved to be a primarily a forest bird on Peleng, where 
a healthy population occurs in the island's montane west, principally at 500-900 m, 
with another population in the lowlands of the island's central isthmus. Banggai 
Crow's behaviour and ecology are similar to those of Piping Crow C. typicus. 
Slender-billed Crow C. enca, a potential competitor, appears to be segregated 
by habitat and perhaps altitude. Nest trees were tall forest species including a 
Bombaceae, a Calophyllum sp., a Canarium sp. and a Palaquium sp. The conservation 
prospects for Banggai Crow are discussed. 

Banggai Crow Corvus unicolor was described from two specimens collected by native 
hunters, at an unspecified locality in the 'Banggai, Sula Islands', Indonesia (Hartert 1919). 
Subsequently, in November 1991, YM & LP briefly observed a lone bird in montane forest 
on western Peleng (Indrawan et al. 1997), the first indication of its survival in the wild. 
Assuming a tiny population (based on the lack of recent records) and rates of habitat loss, 
Banggai Crow was classed as Critically Endangered (BirdLife International 2001, 2005, 
2008). Following the species' definite rediscovery in 2004 (Indrawan & Masala 2007, Masala 
et al. 2008, Mallo et al. 2010), our main aim became to research its ecology and review its 
conservation status. Another, apparently smaller, population was discovered two years 
later by Celebes Bird Club (CBC) in the central isthmus of Peleng (CBC 2006, 2007, 2008, 
Mallo et al. 2010). 

Study area and Methods 

The general geography and ecology of the Banggai Islands, and the neighbouring Sula 
Islands, have been described elsewhere (ICBP 1992, Indrawan et al. 1993, Davidson et al. 1994, 
Sujatnika et al. 1996). The Banggai archipelago, which shares many biogeographic affinities 
with mainland Sulawesi, is named after the second-largest island (265 km 2 ), but Peleng (at 
2,325 km 2 ) is the largest island. The islands are predominantlv low-lying, comprised to a 
large extent of coralline limestone, and vegetated by mosaics of mixed gardens and moist 
forests at various stages of disturbance. Only western Peleng reaches altitudes in excess of 
500 m, with remnants of pre-humid forest ranging from lowland to montane and subalpine; 
with increasing altitude the forests become less degraded. CBC (2008) found that central 
and eastern Peleng (which has undulating to hilly terrain) has more topsoil than the western 
part, supporting lowland forest trees including figs (Ficus spp.), as well as Canarium spp., 
Pigafetta filaris, Lithocarpus havilandii, L. glutinosus, Shorea koordersii, Pometia sp., Macaranga 
spp., Gnetum gnetnon, Trema oriental is and a Mangifera sp. 



Mochamad Indrawan et al. 155 Bull. B.O.C. 2010 130(3) 




Figure 1. Map of the Banggai Islands, including Peleng (main study localities: two in western Peleng and one 
in the central isthmus; based on SRTM 90m Shuttle Radar Topographic Mission (Farr et al. 2007). 

Figure 2. Banggai Crow Corvus unicolor, Peleng, Indonesia, 26 January 2008 (Frangky Masala). 

Figure 3. Habitat of Banggai Crow Corvus unicolor, Peleng, Indonesia (Mochamad Indrawan) 



At 800-900 m western Peleng supports typical montane life forms such as lichens, 
pandans, epiphytes and bryophytes. The forest trees, though not necessarily obligate 
montane flora, include commercially valuable timber such as a Bombaceae, a Palaquium 



Mochamad Indrawan et al. 



156 



Bull. B.O.C. 2010 130(3) 



sp v various oaks (Lithoearpus spp.), a Calophylum sp., Canarium spp., a Syzigium sp. and a 
Podocarpus sp. The forests do not appear to offer much fruit availability. Common fruiting 
trees included a Myristica sp., a Syzigium sp. and an unknown tree species. 

Slash-and-burn cultivation is practiced, with ladangs of yam, taro and legumes. 

Climatic data from the nearbv mainland c .40 km away (Bubung-Luwuk meteorological 
station, unpubl. data 1996-2006; M. Sakev pers. comm.) suggest that the wet season 
generally occupies March to July, with 66-235 mm of rainfall. The dry season, which usually 
lasts September-November is marked bv monthly rainfall of 14-23 mm. Rainfall peaks 
mainly in June, with a smaller peak in March. 

On 2-7 October 2004, 12 September-11 October 2006, and 27 April-17 May 2007 
expeditions were mounted to locate the crow, by MI & I. Tinulele (IT); MI, YM, AM & FM; 
MI, YM, AM, FM & D. S. Katiandagho (DSK), respectively. Available evidence suggested that 
crows seen in the lowlands in 1981 (Bishop 1992), and subsequently found to be widespread 
(Indrawan et al. 1997) were probably Slender-billed Crows Corous erica, so searches were 
concentrated mainly at c. 500-900 m, especially above Tetendeng, in the montane west of 
the island (= Peleng Mountains) where a putative Banggai Crow was reported in 1991 
(Indrawan et al. 1997, Indrawan & Masala 2007). Rapid visits were also made to Alani, at 
c. 400-500 m, in the western Peleng Mountains (7 October 2004), Bombolon, in the eastern 
Peleng Mountains (01°13'39 /, S, 123°03'43"E; c.250 m; 11 October 2006), and to the southern 
Peleng Mountains between Ami and Kramat (01 o 18'48"S, 123°03 , 36 /, E and 01°17'44"S, 
122°59 7 18"E, respectively; 150-900 m; 1-7 May 2007). 

Further ecological data were gained during complementary field studies bv CBC, 
conducted mainly on the central peninsula of the island, especially at Bebe (Liang 
subdistrict, 01°26'69"S, 123°12'36"E; 320 m), on 29 October-2 November 2006, 24 July 2007, 
and 21-25 March 2008. 

Interviews with local farmers and hunters recruited as guides were also conducted to 
record additional anecdotal data concerning the species. 

Field identification and vocalisations 

Examination of Banggai Crows in the hand was possible as follows (location, observers 
and dates in brackets): one dead bird recently shot by two local hunters (YM & FM, Amos, 
14 May 2007), two specimens collected with assistance of local people (CBC, Bebe, 16 and 
22 August 2007) and deposited at the Museum Zoologicum Bogoriense, Cibinong (MZB); 
and a bird mist-netted, measured, photographed and released (YM & FM, Supit, 26 January 
2008). 

Field identification was based on plumage, size, as well as vocalisations and, to a lesser 
extent, behaviour and ecology. Examination of specimens and photographs revealed that 
the pale grey, rather large irides, the larger but relatively short bill, and very short wings 
and tail are also useful identification features (P. C. Rasmussen in lift. 2009). 

In the field, Banggai Crow appears a small crow with generally slatv black plumage 
and a dull brown sheen. Compared to Slender-billed Crow, it generally appears more 
streamlined (and thus smaller), although there is the potential for size overlap between 
the two. As observed twice in different locations, Banggai Crow when perched can even 
resemble Common Cicadabird Coracina tenuirostris in both shape and posture, though the 
cicadabird is smaller and has a less heavy bill. 

In good light, the mantle to shoulder possesses a dull brown sheen, and once a 
brownish sheen was also visible on the neck. Unlike Slender-billed Crow, the species lacks 
any readily visible violet / purplish gloss. Whereas the neck and underparts frequently 
appear slaty (i.e. dull), the head, throat, breast and abdomen are black, and in good light 



Mochamad Indrawan et al. 



157 



Bull. B.O.C. 2010 130(3) 



there can appear to be a darker facial mask. In the field, it has an apparently dark iris, and 
black heavy bill, with dark feet and claws. The primaries and trailing edge of the wings are 
slaty black. The tail is short, and when perched is almost wholly concealed by the folded 
wings; once, there appeared to be a gap of 1-2 cm between the edges of the folded wings 
and the tail. These proportions differentiate it from Slender-billed Crow, which according 
to Goodwin (1976) is relatively longer tailed. 

Our observations, especially of the brown tinge on the mantle and the tail proportions 
matched the species' depiction in Coates & Bishop (1997) quite closely. The quality of the 
brown sheen matched that of the syntypes at the American Museum of Natural History, 
New York (photograph courtesy of N. J. Collar), although the brown appeared more 
extensive and reached the underparts in the latter. The type description mentioned that 'the 
upperside has a fine purplish-blue, strongest on the wings and crown while the hind-neck, 
chest, breast, and abdomen (which are white in G. typica) are duller and more brownish 
slaty black' (Rothschild & Hartert 1900). Although the purplish-blue tinge was not readily 
observed in the field, once a dull blue-greenish tinge was observed to the shoulder. The 
dull brown sheen was less readily observed in juveniles. In two different individuals, the 
plumage appeared dark and even to have a slightly bluish sheen. 

The flight is swift, whistling and direct, resembling that of Piping Crow Corvus typicus 
(Goodwin 1976). Compared to Slender-billed Crow, Banggai Crow more likely keeps to the 
canopy and changes perches with a quick, agile manner. Like C. enca, the whirring of its 
wings can be heard when close, albeit less readily so, though it still serves as a good clue 
for detection in more closed forests. The species is highly active, rarely keeping still and 
thus appears nervous. Only three times were birds observed on exposed perches for 2-8 
minutes, always at distances of 100-300 m. 

Prolonged close observations are difficult, as the species is highly wary, especially if 
approached by observers. However, once a bird circled the observer while making harsh 
calls, as if mock-attacking an intruder, not unlike a Piping Crow mobbing stationary human 
observers (IT, 4 October 2004). 

Banggai Crow vocalises mainly in the morning, on leaving the roosts, as well as in the 
afternoons. Calls are uttered both perched and in flight. They are relatively vocal, e.g. on 5 
October 2006, at 06.00-07.00 h, two exchanged calls at a rate of up to 8-12 phrases / minute. 
Bouts may last up to c.20 minutes. Thus, calls are useful for detection. 

Birds in a group give a 3-4-note creaking whistle kruik, kruik, kruik, kruik (lasting 2-3 
seconds), which at close range sounds like nasal screams, and apparently serves as a contact 
call emitted both in flight and perched, and was termed type 1. Once, type 1 was emitted 
with the bill opened half its width. The main call also included a whistled double kriuuk 
...kruiik, which lasts c.0.8-1.5 seconds and is apparently given most frequently in flight. 
Although probably a shortened variation of type 1, it is termed type 2. Birds in threes and 
fours appear to more readily vocalise than in one or twos, giving type 1 and type 2 calls, 
respectively. Sometimes, type 1 calls are immediately followed by a melodious whistle, a 
two-note phrase initially descending then ascending, whu, weeeeeeee (lasting 2-3 seconds). 
This is the type 3 call, and occasionally it was initiated with a single metallic note, tong. 
Variations included strophes of creaking and trilling notes. Juveniles gave a repeated soft 
cawing wree-eek (c.0. 8-1.0 second), which may be a contact / alarm call, and is termed 
type 4. 

The whistled main calls and nasal screams of Banggai Crow are not unlike those of 
Piping Crow (IT pers. obs.; http:/ /homepage.mac.com/alanwilkinson/birding/sulawesi/ 
grf/pipingcrow.mov). But, those of Piping Crow are apparently higher pitched, more 
upslurred, with the last element ascending sharply and perhaps harsher. The type 3 call of 



Mochamad Indrawan et al. 



158 



Bull. B.O.C. 2010 130(3) 



3 



S-i .£3 



,2 CM LO 

^ s ^ 



oo 
K so 

„ ^ Sj" 

£ ^ it 1 

Si 5- ^ 

^5 £-i CM 



1 

Oh 

3 



c 

o 

cn '.+2 

O > 
'> CD 

<D cn 



3 


o 


o 


c 






X 






CS 


CO 




cn 


<_n 




CO 



■ &j ,0 
« cn 



> ^ 

3 



c 

o ^ 

'X en 

| s 

3 >^ 



v2 

C 
O 



cn 



O 



.5 _2 oo 

in • ■ 

8 | 
2 ^ -g* 

sal 

E £ Oh 



O 

o 

x> 60 



O v 

in CD 



co 



O "3 o 

13 en CM 
u 3 u 



S 2 

13 ?» 



"= 2 

be bfc 



.5 o 

cn bJO 



O in 
O 

Z 3 



9&I ^ 



o 

X 



>»■« '-J « 



oo w 



~ E 

LT - 

O CN 



X 

1 8 3 

O cu O 

oo o ra 

o m 0) 



o in 



oi in 

£ « 

x « 

Q ° X 



o o C2 







so 


2 


sO 




sO 


2 


sO 




SO 








o 




o 




o 




o 








o 




\ 

ON 




■\ 
OS 




ON 




On 




ON 


«a 






o 




O 

\ 




o 

\ 












in 
c 


< 


CN 




CN 




CN 
CN 




CM 
CN 


> 


CN 
CN 


> 



Mochamad Indrawan et al. 



159 



Bull. B.O.C. 



2010 130(3) 



3 

o 2 

-si 

CD _3 

§•* 

P fi 



O) 



OJ 3 QJ 



to 

(N ON 
O i< N 

5 o 



LO CO 
H ON 
« H CO 

£s2 



LO 

CO W 

bc<~o ^ 
© tH ■ "-O 

?H ^ 



e 

o 

bC 

gp s 

O o 

_Q LO 
O 

CO d 



to w 

< o ^ 



o o 



<u o 

7^ CD 

s £ 

CD O 

> "9 
3 03 

'57 S 
~ 2 

^£ 
II 



60 

T3 >^ CD 

B 1 & 



0> ^ 

E c <^ 



CD 3 



S T3 

qj y 

^£ 

T3 Oh 

OS CD 

c o 



2^ 

bC 

o ° 



3 3 

LO 
C 5-1 

0£ 



O QJ 



C cd 

S £ 



03 ;rj 
«- 

5-1 

C bC 
re £ 



5£ £ 



X3 >, 

QJ Oh 

> o 

o c 



2 -s 
u o 



c a) 



O > 

- o2 



bp ^"^O 

• S ■£ 5-h 

O r- f-i 

U « 2 



S .S ^ 



QJ QJ 



o 



U * 



o 

O .g 



5 6 



CO >M 



Mochamad Indrawan et al. 



160 



Bull. B.O.C. 2010 130(3) 



Banggai Crow also sounds like that of Piping Crow, although the last note is shorter than 
that of Piping Crow (IT pers. obs.). The calls of Banggai and Piping Crows differ from those 
of Slender-billed Crow in both the rest of the Banggai Islands and the nearby mainland, i.e. 
the southern part of Sulawesi's eastern peninsula, which is a simple caw ending sometimes 
in a falsetto (Indrawan et al. 1997). 

The calls of Banggai Crow, especially type 2, are imitated by Hair-crested Drongo 
Dicrurus hottentottus. However, the imitations are usually followed by strophes of typical 
drongo calls including harsh and high-pitched metallic note(s), and therefore can be 
separated with care. 

Results 

Distribution. — The species is well known to local people of western Peleng, who gave it 
a local name, the onomatopoetic 'Kuyak', and are confident in differentiating its calls from 
those of Slender-billed Crow, whose vernacular name 'Pak-pak' is also onomatopoetic. 
They gave a detailed description of its morphology ('smaller-sized crow') and behaviour- 
ecology ('montane forest bird'), suggested that it is locally abundant, and eventually helped 
us locate the bird's main haunts. In general, Banggai Crow occurs in forested areas, as well 
as mosaics of forest and cultivation, but not wholly deforested areas. The species' overall 
altitudinal range on western Peleng, 500-900 m, corresponds to the lower montane to upper 
montane forest zones (DSK & MI pers. obs.). 

Multiple encounters of birds in groups of up to four, especially at higher altitudes, are 
presented in Table 1. On the edge of forest at Luk Panenteng (01°13'00.7"S, 122°58'22.6"E; 
c.15 m), local farmers reported the species two days prior to our visit, but this is unconfirmed. 
Due to the brevity of our visit to the westernmost mountains, at Alani (7 October 2004), 
no sightings were made. However, local people are apparently familiar with the species. 
Slender-billed Crow was encountered mainly up to 400 m (with a single observation of one 
at c.900 m; cf. Mallo et al. 2010). Overall, westernmost Peleng is heavily deforested and it is 
unlikely that Banggai Crow is abundant there. The central and easternmost part of western 
Peleng is more forested, including at Luk Panenteng and Alul-Kramat near the south coast. 
Banggai Crow is well known to many local farmers and hunters there. 

Many sightings were obtained at the main study sites in the western part of western 
Peleng, namely at Laheme and Bobonggon. At Laheme, apparently three different pairs, 
each with two fledglings, were briefly encountered in forest at c. 700-900 m (AM & MI, 5 
October 2004). At Bobonggon, along a transect of c.2.6 km, at least 12 birds were detected 
(5 October 2004). Above Tetendeng village we therefore estimated 32-50 birds w ithin a 
radius of 3-4 km. A transect of cA km on the forested upper montane slope of Kramat-Alul 
suggested that c.5 groups (of 15-25 birds) may occur. 

A branch nester, nests of Banggai Crow were found at three locations (Table 2). Nest 
trees were tall forest species (c. 12-30 m tall) including Bombaceae, Calophyllum, Canarium, 
Palaquium, and other unidentified trees. Nest trees were either emergents or at least fairly 
isolated from their neighbours. Frequently, nests were placed on branches facing east. On 
a given tree 1-7 nests were found. Nests were always clustered in ones or tw os, frequently 
on main stems, and within the topmost two-thirds of the canopy. 

Discussion 

Relative abundance. — As initially indicated by local information, we found Banggai 
Crow to be locally abundant, especially in montane western Peleng (Tabic 1). Observations 
suggest thai Banggai Crow occurs mainly at higher altitudes (300-900 m) with heavy forest 



Mochamad Indrawan et al. 



161 



Bull. B.O.C. 2010 130(3) 



TABLE 2 

Nests of Banggai Crow Corvus unicolor found in 2006 and 2007. 



Date Location 
(observer 
name/s in 
brackets) 

22/09/06 Sabol 
(YM & FM) 

02/10/06 Momos 

06/10/06 

09/10/06 

(MI) 



Habitat Nest tree Diameter 
at breast 
height of 
nest tree 

Primary Pakquutm sp. 
forest 

Secondary Bombaceae c.20 cm 
forest 

Calophyllum c.15 cm 



No. of Nearby 
nests per nesting 



02/05/07 Alul-Kramat Primary Myristica sp. c.25 cm 

(MI) forest 

c.700-900m r ■ 1C 

Cananum sp. c.15 cm 

unidentified c.20 cm 



02/05/07 
(MI) 

02/05/07 
(SK) 

02/05/07 Kramat (near Primary 
(MI) summit) forest 



unidentified c.40 cm 
unidentified 
unidentified c.25 cm 



15/05/07 Amos 

17/05/07 

(YM & FM) 

29/06/07 Buta 
(via AM) Banggong 



c.800 m 

Secondary unidentified 10 cm 
forest 

unidentified 15 cm 
imknown unidentified - 



tree 

4 

3 
1 



tree 

None 

Two trees 
c.15 m 
apart 



None 



Two trees 
only c.7 m 
apart 



None 



Notes 



Apparently unoccupied 
nests of varying ages. 

No birds seen at the nests 
but local people indicated 
that one was last seen at 
a nest on 30 September 
and that one was seen on 
the same tree after we left. 
Nest revisited on 6 October 
(05.30-06.00 h) and 9 
October (18.00-19.00 h) but 
no birds seen. On 6 October, 
a crow was flushed from the 
canopy, but no conclusive 
evidence of nest being 
active. Direct inspection was 
not undertaken for fear of 
disturbance. 

Apparently unoccupied 
nests of varying ages. 



Apparently unoccupied 
nests of varying ages. 

Emergent tree. 



Apparently unoccupied 
nests of varying ages; 
emergent tree. 

Two trees Active nest tended by 2 
c.500 m birds, with 1 egg. 
apart Active nest tended by 1 
bird, with 3 egss. 



cover, which, except for a previous three-day visit by YM & LP (Indrawan et al. 1997), 
have been little explored hitherto. On western Peleng, Banggai Crow is not common in 
the lowlands (although CBC found otherwise in the central isthmus). Based on previous 
surveys, including an archipelago-wide search in 1991 (Indrawan et al. 1993, 1997), it is 
unlikely that the species occurs in any numbers elsewhere on the Banggai group's larger 
islands, or even away from montane western Peleng and the central isthmus, meaning that 
it has a very small range (Indrawan et al. 1997, Indrawan & Masala 2007, CBC 2008, Mallo 
et al 2010). 

Local hunters on western Peleng estimated up to 50 birds in a 3-4-km radius. However, 
care must be taken in extrapolating local densities across the species' available altitudinal 
range and habitat, because not all montane habitats support the crow. Based on our 



Mochamad Indrawan et al. 



162 



Bull. B.O.C. 2010 130(3) 



observations and local reports, we estimated that in the western Peleng Mountains Banggai 
Crow numbers 50-200 individuals, and YM estimated there may be close to 500 birds 
throughout western Peleng. 

While the crow nests in tall trees, at risk of clearance, we encouragingly observed 
relatively frequent fledglings and juveniles in 2004, 2006 and 2007, indicating active 
recruitment. 

Breeding biology. — Mostly unoccupied (probably abandoned) nests were observed 
in September-October 2006 and April-May 2007 (Table 2). The crow apparently nests at 
least once p. a., during and / or at the end of the wet season, i.e. during our 2006 and 2007 
surveys in August-September and in May-June, respectively. Despite that Lithocarpus spp. 
are among the locally dominant trees, their use for nesting was not seen by us, but a local 
person informed us that he had seen them being used once or twice (A. Lumano pers. 
comm.). It is unknown why these trees are not habitually used; perhaps their architecture 
or ant commensalism discouraged their use by Banggai Crows for nesting. 

The number of nests probably depends on the size of the nesting tree. Nests were of 
different ages. Based on the colour and relative decay of the dried sticks, the older nests 
appeared darker whereas recently constructed nests are whitish. It is unknown if different 
nests on the same tree were used simultaneously, but based on the age of the sticks 
used it seems more likely that they were consecutively constructed in different seasons. 
Furthermore, the closest nest trees were usually 100-200 m apart, suggesting the species is 
probably not a colonial nester. 

Nests were constructed of relatively sparse dry sticks and branches, in slightly 
depressed platforms or, occasionally, in the shape of a slightly inverted cone. The inner 
cup was more neatly lined with finer branches and twigs. The nest's form resembles that 
of Slender-billed Crow in the Banggai group (MI & YM pers. obs.), but the latter's nests are 
larger, and constructed of larger sticks. Nests of Banggai Crow resemble those of Green 
Imperial Pigeon Ducula aenea in size (but the latter is a platform of much sparser and thinner 
branches), whereas nests of Slender-billed Crow are as large as those of Brahminv Kite 
Haliastur indus but less cup-shaped than the latter (YM & MI pers. obs.). 

A local farmer in Alani reported finding a nest in a 'Kayu Tomoni' tree (scientific name 
unknown) which contained a single nestling (July 2004). A local report was also received of 
a nest with three eggs on 29 June 2007, at Buta Banggong (A. Maleso pers. comm.). 

Two active nests c.0.5 km apart were observed on 15 and 17 May 2007, at Amos (YM & 
FM). At the first, a bird was seen on the nest warily observing its surroundings. Its partner 
perched nearby, c.10 m away. During the 20-minute observation, the birds were almost 
silent, with the non-brooding individual calling just once. The second active nest was on a 
tree with six nests on it. When approached, a single Banggai Crow silently made circular 
flights twice around the nest, then left. Five minutes later a call was heard nearby. The two 
nests held one and three eggs, respectively, which were white, fairly heavily marked with 
faint purple to grey spots, and sparse bold speckles of brown. 

Detecting the species would probably be easier in July-September (post-wet season) 
when fledglings are barely able to fly and effectively restrict the movements of the adults. 
C. unicolor, like many other crows, is gregarious and apparently travels in family parties. In 
October 2004 and September-October 2006, juveniles were still with the adults. During one 
observation, on 4 October 2004, a fledgling was fed arthropods (Sunosol pers. obs.). 

Ecology. — The apparently regular distribution of Banggai Crow indicates that the species 
maintains group territories. However, our observations reveal that birds regularly descend 
the slopes and cover large areas, suggesting that their home range mav be extensive. Like 



Mochamad Indrawan et al. 



163 



Bull. B.O.C. 2010 130(3) 



most passerines, Banggai Crow is active during the early morning and late afternoon. Calls 
were heard just after sunrise, and two birds were seen in the canopy of tall isolated roost 
trees at a ladang abutting forest edge, at c.900 m (MI, 5 October 2004). Early morning is 
sometimes used for prolonged sunning and preening on bare branches (MI pers. obs.). In 
mid to late morning, the birds move in threes and fours from the roost areas to the forested 
lower slopes, to forage (MI pers. obs.). In the afternoon they gradually approach the roost 
sites in loose family parties, with more calling. When foraging, the crow frequently keeps 
to the upper canopy, whereas in the midday hours they stay in the mid canopy. Trees that 
are frequently used are those with some leaves. It roosts in emergents and tall trees in the 
forest and forest edge. The birds appear less inclined to cross wide open areas, especially 
compared to Slender-billed Crow. On the infrequent occasions that crows were observed 
flying above the canopy to cover longer distances, they followed valley contours. 

In the absence of farmers, C. unicolor may forage in ladang dry-land cultivation and 
perch just 1-3 m above ground (MI pers. obs.). However, in places where inhabitants use 
airguns, e.g. Kokolomboi, the crow did not appear 'habituated' and spent even less time on 
individual perches. At Bobonggon, where airguns are rare, they appeared to spend longer 
perched. At both sites, the local community attributed difficulties in making prolonged 
observations to the crow's intelligence and wariness (B. Maddus pers. comm.). 

It is sometimes possible to follow birds while foraging. At the forest edge in the 
subvillage of Kokolomboi, at c.500 m, one bird was encountered repeatedly at the same 
location. In another observation, a family of three, actively foraging and fluttering between 
trees appeared to remain in the same area for at least one hour in late morning. 

Given the relative scarcity of fruits, we hypothesise that the main food of Banggai Crow 
is probably arthropods, which may also explain its relatively smaller size. Local hunters 
report that the bird takes winged isopteran termites. 

Our general observations of behaviour, especially the whistled call, and preference for 
forested canopies, nervousness, as well as observer-mobbing suggest that the species is 
more closely related to C. typicns than to C. enca (see Mallo et al. 2010). 

Our data support BirdLife International's (2001) assessment that Slender-billed Crow 
has become dominant in more disturbed habitats, especially in the lowlands. The highest 
recorded altitude of C. enca, 400 m at Alani, appears to lie below that of Banggai Crow, and 
they may be altitudinally segregated. It is unknown, however, how much lower Banggai 
Crow ranged in prior decades. On western Peleng, Banggai Crow is reported to have 
occurred near sea level c.40 years ago (AM pers. obs). 

Threats. — Conversion of montane forest to meet the demand for agricultural land for 
the increasing human population constitutes one of the main threats to the species. Forest 
conversion to shifting cultivation is a potential threat because conversion will reduce 
available habitat for the Banggai Crow, but will also pave the way for Slender-billed Crow 
to extend its range. Although subsistence hunting occurs, and airguns are increasingly 
used, there is no systematic demand on the crow. Some farmers believe the crow is a minor 
pest because it is assumed to take poultry eggs. However, this seems very unlikely, given 
the crow's range, which calls for clarification of the crow's behaviour. 

Conservation. — The status of Banggai Crow was re-evaluated using data from our 
surveys. Based on known records and projected range within suitable habitat, the species 
has an estimated Extent of Occurrence (EOO) of c.494 and 209 km 2 in the west of the island 
and central isthmus, respectively. The area, extent and quality of habitat within this range 
is declining meaning the species is Endangered under criterion Bla+b(iii) (i.e. an EOO 
of <5,000 km 2 at a single location and declining). The survey also projected that the area, 



Mochamad Indrawan et al. 



164 



Bull. B.O.C. 2010 130(3) 



extent and quality of habitat are likely to decrease even further due to conversion and 
over-exploitation of resources. Because altitudinal range expansion by Slender-billed Crow 
could pose a direct threat to Banggai Crow, in situ conservation of the latter should include 
monitoring of Slender-billed Crow as a potential competitor 

Our limited interviews suggested that local community members could feel pride in the 
unique existence of Banggai Crow in their regions. Although the crow is considered a minor 
pest, several local farmers are interested in its conservation. Thus conservation measures 
should be designed as bottom-up processes beginning with local farmers (and hunters). 
Use of the vernacular name 'Kuyak' may instill local pride, and assist conservation efforts. 
To develop local awareness, local people should be involved in research, including into the 
crow's diet, in order to establish that it is not an egg predator. 

Habitat protection is of high priority. Reserves should be developed in conjunction 
with community-based forest protection, but are possible only through agreements 
between regional (=district) government and local communities concerning land use. It 
is more rational to realise community agreement, through traditional 'adat' laws, before 
establishing regional regulations to protect the forests. 

In the long run, ecotourism could contribute to the economic value of the species and its 
habitat. However, birdwatchers must be sensitive to local culture, especially as the crow's 
main range is surrounded by isolated communities whose members do not necessarily 
speak the national language. For instance, in our experience, even casual birdwatching 
can give rise to conflict, which could be counterproductive to the species' conservation. 
It is recommended that visits include not only birdwatching but also work with local 
stakeholders to ensure two-way communication and effective sharing of benefits, whether 
material, knowledge, or beyond. 

Acknowledgements 

The surveys in 2004-07 were funded by Nagao-Natural Environmental Funding (NEF), British Birds, and 
Zoologische Gesellschaft fur Arten- und Populationsschutz e. V. (ZGAP). We thank Prof. Somadikarta (Univ. 
of Indonesia) for sharing his vast knowledge of historical Indonesian ornithology. Dr Roland Wirth and 
Prof. Stephen Garnett encouraged a wider focus for this study. Dr Paul Sweet (AMNH).kindlv provided 
information on the syntypes. Jon Riley (OBC), Dr Nigel Collar (BirdLife International), Dr Paul Donald 
(RSPB), Guy Kirwan, Jeremy Bird and Murray Bruce made expert comments on an earlier draft. Prof. Pamela 
Rasmussen kindly provided her expert advice on crow taxonomy. The people of Tetendeng have always 
encouraged us to learn from their expertise of local natural history. For guidance and sharing knowledge in 
the field, we thank Aliman Lumano, Ardi See, Bisalung Maddus and Hepson Laaso. We thank Ms. Herlina 
(Celebes Bird Club) for information exchange in Palu. 

References: 

BirdLife International. 2001. Threatened birds of Asia: the BirdLife International Red Data book. BirdLife 

International, Cambridge, UK. 
BirdLife International. 2005. Corvus unicolor. In: 2006 IUCN Red List of threatened species, www.iucnredlist. 

org (accessed 23 May 2007). 
BirdLife International. 2008. Species factsheet: Corvus unicolor. www.birdlife.org/datazone (accessed 19 

September 2008). 

Bishop, K. D. 1992. New and interesting records of birds in Wallacea. Kukila 6(2): 8-35. 

Coates, B. J. & Bishop, K. D. 1997. A guide to the birds of Wallacea: Sulawesi, The Moluccas and Lesser Sunda 

Islands, Indonesia. Dove Publications, Alderley. 
CBC (Celebes Bird Club). 2006. Pengamatan burung di Pulau Peleng, Kepulauan Banggai, Sulawesi Tengah [Bird 

observations on Peleng Island, Banggai Islands, Central Sulawesi]. Cvclostvled manuscript. 
CBC (Celebes Bird Club). 2007. Laporari survey gagak Banggai Corvus unicolor di Pulau Peleng. Kepulauan 

Banggai, Provinsi Sulawesi Tengah [Observations on the Banggai Crow Corvus unicolor on Peleng Island, 

Banggai Islands, Central Sulawesi Province]. Cyclostyled manuscript. 
CBC (Celebes Bird Club). 2008. Pengamatan burling di Pulau Banggai dan Pulau Peleng. Kepulauan Banggai, 

Sulawesi Tengah [Bird observations on Banggai Island and Peleng Island, Banggai Islands, Central 

Sulawesi]. Cvclostvled manuscript. 



Mochamad Indrawan et al. 



165 



Bull. B.O.C. 2010 130(3) 



Davidson, P. J., Lucking R. S v Stones A. J., Bean N. J., Raharjaningtrah, W. & Banjaransari, H. 1994. Report 
of an ornithological survey to Taliabu, Indonesia: with notes on the Babirusa Pig. Final report to 
Indonesian Institute of Sciences, Directorate General for Forest Protection & Nature Conservation, 
BirdLife International-Indonesia Programme. 

Farr, T. G., Rosen, P. A., Caro, E., Crippen, R., Duren, R., Hensley, S., Kobrick, M., Paller, M., Roth, L., Seal, D., 
Shaffer, S., Shimada, J., Umland, J., Werner, M., Oskin, M., Burbank, D. & Alsdorf, D. 2007. The Shuttle 
Radar Topography Mission. Rev. Geophys. 45: doi:10.1029/2005RG000183. 

Goodwin, D. 1976. Crows of the world. Brit. Mus. (Nat. Hist.), London. 

Hartert, E. 1919. Types of birds in the Tring Museum: B. Types in the general collection. Novit. Zool. 26: 
123-178. 

ICBP. 1992. Putting biodiversity on the map: priority areas for global conservation. International Council for Bird 

Preservation, Cambridge, UK. 
Indrawan, M., Fujita, M. S., Masala, Y. & Pesik, L. 1993. Status and conservation of Sula Scrubfowl (Megapodins 

bernsteinii Schlegel 1866) in Banggai Islands, Sulawesi. Trop. Biodiver. 1: 113-130. 
Indrawan, M., Masala, Y. & Pesik, L. 1997. Recent observations from the Banggai Islands. Kukila 9: 61-70. 
Indrawan, M. & Masala, Y. 2007. Projeckt zum Schuctz kritische der Banggai-Krahe. Zool. Gesseschaft fur 

Arten-und Populationsschultz 23: 13-14. 
Jollie, M. 1978. Phylogeny of the species of Corvus. Biologist 60: 73-108. 

Mallo, F. N., Putra, D. D., Rasmussen, P. C, Herlina, Somadikarta, S., Indrawan, M., Darjono, Mallo, I. N., 
Sweet, P., Rahman, A., Raharjaningtrah, W., Masala, Y. & Verbelen, P. 2010. Rediscovery and taxonomic 
status of the Critically Endangered Banggai Crow Corvus unicolor on Peleng Island, Indonesia. Bull. Brit. 
Orn. CI. 130: 166-180. 

Masala, Y., Masala, F., Dwi Putra, D., Nur Mallo, F., Herlina, Maleso, A., Mopook, L., Maddus, B., 
Katiandagho, S. & Indrawan, M. 2008. Erste Fotos der Banggai-Krahe. Zool. Gesseschaft fur Arten-und 
Populationsschultz 24: 17. 

Rothschild, W. & Hartert, E. 1900. [A new species of crow]. Bull. Brit. Orn. CI. 11: 29-30. 

Stresemann, E. 1932. Die Vogelsamlung der Tring Museums ihr Aufbau und ihr Ende. Orn. Monatsb. 40: 
65-73. 

Sujatnika, Jepson. P., Soehartono. T. R., Crosby. M. J. & Mardiastuti, A. 1996. Indonesian biodiversity: the 
Endemic Bird Area approach. PHPA / BirdLife International-Indonesia Programme, Bogor. 

Vaurie, C. 1958. Remarks on some Corvidae of the Indo-Malaya and Australian region. Amer. Mus. Novit. 
1915: 1-13. 

White, C. M. N. & Bruce, M. D. 1986. The birds of Wallacea (Sulawesi, the Moluccas and Lesser Sunda Islands, 
Indonesia): an annotated checklist. BOU Checklist No. 7. British Ornithologists Union, London. 

Addresses'. Mochamad Indrawan & Yunus Masala, Indonesian Ornithologists' Union, KPP IPB, Baranangsiang 
IV, Blok B 63, Bogor 16173, Jawa Barat, Indonesia, e-mail: jamblang@cbn.net.id. Frangky Masala, 
Leffrendy Pesik & Daniel Simson Katiandagho, Desa Batu Putih, Bitung, Sulawesi Utara, Indonesia. 
Dadang Dwiputra, Fachry Nur Mallo & Idris Tinulele, Celebes Bird Club, Jalan M. H. Thamrin No. 63, 
Palu 94111, Sulawesi Tengah, Indonesia. Ayub Maleso & Sunosol, Dusun Tetendeng, Leme-leme Darat, 
Kecamatan Buko, Banggai Kepulauan, Sulawesi Tengah, Indonesia. Agus Salim, Jalan Palem Putri, 
Sektor V, Kav. 5-7, Bogor, Indonesia. 

© British Ornithologists' Club 2010 



Fahrv Xur Mallo et al. 



166 



Bull. B.O.C. 2010 130(3) 



Rediscovery of the Critically Endangered Banggai Crow 
Corvns unicolor on Peleng Island, Indonesia, part 2: 

taxonomy 

by Fahry Nur Mallo, Dadang Dwi Vutra, Pamela C. Rasmussen, 
Herlina, Soekarja Somarfikarta, Mochamad Indrawan, Darjono, 
Ihsan Nur Mallo, Paul Sweet, Abdul Rahman, Wahyu Raharjaningtrah, 
Y unus Masala & Philippe Verbelen 

Received 8 October 2009; final revision accepted 31 May 2010 



Summary. — Since its description in 1900, the Banggai Crow Coram unicolor has 
been known solely from two specimens of questionable provenance. The taxon has 
sometimes been considered a subspecies of Slender-billed Crow Corvns enca, but 
is currently treated as a Critically Endangered species, and has been considered 
possibly extinct. Recent field work has been undertaken in the Banggai Islands on 
crows thought to be C. unicolor, but the presence of C. enca there precluded certain 
field identification. The collection of two specimens on Peleng Island in 2007 enabled 
morphological comparisons with the svntvpes and unequivocally corroborates the 
continued existence of the Banggai Crow, as do recent field observations. Here 
we show that the 2007 Peleng birds are the same taxon as the svntvpes of C. 
unicolor, designate a lectotvpe, provide new data on the morphological and vocal 
characteristics of C. unicolor, and demonstrate that C. unicolor is certainlv not a 
subspecies of C. enca. We recommend that C. unicolor is best treated as a distinct 
species under the Biological Species Concept. 



Banggai Crow 



Corvns unicolor (Fig. 5) has been known for over a centurv onlv from 



two specimens. Although some sources have indicated that the tvpe specimens were from 
Banggai Island, one of the main islands in the Banggai Islands (Madge & Burn 1994, Dickinson 
2005; Fig. 1), the provenance of the svntvpes of C. unicolor has never been satisfactorily 
resolved, and indeed the species' continued 
existence has been doubted. Several authors 
have followed Vaurie (1958) in considering 
C. unicolor a subspecies of Slender-billed 
Crow C. enca, while Dorst (1947) treated C. 
unicolor as a subspecies of Piping Crow C. 
typicus. Although most recent authors (e.g. 
[nskipp et al. 1996) have followed Goodw in 
(1976) in considering C. unicolor a species, 
the taxonomic status of C. unicolor remains 
equivocal. 

Rothschild & Hartert (1900) described 
two unsexed crow specimens in a collection 
made bv natives on Banggai, Sula Islands' as 
a new species Gazzola unicolor. Subsequently 
Hartert attempted to fix one as the tvpe by 
tying a Rothschild type label on the specimen 
(M. LeCrov in litt. 2009), and he (Hartert 




Figure 1. Map of the Banggai Islands showing 
localities mentioned in the text. 



Fahry Nur Mallo et al. 



167 



Bull. B.O.C. 2010 130(3) 



1919) wrote that in 1900 the Tring Museum 'received a number of well-prepared skins, 
collected by natives, from Mr. van Renesse van Duivenbode. They were said to come from 
Banggai in the Sula group, east of Celebes' (Fig. 1), and that '[a]mong these skins were the 
two specimens of Gazzola unicolor . . . '. Hartert (1919) further claimed that '[t]hough the 
localities of skins from this source are often doubtful and incorrect, the locality must have 
been correct this time, as shown by certain other species and subspecies.' Meinertzhagen 
(1926) stated they 'appear to be 'trade' skins prepared by natives, neither having any reliable 
data attached'; however, the specimens are not trade skins but well-made skins prepared by 
Duivenbode's trained local collectors (M. LeCroy in litt. 2009). Neither of the two syntypes 
(AMNH 673966, 673967), which came to the American Museum of Natural History (New 
York) as part of the Rothschild Collection, have original collector's labels, and the date and 
locality of the two specimens is obscure. Although several collectors worked in the Banggai 
Islands (see Discussion), and a few recent observers have been there specifically seeking C. 
unicolor (although these observers did not venture high into the hill forests; Bishop 1992, 
King 2007), no further information about this enigmatic taxon has come to light since its 
description. This has led to speculation that the species might be extinct (Madge & Burn 
1994, Dickinson 2003). Owing to the lack of field observations and recent reports, Banggai 
Crow was assumed to have a very small population and was listed as Critically Endangered 
in the IUCN Red List of Threatened Species (BirdLife International 2006, 2007). 

Ecological studies (Masala et al. 2008, Indrawan et al. 2010; Celebes Bird Club unpubl.) 
and very recent independent observations by F. Rheindt and PV in West Peleng in March 
and April 2009 have revealed the contemporary survival of the Banggai Crow in western 
Peleng, especially in the sub-districts of Buko, Bulagi and Liang. These studies have resulted 
in the first data on the behaviour, ecology, vocalisations and conservation status of Banggai 
Crow (Indrawan et al. 2010). Field identification of Corvus unicolor was based on plumage, 
size and vocalisations, and to a lesser extent behaviour and ecology (Indrawan et al. 2010). 
Two specimens were collected (see below) and are now in the Museum Zoologicum 
Bogoriense, Cibinong (MZB). However, although never reported by early explorers, crows 
provisionally considered to be an undetermined subspecies of Slender-billed Crow C. 
enca are evidently now widespread in disturbed lowlands of the Banggai Islands, which 
has led to doubts about the identification and diagnosability of C. unicolor, and hence its 
continued survival. C. enca was first recorded on both the islands of Peleng and Banggai in 
1981 (Bishop 1992), and by 1991 was widespread with a nesting record as far south as the 
Bowokan Islands, between the main Banggai Islands and the Sula Islands (Indrawan et al. 
1997). The lack of historic records may indicate that C. enca has recently colonised following 
anthropogenic habitat conversion. However this hypothesis requires further research 
considering that older villagers in Western Peleng claim that 'the big lowland crow' was 
also present in their childhood when disturbed forest dominated low elevations on Peleng 
(Rheindt et al 2010). 

Given that identification criteria diagnosing these all-black birds in the field are not 
well known and in the absence of knowledge of the vocalisations of the crows on Peleng, 
it has heretofore been problematic to provide unassailable evidence of the continued 
existence of Banggai Crow. This is largely because no specimens of C. enca are known 
from the Banggai Islands and because variation within this highly polytypic, widespread 
species is poorly documented. C. e. celebensis is the widely distributed subspecies of C. enca 
on Sulawesi and some neighbouring islands, whilst C. e. mangoli has been little-studied 
and was described from just two specimens (Vaurie 1958). No other taxa of C. enca closely 
approach the Banggai Islands. Although birds assigned to C. enca now occur commonly on 



Fahry Nur Mallo et al. 



168 



Bull. B.O.C. 2010 130(3) 



the Banggai group, the lack of specimens means that we cannot yet definitively determine 
the subspecies there. 

In addition to the free-living C. unicolor studied (Indrawan et al. 2010), we studied and 
measured four individuals in the hand. Here we show that these, and birds photographed 
and sound-recorded, unquestionably represent C. unicolor. As the original description 
(Rothschild & Hartert 1900) was brief and based on just two specimens, and subsequent 
descriptive notes have either not added much or have been contradictory, we provide 
additional descriptive details on the basis of our new material. We also re-evaluate the 
historical record of this species and its taxonomic status. 

Methods 

Because of their rarity, neither the AMNH nor MZB specimens could be borrowed for 
direct comparisons. Hence, PCR visited AMNH prior to her visit to MZB to photograph and 
measure the syntypes, and to determine which characters could be used to distinguish C. 
unicolor from the many races of C. enca, almost all of which are well represented at AMNH. 
Because only C. e. celebensis and C. e. sulaensis are known from the region, these two taxa were 
subject to the most detailed comparisons. At MZB, therefore, indirect comparisons could 
be made using the same methods and measurements taken by the same observer. Colour 
comparisons were made by PCR using designations in Smithe (1975) under fluorescent 
lighting at both AMNH and MZB. Colour comparisons with Smithe (1975) also made of 
the MZB birds, by MI, produced similar results, but those by PCR are used here because 
she studied both the AMNH and MZB specimens. Evidently because of the circumstances 
of capture, the new specimens are missing some feathers, particularly around the head; 
some plumage areas are soiled, some areas (e.g. the throat) have ruffled feathers; and the 
underparts of one of the new specimens are largely concealed by the wings, making colour 
comparisons of these plumage areas difficult. 

Measurements were taken to the nearest 0.1 mm using digital callipers. Those of most 
specimens were taken by PCR, but a few C. e. mangoli specimens and two putative C. 
unicolor were measured by MI or, in the former case, taken from the literature (Vaurie 1958). 
Measurements taken included: longest rictal bristle; culmen from skull base; culmen ridge 
width, bill height, and bill width at distal edge of nares; gape width; wing (flattened); distance 
between tip of longest primary-covert and tip of primary 1 (pi; outermost); shortfalls from 
wingpoint of folded wing of each primary (ppl-10); tarsus; hindclaw (excluding scute); tail 
(from insertion point between central rectrices); and tail graduation (distance between tip of 
central rectrix and tip of outermost rectrix of folded tail). Univariate summary statistics and 
Principal Component Analysis were made using Systat 8.0. Principal Components Analysis 
(PCA) was used to determine which variables best explain variabilitv in the data and which 
best separate the two species. For purposes of the PCA, specimens of C. c. celebensis and C. 
e. mangoli (//=4), as well as the two smallest races of C. enca, namely C. c. pusillus {n=3) and 
C. e. samarensis (n=l), were included in the analysis to determine if proportional differences 
exist in C. unicolor vs. disparate races of C. enca. 

Field recordings were made by PV using an Edirol R-09HR field recorder with a 
Sennheiser ME-66 directional microphone, and sonograms were prepared using Raven 
Pro 1.3 (Cornell Laboratory of Ornithologv). Field photographs were taken by PV using a 
Canon Eos 40D with a Canon EF 100-i00 IS 4.5-5.6 telephoto lens. 



Fahry Nur Mallo et al. 



169 



Bull. B.O.C. 2010 130(3) 



Results 

New specimens and records. — On 24 July 2007, two C. unicolor were taken alive at Bebe 
sub-village by Celebes Bird Club (CBC), but they perished on 16 and 22 August 2007 (an 
adult female and adult male respectively) and were then prepared as specimens. These 
were later donated by CBC through MI to MZB, so there are now four Banggai Crow 
specimens in museum collections worldwide (Table 1). Prior to the collection of the MZB 
specimens, a bird shot by a local hunter on 14 May 2007, in the vicinity of Amos village 
(Buko sub-district, 01°16'28.1"S, 122°53 , 33.7"E; 697 m) was measured and photographed by 
YM & F. Masala, but the bird could not be confiscated, and the measurements, which were 
made hurriedly, could not be double-checked. The wing measurement of this bird (which, 
as visible in photographs, is otherwise typical of C. unicolor) is so long that it must either 
have been measured or recorded erroneously. On 26 January 2008, another bird was caught, 
measured, photographed and released in the vicinity of Supit village (Buko sub-district), 
very near Amos. 

While in the forested hills of western Peleng (in the vicinity of Tataba, on 22-31 March 
2009 and 2-5 April), PV & F. Rheindt (during the former dates only) encountered several 
pairs and small groups of 2-A birds at altitudes of 650-900 m. 

Comparison of new specimens with syntypes of C. unicolor. — Colour comparisons of 
the MZB specimens with the AMNH syntypes are presented in Table 2. For those plumage 
areas in which comparisons were possible, colour differences were all minor. For soiled and 
/ or ruffled plumage areas that did not lend themselves to close comparison, differences 
between the MZB and AMNH specimens were not apparent. Both of the new specimens 
show strongly grey feather bases, which in a few areas were judged to be of a slightly darker 
shade than in the syntypes (bearing in mind that direct comparisons were impossible). 
The two MZB Banggai Crow specimens from Peleng Island match the original description 
(Rothschild & Hartert 1900) in that the base of the feathers were strongly grey, rather than 
bright white as in C. typicus, C. e. celebensis and C. e. mangoli. The main colours of C. unicolor 
are Sepia (219), Sepia (119) and Dark Grayish Brown (20) (Smithe 1975), with a bluish sheen 
(Cyanine Blue 74) in more intense light (Table 3). 

In measurements, the new MZB C. unicolor specimens clearly fit within the very limited 
range of variation of the two AMNH syntypes (Table 3). All the preserved specimens and 
the released individual share the diagnostically short wing; however, as mentioned above 

TABLE 1 



Specimens of Banggai Crow Corvus unicolor in existence in the world's museums as of 2009. 



Museum 


Number 


Sex 


Locality 


Date 


Elevatior 


Collector(s) 


Field No. 


AMNH 


673966 


? 


Sula Islands (Banggai) 


1900 or earlier 


? 


Unknown; sent by 
Duivenbode 


None 


AMNH 


673967 


7 


(Banggai,) Sula Islands 


1900 or earlier 


? 


Unknown; sent by 
Duivenbode 


None 


MZB 


31.255 


F 


Bebe sub-village, Tombos 
village, Liang sub-district, 
Banggai Islands, Central 
Sulawesi (01°26'69.0"S, 
123°12'36.27"E) 


Captured 24 
July 2007, died 
16 August 2007 


320 m 


F. N. Mallo, D. Dwi 
Putra, Herlina, A. 
Rahman, I. N. Mallo 


01 


MZB 


31.256 


M 


Bebe sub-village, Tombos 
village, Liang sub-district, 
Banggai Islands, Central 
Sulawesi (01°26'69.0"S, 
123°12'36.27"E) 


Captured 24 
July 2007, died 
22 August 2007 


320 m 


F. N. Mallo, D. Dwi 
Putra, Herlina, A. 
Rahman, I. N. Mallo 


02 



Fahrv Nur Mallo et al. 



170 



Bull. B.O.C. 2010 130(3) 



TABLE 2 

Colour comparisons betw een s\Titypes and new- specimens of Banggai Crow Comis unicolor. 
Colour names follow Smithe (1975). 



Area 

central crown 



ear-coverts 
throat 

centre of nape 
central mantle 

scapulars 

side of neck 

tertials 

uppertail-coverts 

uppertail surface 

central breast 

central belly 

undertail-coverts 

nape feather bases 

mantle feather 
bases 



uppertail-coverts 
feather bases 

central breast 
feather bases 
central belly 
feather bases 



AMNH 67396c 
black with slight 
iridescence closest to 
Color 173, Indigo blue 

slightly glossy Color 
S9Jet*Black " 
slightly glossv Color 
89 Jet Black 
dark brown. Color 20, 
Dark Grayish Browm 

slightly glossy black, 
closest to but slightly 
blacker than Color 82, 
Blackish Neutral Gray 
black with slight 
iridescence closest to 
Color 173, Indigo Blue 

between Color 119, 
Sepia and Color 219, 
Sepia; darker than 219 
but warmer than 119 
black with slight 
iridescence closest to 
Color 173, Indigo Blue 
closest to Color 20, 
Dark Gra\ish Brown 



slightly glossy Color 
82, Blackish Neutral 
Gray 

slightly glossy Color 
82, Blackish Neutral 
Gray 

slightly glossy Color 
82, Blackish Neutral 
Gray 

Color 82, Blackish 
Neutral Gray 

medium grey. Color 83. 
Light Neutral Grav 
medium grey (darker 
than nape base colour) 
Color 84, Medium 
Neutral Gray 
medium brownish 
grey. Color 79, 
Glaucous 

rather pale grev Color 
86, Pale Neutral Gray 
medium grey. Color 83. 
Light Neutral Gray 



SIN! 



slightly glossy Color 

shghtly glossy Color 

dark browTv Color 20, 
Dark Grayish Brown 
browner than AMNH 
673966, Color 119, 



slightiy glossy- Color 
119, Sepia 



between Color 119, 
Sepia, and Color 219, 
Sepia; darker than 219 
but warmer than 119 



slightly glossv Color 
89,Jet~Black 

feathers too ruffled or 
missing to judge 
dark brcwrish black 
Color 119, Sepia 
matte black, Color 89, 
let Black 



V:: Color 32 Blackish 
Neutral Gray; right 
Color 119A, Hair 
Brown 

brownish black, Color 
11?. Seria 



slightly glossy Color Color 82, Blackish 
119 , Sepia Neutral Gray 



closest to Color 20, 
Dark Gra\ish Brown 



black, between Color 
82, Blackish Neutral 
Gray and Color 89, Tet 
Black 

slightly glossy Color 
82, Blackish Neutral 
Gray 



slight! v glossv Color 
82, Blackish Neutral 
Gray 

Color 19. Dusky Brown slightly glossy Color 
82, Blackish Neutral 
Gray 

Color 19, Dusky Brown black, between Color 
82, Blackish Neutral 
Gray and 89 Jet Black 



Color 82. Blackish 
Neutral Grav 

medium grey. Color 83. 
Light Neutral Gray 
medium grey (darker 
than nape base colour) 
Color 84. Medium 
Neutral Gray 
Color 84, Medium 
Neutral Gray 

rather pale grey Color 
86. Pale Neutral Gray 
medium grey. Color 83. 
Light Neutral Gray 



MZB 31.25c" 

too many feathers 
crossing :c hidge 

slightly glossy Color 
89 Jet Black 
feathers raffled :r 
crossing :c ; od;e 
dark browTiish black, 
Color 119, Sepia 
matte black. Color 89, 
Jet Black 



Cclrr 3r ~ez Black 



black, between 82, 
Blackish Neural Grav 
and 89 Jet Black 

Color 89, Jet Black 



black, between Color 
82 , Blackish Neutral 
Gray and Color 89, Jet 
Black 

between Color 82, 
Blackish Neutral Gray 
and 89, Jet Black 

not yisible due to 
preparation style 

Color 89 Jet Black 



Color 89, Jet Black 



Color 82, Blackish 
Neutral Gray 

medium grey. Color 84, medium grey, Color 84, 
Medium Neutral Gray Medium Neutral Gray 



medium grey (same 
as nape base colour) 
Color 84, Medium 
Neutral Gray 
medium brownish 
grey. Color 79, 
Glaucous 
Color 85, Light 
Neutral Gray 
Color 84, Medium 
Neutral Gray 



medium grey (same as 
nape base colour) Color 
84. Medium Neutral 
Gray 

medium brownish 

grey, Color 79, 

Glaucous 

not \isible due to 

preparation style 

Color 83. Dark Neutral 
Gray 



Fahry Nur Mallo et al. 



171 



Bull. B.O.C. 2010 130(3) 



TABLE 3 



Measurements (rnm) of all known and putative Banggai Crow Corvus unicolor individuals. 



Measurement 


AMNH 


AMNH 


YM* 


MZB 31.255; 


MZB 31.256; 


YM* 




673966 


673967 


(Bobonggon, 


CBC 


CBC 


(Sapit, 




(syntype) 


(syntype) 


14 May 2007); 


(Bebe, 


(Bebe, 


26 January 








specimen not 


16 August 


22 August 


2008); released 








saved 


2007) 


2007) 




Longest rictal bristles 


15.2 


15.6 


_ 


11.3 


10.4 


_ 


Culmen from skull base 


46.1 


46.2 


- 


45.4 


48.0 


_ 


Culmen ridge width at 


7.3 


6.3 


_ 


7.1 


6.8 


_ 


distal edge of nares 














Gape width 


20.6 


18.5 


_ 


c.21.5 


20.1 


_ 


Bill height at distal nares 


17.7 


17.0 


15.0 


16.3 


17.4 


_ 


Bill width at distal nares 


13.9 


12.9 


_ 


13 


12.2 


_ 


Wing length (flattened) 


205 


210 


270** 


206 


206 


209 


Longest primary-covert 


70 


76 


_ 


74 


77 


_ 


to PI tip 














PI shortfall 


76 


75 


- 


72 


72 


- 


P2 shortfall 


30 


26 


- 


28 


27 


- 


P3 shortfall 


7 


5 


- 


7 


6 


- 


P4 shortfall 


2 


0 


- 


3 


2 


- 


P5 shortfall 


0 


0 


- 


0 


0 


- 


P6 shortfall 


7 


9 




9 


11 


- 


P7 shortfall 


26 


26 




28 


28 




P8 shortfall 


44 


37 




40 


40 


_ 


P9 shortfall 


54 


51 


- 


48 


49 


- 


P10 shortfall 


59 


56 




58 


55 




Tarsus length 


45.9 


40.9 


45.0 


41.6 


42.1 


45.0 


Hindclaw 1 


15.4 


14.5 




11.8 (very 
worn) 


13.1 




Tail (from insertion) 


103 


108 




111 


114 


100 


Tail graduation 


6 


5 




6 (slightly 
worn) 


9 





^Specimen not measured by PCR 
^^Measurement almost certainly incorrect; see text 



the hunter-killed bird that was not preserved was recorded as having a much longer wing. 
Photographs of the latter bird, however, show that it shares other attributes of C. unicolor, 
in particular the grey feather bases. 

The irides of the living C. unicolor were greyish white, as clearly shown in photographs 
taken of them while alive. In strong contrast, adult specimens examined at MZB of C. enca 
subspecies for which label data were recorded had the irides brown (two C. e. compilator, 
six C. e. celebensis) or coffee-brown (one from Kalidupa Island, another from Buton Island); 
dark blue (one C. e. compilator), or blue-black (two C. e. compilator). A young juvenile C. 
e. celebensis had the irides grey. At AMNH, most C. enca labels with iris colour indicated 
they were dark brown, while two were grey-brown, one light reddish brown, and one red 
(perhaps in error). 

As regards age categories, AMNH 673966 is an adult based on its rounded rectrices, 
with fault bars that do not line up, and its less pointed / acute outer primaries 2-3 
(numbered from outside inwards) than AMNH 673967. The latter (AMNH 673967) may be 
an immature, as its posterior underparts are slightly browner than in AMNH 673966; its 



Fahry Nur Mallo et al. 



172 



Bull. B.O.C. 2010 130(3) 



TABLE 4 

Measurements (mm) of specimens of Banggai Crow Corvus unicolor and geographically proximate races 
of Slender-billed Crow C. enca, presented as mean ± SD (n). Primary shortfalls are tips of each primary 
(numbered ascendently) to wingpoint of folded wing. 



Measurement 


C. unicoloY (all) 


C. enca celebensis 


C. cncci mangoli* 


Longest rictal bristles 


13.1 ± 2.6 (4) 


21.5 ± 2.0 (23) 




Culmen from skull base 


46.3 ± 1.2 (4) 


54.4 ± 2.8 (17) 


55 .4 ± 2.8 (7) 


Culmen ridge width at distal edge of 


6.9 ± 0.4 (4) 


7.0 ± 0.5 (19) 


6.6 ± 0.5 (4) 


nares 








Gape width 


19.7 ±1.1 (3) 


23.0 ± 1.4 (19) 


22.6 ± 1.7 (4) 


Bill height at distal nares 


17.1 ± 0.6 (4) 


17.7 ± 0.7 (16) 


18.1 ± 1.7 (2) 


Bill width at distal nares 


13.0 ± 0.7 (4) 


14.1 ± 0.6 (19) 


13.6 ± 1.0 (4) 


Wing length (flattened) 


206.7 ± 2.2 (4) 


279.6 ± 11.2 (18) 


274.4 ± 13.4 (7) 


Longest primary-covert to PI tip 


74.2 ± 3.1 (4) 


114.5 ± 6.0 (15) 


101.8 ±4.8 (4) 


PI shortfall 


66.2 ± 14.2 (4) 


93.6 ± 6.6 (13) 


99.0 ± 9.9 (4) 


P2 shortfall 


27.8 ± 1.7 (4) 


29.1 ± 3.8 (13) 


37.7 ± 2.6 (4) 


P3 shortfall 


6.3 ± 0.9 (4) 


4.4 ± 2.3 (13) 


8.8 ± 2.6 (4) 


P4 shortfall 


1.8 ± 1.3 (4) 


0.3 ± 0.8 (13) 


1.2 ± 2.5 (4) 


P5 shortfall 


0(4) 


1.3 ± 1.2 (12) 


1.8 ± 1.3 (4) 


P6 shortfall 


9.0 ± 1.6 (4) 


13.1 ±4.0 (12) 


14.8 ± 2.8 (4) 


P7 shortfall 


27.0 ±1.2 (4) 


41.2 ± 6.3 (10) 


44.0 ± 5.4 (4) 


P8 shortfall 


40.2 ± 2.9 (4) 


61.3 ±8.6 (8) 


58.5 ± 6.4 (2) 


P9 shortfall 


50.5 ± 2.6 (4) 


75.0 ± 9.7 (8) 


71.0 ± 7.1 (2) 


P10 shortfall 


57.0 ± 1.8 (4) 


85.0 ± 9.9 (8) 


82.5 ± 10.6 (2) 


Tarsus length 


42.6 ± 2.2 (4) 


52.3 ± 2.4 (17) 


48.5 ± 2.3 (4) 


Hindclaw 1 


13.7 ± 1.6 (4) 


17.3 ± 0.9 (18) 


10.6 ± 0.7 (4) 


Tail (from insertion) 


108.9 ± 4.9 (4) 


134.0 ± 5.6 (19) 


127.7 ± 9.5 (7) 


Tail graduation 


6.0 ± 2.2 (4) 


8.2 ±5.1 (11) 


5.8 ± 2.8 (4) 



*some measured by M. Indrawan and C. Vaurie; includes specimens from Taliabu Island. 



tarsi, toes and claws are paler than in 
AMNH 673966, and the fault bars on 
its rectrices line up; however, its age 
class must be considered uncertain. 
MZB 31.255 is probably a full adult, 
although it has brownish patches in 
the right scapulars and inner base of 
the left central rectrices and associated 
coverts (possibly induced by chemical 
means). It lacks the brownish wash 
over the cape of the two AMNH 
specimens, which might be due to 
slight foxing (M. LeCroy in litt. 2009), 
a type of light-induced post-mortem 
change from black to reddish-brown; 
however, a brownish-tinged cape 
is apparent in some living birds 
photographed by PV. MZB 31.256 
is clearly a full adult, lacking any 



TABLE 5 

Summary results from Principal Components Analysis of 
Banggai Crow Corvus unicolor 
and Slender-billed Crow C. enca. 



Measurement 


Factor 1 


Factor 2 


Nasal feather length 


0.86 


0.03 


Culmen length from skull 


0.93 


-0.12 


Culmen ridge width from distal nares 


0.39 


0.70 


Bill height from distal nares 


0.61 


0.44 


Bill width from distal nares 


0.67 


0.42 


Wing length 


0.92 


-0.28 


Tarsus length 


0.93 


0.01 


Hindclaw length 


0.89 


-0.12 


Tail length 


0.78 


-0.49 


Variance explained (eigenvalue) 


5.65 


1.21 


% total variance explained 


62.82 


13.43 



Fahry Nur Mallo et al. 



173 



Bull. B.O.C. 2010 130(3) 



brownish areas, and with unworn, rounded 
rectrices and outer remiges. Neither MZB C. 
unicolor specimen shows evidence of typical 
juvenile Corvus characters such as fluffier- 
textured feathers on the nape, mantle and / 
or vent; brownish overall colour; or distinctly 
paler areas on the bill or tarsi. 

The conspicuous, broad bare fleshy 
eye-ring of the two MZB specimens was 
dark greyish in life, and is blackish in the 
specimens. The bill, both in life and in the 
specimens, is completely black (Color 82, 
Blackish Neutral Gray; Smithe 1975). The 
rictal bristles are stiff and cover the base of 
the culmen and part of the nares. The feet are 
dark Blackish Neutral Gray, with a metallic 
sheen, both in life and in the specimens. 




Figure 2. Plot of Banggai Crow Corvus unicolor and 
Slender-billed Crow C. enca specimen factor scores 
on Factors 1 and 2 from Principal Components 
Analysis. Factor 1 is a strong size axis, on which only 
culmen ridge width is negatively correlated, and 
Factor 2 is a shape axis, contrasting bill dimensions 
other than length with overall size. 



Comparisons with Corvus enca celebensis 
and C. e. mangoli. — Compared to C. unicolor, 
C. enca celebensis is distinctly larger and 
especially longer winged (Table 4, Fig. 2). The 
bill of C. e. celebensis is somewhat variable in 
length but is not as markedly different in size 

and shape from that of C. unicolor as are some specimens of C. e. mangoli, as both the former 
have proportionately short, heavy bills. While C. e. celebensis and C. e. mangoli have long, 
bushy narial bristles and relatively well-developed throat hackles, the bristles are reduced 
(see Table 4) and the hackles are not evident in C. unicolor. In colour, C. unicolor specimens 
are much less purple-glossed above than on C. e. celebensis. The little gloss that C. unicolor 
has above is bluer than in C. e. celebensis. Differences in the shade of black on the underparts 
between C. e. celebensis and C. unicolor are not constant. The feather bases of C. e. celebensis 
are brilliant white over the entire body, while those of C. unicolor are strongly grey. 

Compared to C. unicolor, C. e. mangoli is noticeably larger and the bill is relatively 
more slender and much longer (Table 4), although bill length is quite variable if birds from 
Taliabu are included. The plumage colour was strikingly different; compared to C. unicolor, 
C. e. mangoli has a paler, slatier tone vs. darker and blacker in C. unicolor. As in C. e. celebensis 
but very unlike C. unicolor, the bases of the blackish feathers in C. e. mangoli were white. 

Compared to specimens of C. e. celebensis and C. e. mangoli, as well as the two 
smallest races of C. enca, C. e. pusillus and C. e. samarensis, it is clear that C. unicolor differs 
proportionally from these disparate taxa (Fig. 2, Table 5). It is smaller overall than any of 
the other taxa, with a relatively heavy, short bill. 

Field identification. — Although specimens of C. unicolor do resemble small C. enca, 
and hence it might seem that field identification of these all-black birds would be difficult, 
this is not the case (see Fig. 3). The pale grey irides of C. unicolor had not previously been 
suspected, as the syntypes bear no information on soft-part colours. In photographs of live 
birds, Banggai Crows also appear very large-eyed, which in combination with the pale 
irides should aid field identification; while juvenile Slender-billed Crows may show a grey 
iris, this presumably is still distinctly darker than the iris of C. unicolor, although further 
substantiation is needed. Photographs in life also show that the Banggai Crow's massive 



Fahrv Nur Mallo et al. 



174 



Bull. B.O.C. 2010 130(3) 



(hardly 'insignificant', contra Madge & Burn 1994) but relatively short hill is an obvious 
identification feature, especially given the birds' small overall size. However, to appreciate 
these characters close views are necessary, and the species' nervous behaviour may make 
prolonged observation at close quarters difficult. 

The very short wing and tail of Banggai Crow are also noticeable in the field and give 
the species a very different appearance in flight compared to C. enca. C. unicolor has a very 
distinctive fast fluttering flight which differs from the typically much slower wingbeats of 
C. enca. 

Banggai Crow and Slender-billed Crow appear to have different habitat preferences. 
While C. enca seems to be largely restricted to open areas in coastal lowlands up to 300 m, 
Banggai Crow is found at higher elevations and in less-disturbed forest. 

C. unicolor is a very vocal species and is often heard before being seen. While C. enca 
on Peleng typically utters a series of cawing notes (Fig. 4), the call of C. unicolor is much 
more reminiscent of the shrill screeches of C. typicus, being usually repeated 3—4 times, and 
sometimes followed by a loud whistle (Fig. 4). Therefore, when crows are heard on Peleng, 
field identification is straightforward. 

Discussion 

With these unequivocal specimens, photographs and recordings from Peleng Island, 
there can be no more doubt about the current survival and identity of the Banggai Crow. 

Regarding the questionable nature of the locality data of the svntvpes of C. unicolor, in 
the first place, the Banggai Islands are not now generally considered part of the Sula Islands. 
However, at least 24 of the specimens in the AMXH from the Banggai Islands are labeled 
as if the latter are a group within the Sula Islands, making it clear that this treatment is 
simply an historical artefact and should not be seen as casting doubt upon the provenance 
of the svntvpes within the Banggai Islands. On the other hand, L. D. W. A. van Renesse van 
Duivenbode, a planter and merchant based on Ternate (near Halmahera) whose specimens 
are from various islands through Ternate in 1860-81, is not known to have personally 
collected in the Banggai Islands, and (as alluded to by Hartert 1919), his collection has been 
considered to contain unreliable records (see also White & Bruce 1986). Although Hartert 
(1919) stated that the locality in this case must have been correct, as shown bv other species 
and subspecies, he did not indicate which other taxa these were and we have not been able to 
verify this based on listings of AMNH holdings. While Meinertzhagen (1926) identified the 
C. unicolor syntypes as probable trade skins, he provided no rationale for this and appears 
to have groundlessly equated the fact that these are native-prepared skins with their being 
trade skins. Some authors have indicated the Banggai Islands (the group as opposed to the 
island) as the provenance (Blake & Vaurie 1962, Goodwin 1976), but curiously none of the 
above suggested Peleng, the largest of the Banggai Islands, as the home of this species. 

Other attempts to elucidate the circumstances of collection of C. unicolor have been 
inconclusive. Bruce (1986) stated that one of Rothschild's collectors, H. Kiihn, worked in the 
Banggai Islands in 1884-85, and Coates & Bishop (1997) concluded, perhaps on this basis, 
that the species was known from 'two specimens from an unspecified island in the Banggai 
archipelago, collected during 1884-1885.' However, the AMNH collection (which now 
holds almost all of Rothschild's bird skins) appears to possess no Kiihn specimens from 
the Banggai Islands. Collecting in the Banggai islands, including Peleng, was undertaken 
in r.1892 and in May-August 1895 by C. W. Cursham (Eck 1976, White & Bruce 1986), with 
c.400 of Cursham 's specimens from the Banggai Islands held in Dresden at the Staatlichen 
Museums fur Tierkunde (SMTD) (Eck 1976: 88); 84 Cursham specimens from Banggai Island 
and 72 from Peleng Island are at AMNH; and still others are in Berlin at the Museum fur 



Fahrv Nur Mallo et al. 



175 



Bull. B.O.C. 2010 130(3) 




Figure 3. Photographs of living Banggai Crows Corvus unicolor (left column) and Slender-billed Crows C. enca 
(right) from Peleng Island. All Banggai Crow photographs were taken in the hill forests of western Peleng 
(650-900 m) near Tataba town; upper left on 23 March 2009, middle left 4 April 2009, and bottom left 23 
March 2009. All Slender-billed Crow photographs were taken in an agricultural area near Salakan town in 
eastern Peleng on 6 April 2009. All photographs by P. Verbelen. 



Naturkunde. Thus, although Cur sham was evidently the sole major collector in the Banggai 
Islands prior to the description of C. unicolor, it is unclear whether Duivenbode could have 
obtained the two syntypes from him, and it seems unlikely that Cursham would not have 
presented them directly to Rothschild rather than sending them to Duivenbode. Following 
the description of C. unicolor, a few specimens were collected in the Banggai Islands by W. 
Kaudern in 1920 and a Mr Van Den Bergh in 1932 (Bishop 1992). Finally, in July-August 
1938, J. J. Menden collected birds on Peleng (Eck & Quaisser 2004). None of these collectors 
obtained any further crows in the Banggai Islands. 

All this uncertainty has naturally given rise to the question of whether the syntypes 
of C. unicolor were actually collected in the Banggai Islands. Although the type locality of 
Banggai Crow will probably never be known with certainty, the rediscovery of Banggai 
Crow on Peleng Island confirms that this distinctive taxon does occur in the Banggai 
Islands, although perhaps not on Banggai Island itself. Of course, one possibility is that 
the syntypes did come from Banggai Island and that the species is now extirpated there. It 



Fahry Nur Mallo et al. 



176 



Bull. B.O.C. 2010 130(3) 








- — - jfc 






■ |i 


| M 


?■ f: , 




:. 1 JJ -M M 5 S « « %s * ft » ft A 



j — »•-— — — • tffr- •••• iff tt| 



i 1 




fr 


It f 


it 













Kit 





Figure 4. Sonograms of vocalisations of Banggai Crow Corru> unicolor (a, b), Piping Crow C. typicus (c-e) and 
Slender-billed Crow C. encfl (f) on Peleng. All recordings made by F. Verbelen, other than c by D. Farrow (XC 
19806), d, e by P. Noakes (XC 22446, 22447). 



Fahry Nur Mallo et al. 



177 



Bull. B.O.C. 2010 130(3) 




seems more likely that the type specimens 
came from Peleng Island, but further study 
of habitat and altitudinal requirements may 
provide evidence on the matter. There is no 
evidence that it occurs in the Sula Islands, so 
the original type locality was almost certainly 
due to prevailing usage and / or informal 
grouping of these two geographically close 
island groups. 

Hartert (1919) did not distinguish 
between the two syntypes, but AMNH 
673967 was clearly his intended type, as he 
affixed to it a Rothschild type label which 
now reads '{Synjtype of Gazzola unicolor R & 
H, (Banggai,) Sula Islands (Nat. Coll.)'. That 
specimen was therefore catalogued as the 
type when the Rothschild Collection came 
to AMNH, and was segregated with the 
type specimens, while the second syntype 
was only later added to the AMNH type 
collection (M. LeCroy in lift. 2009). The label 
of AMNH 673966, written by M. LeCroy, 
bears the data 'Syntype of Gazzola unicolor 
Rothschild and Hartert 1900, BBOC 11:29'. 
We hereby designate AMNH 673967 the 
lectotype of Gazzola unicolor in order to 
remove the ambiguity inherent in the original 
description. AMNH 673966 becomes the 
paralectotype. 

The species-level taxonomy of the 
Banggai Crow has long required clarification. 
In the original description of C. unicolor, 
Rothschild & Hartert (1900) characterise the 
species as '[l]ike Gazzola typica from Celebes 
in structure, size, and form, but differing in 
its uniform blackish colour, and the bases of 
the black feathers not being white, but grey. 
The upperside has a fine purplish-blue gloss, 

strongest on the wings and crown, while the hind-neck, chest, breast, and abdomen . . . are 
duller and more brownish slaty black. Wing 203 to 207 mm., tail 112 to 117, Culmen 47, 
metatarsus 40.' At that time, C. enca was unknown from the Banggai Islands, and Rothschild 
& Hartert (1900) did not explicitly compare Gazzola with C. enca. Meinertzhagen (1926) and 
Stresemann (1940) continued to treat C. unicolor as a species but both suggested it might 
be a race of C. enca. Dorst (1947), in contrast, treated C. unicolor as a race of C. typicus, but 
this was not widely followed. Instead, Vaurie's (1958) decision to treat C. unicolor as a 
subspecies of C. enca has been far more influential, although he did not mention the fact 
that C. unicolor differs strikingly from geographically proximate races of C. enca in having 
strongly grey, rather than bright white, bases to the feathers over the entire body. Eck 
(1975, 1976) followed Vaurie in treating C. unicolor as a race of C. enca, but he questioned 




Figure 5. Banggai Crow Corvus unicolor (top) in 
comparison with two subspecies of Slender-billed 
Crow, C. enca celebensis (centre) and C. e. mangoli 
(bottom). Painting by Agus Prijono. 



Fahry Nur Mallo et al. 



178 



Bull. B.O.C. 2010 130(3) 



this assignment and stated that C. unicolor is the only strongly marked Banggai endemic 
bird taxon. More recently, C. unicolor has been said to differ from geographically adjacent 
races of Slender-billed Crow C. enca (C. e. celebensis of Sulawesi and some satellites, and C. e. 
mangoli of the Sula Islands) on the basis of its smaller size, comparatively 'insignificant' bill, 
more highly glossed plumage, and grey (vs. white) bases to neck feathers (Madge & Burn 
1994). It has generally been afforded species status on the basis that it may be more closely 
related to C. typicus than to C. enca (Goodwin 1976, Madge & Burn 1994, Inskipp et al. 1996), 
and Sibley & Ahlquist (1990) treated the taxon as C. {typicus) unicolor. Madge & Burn (1994) 
also suggested that C. unicolor 'is very close to the Piping Crow and it could in fact be an 
isolated, wholly blackish form of this species'. 

The new Banggai Crow specimens confirm the known characteristics of the species that 
were previously based solely on the two syntypes, in that all four have consistently short 
wings and tails, all are basically all black with strongly grey feather bases (very unlike the 
bright white feather bases of most races, including all the geographically proximate ones, 
of C. enca), and all four have deep, short bills. The revelation that the iris of Banggai Crow 
is pale strongly supports its specific distinctness, as adults of Slender-billed Crow have 
dark irides. Except for the wing measurement of the hunter-killed specimen that was not 
preserved, the other Banggai Crow specimens are very similar in shape and size, and show 
no approach to Slender-billed Crow (at least to C. e. celebensis and C. e. mangoli). On the 
other hand, C. unicolor and C. typicus are very similar in measurements (see Appendix). 
Past treatment of C. unicolor as conspecific with C. enca was based on the fact that some 
small taxa treated as races of C. enca (C. e. pusillus and especially C. e. samarensis) do occur 
in the Philippines, but these differ in several respects from C. unicolor and, given their 
geographical ranges, they are highly unlikelv to have any close relationship to C. unicolor. 

Compared with the taxon of C. enca that now inhabits Peleng Island (the subspecific 
identity of which is unresolved), Banggai Crow has different vocalisations, behaviour and 
ecology (e.g. preference for more closed canopies, whistled main call rather than simple 
cawing, and swifter flight; Indrawan et al. 2010). The behaviour, vocalisations and ecologv 
of C. unicolor seem more similar to C. typicus of mainland Sulawesi, but the ranges of 
these two taxa are separated by a deep strait (>900 m), although at the narrowest point 
Sulawesi and Peleng are separated by only 14 km, and the landmasses either side had 
different tectonic origins (Banggai being part of the Sula spur; Hall 1998, 2001). In addition, 
although their vocalisations are remarkably similar (both being very different from C. enca), 
those of C. unicolor have stronger harmonics, which is reflected in its less pure and lower 
pitched sounding vocalisations than those of C. typicus (Fig. 4). Further study with a larger 
sample of homologous vocalisations of both taxa is required to establish whether they are 
consistently different, and controlled playback experiments could shed light on species 
recognition. Considering the obvious differences in morphologv between C. unicolor (which 
is all black) and C. typicus (which is pied); apparent minor differences in vocalisations; and 
in comparison with accepted species limits in other Corvus species, we advocate treatment 
of C. unicolor as specifically distinct under the Biological Species Concept. We believe it 
highly likely that C. unicolor and C. typicus are sister species. 

Further questions remain concerning the subspecific identity of the local congener of 
C. unicolor on Peleng Island. Although field observations indicate that C. e. celebensis (rather 
than the equally likely C. e. mangoli) is the local form on the Banggai Islands, specimen 
evidence is still needed. Judicious collection of voucher material of Slender-billed Crow 
in the Banggai Islands is possible because the bird is common. Anecdotal information 
suggests that C. enca may be a competitor for the Criticallv Endangered C. unicolor (BirdLife 
International 2001, 2005, 2007), especially where moist forests have been converted to 



Fahry Nur Mallo et al. 



179 



Bull. B.O.C. 2010 130(3) 



plantations. Whether C. enca poses a threat to C. unicolor via hybridisation at ecotones is 
unknown and requires study. 

Acknowledgements 

Indrawan's field work resulting in the rediscovery of the Banggai Crow was funded by Nagao — Natural 
Environmental Funding (NEF), British Birds, and Zoologische Gesellschaft fur Arten- und Populationsschutz 
e. V. (ZGAP). The people of the village of Tetendeng (Buko sub-district) and sub-villages of Bebe (Liang 
sub-district) on Peleng extended their hospitality and shared their expertise on local natural history. For 
guidance and sharing indigenous knowledge in the field, we thank Mr Ardi See, Mr Aliman Lumano, Mr 
Bisalung Maddus and Mr Hepson Laaso. For collaboration in the field, we thank Mr Ayub Maleso (head of 
Tetendeng village local legislature), as well as Messrs. Ismail, Han, and A. S. Papatoon. Dr Nigel Collar and 
Dr Stuart Butchart (BirdLife International) proffered critical comments on Banggai Crow identification. Colin 
Trainor and Jez Bird provided helpful reviews of the paper. We thank the staff of the Museum Zoologicum 
Bogoriense (MZB), Cibinong, for allowing us to examine the new specimens; the American Museum 
of Natural History (AMNH) for allowing study of the syntypes and for sending a loan of comparative 
specimens to PCR; the Harvard Museum of Comparative Zoology (MCZ) for allowing examination of a 
comparative series; and the University of Michigan Museum of Zoology (UMMZ) for lending specimens 
to PCR. Travel by PCR to Indonesia was made possible through the College of Natural Science and Office 
of Study Abroad, Michigan State University. Mary LeCroy (AMNH) provided valuable help and clarified 
several issues relating to the syntypes, and Thomas Trombone (AMNH) provided data on specimens from 
the Banggai Islands. Sonograms of Corvus typicus were made from recordings by David Farrow and Paul 
Noakes catalogued on Xeno-canto. Mr Agus Prijono kindly executed the original paintings of the Banggai 
Crow and similar species accompanying this paper. 

References: 

BirdLife International. 2001. Threatened birds of Asia: the BirdLife International Red Data hook. BirdLife 

International, Cambridge, UK. 
BirdLife International. 2005. Corvus unicolor. 2006 IUCN Red List of threatened species, www.iucnredlist.org 

(accessed 23 May 2007). 

BirdLife International 2007. Corvus unicolor. 2007 IUCN Red List of threatened species, www.iucnredlist.org 

(accessed 6 March 2008). 
Bishop, K. D. 1992. New and interesting records of birds in Wallacea. Kukila 6: 8-35. 

Blake, E. R. & Vaurie, C. 1962. Family Corvidae. Pp. 204-282 in Mayr, E. & Greenway, J. C. (eds.) Check-list of 

birds of the world, vol. 15. Mus. Comp. Zool., Cambridge, MA. 
Coates, B. J. & Bishop, K. D. 1997. A guide to the birds of Wallacea: Sulawesi, the Moluccas and Lesser Sunda Islands, 

Indonesia. Dove Publications, Alderley. 
Dickinson, E. C. (ed.) 2003. The Howard and Moore complete checklist of the birds of the world. Third edn. 

Christopher Helm, London. 
Dickinson, E. C, Dekker, R. W. R. J., Eck, S. & Somadikarta, S. 2004. Systematic notes on Asian birds. 45. 

Types of the Corvidae. Zool. Verh. Leiden 350: 111-148. 
Dorst, J. 1947. Revision systematique du genre Corvus. Oiseaux et R.F.O. 17: 44-86. 
Eck, S. 1975. Uber die Sunda Krahe der Sula Inseln. Beitr. Vogelkd. 21: 477-479. 

Eck, S. 1976. Die Vogel der Banggai-Inseln, insbesondere Pelengs (Aves). Zool. Abh. Staatl. Mus. Tierk. Dresden 
34: 53-100. 

Eck, S. 1977. Erganzendes iiber die Vogel der Insel Taliabu, Sula-Inseln. Zool. Abh. Staatl. Mus. Tierk. Dresden 
34: 127-133. 

Eck, S. & Quaisser, C. 2004. Verzeichnis der Typen der Vogelsammlung des Museums fiir Tierkunde in den 
Staatlichen Naturhistorischen Sammlungen Dresden. Zool. Abh. Staatl. Mus. Tierk. Dresden 54: 233-316. 
Goodwin, D. 1976. Crows of the world. Brit. Mus. (Nat. Hist.), London. 

Hartert, E. 1919. Types of birds in the Tring Museum: B. Types in the general collection. Novit. Zool. 26: 
123-178. 

Hall, R. 1998. The plate tectonics of Cenozoic SE Asia and the distribution of land and sea. Pp. 99-131 in Hall, 

R. & Holloway, J. D. (eds.) Biogeography and geological evolution of SE Asia. Backhuys, The Netherlands. 
Hall, R. 2001. Cenozoic reconstructions of SE Asia and the SW Pacific: changing patterns of land and sea. 

Pp. 35-56 in Metcalfe, I., Smith, J., Morwood, M. & Davison, I. (eds.) Faunal and floral migrations and 

evolutions in South Eastern Asia-Australia. Swets & Zeitlinger, Lisse. 
Indrawan, M., Masala, Y. & Pesik, L. 1997. Recent bird observations from the Banggai Islands. Kukila 9: 

61-70. 

Indrawan, M., Masala, Y., Dwiputra, D., Mallo, F. N., Maleso, A., Salim, A., Masala, F., Tinulele, I., Pesik, 
L., Katiandagho, D. S. & Sunosol. 2010. Rediscovery of the Critically Endangered Banggai Crow Corvus 
unicolor on Peleng Island, Indonesia, part 1: ecology. Bull. Brit. Orn. CI. 130: 154-165. 



Fahry Nur Mallo et al. 



180 



Bull. B.O.C. 2010 130(3) 



Inskipp, T., Lindsey, N. & Duckworth, W. 1996. An annotated checklist of the birds of the Oriental region. Oriental 
Bird Club, Sandy. 

Jollie, M. 1978. Phylogeny of the species of Corvus. Biologist 60: 73-108. 

King, B. 2007. Tour news (updated 23 October 2007). www.kingbirdtoiu's.com/news.html (accessed 28 
February 2008). 

Madge, S. & Burn, H. 1994. Crows and jays: a guide to the crows, jays and magpies of the world. Houghton Mifflin, 
Boston. 

Masala, Y., Masala, F., Putra, D. D., Mallo, F. N., Herlina, Maleso, A., Mopook, L., Maddus, B., Kariandagho, 
S. & Indrawan, M. 2008. Erste Fotos der Banggai-Krahe. Zool. Gesselschaft Arten Populationschutz Mitt. 
24(1): 17. 

Meinertzhagen, R. 1926. Introduction to a review of the genus Corvus. Novit. Zool. 33: 57-121. 

Rheindt, F. E., Verbelen, F., Putra, D. D., Rahman, A. & Indrawan, M. 2010. New biogeographic records in 

the avifauna of Peleng Island (Sulawesi, Indonesia), with taxonomic notes on some endemic taxa. Bull. 

Brit. Orn. CI. 130: 181-207. 
Rothschild, W. & Hartert, E. 1900. [A new species of crow.] Bull. Brit. Orn. CI. 11: 29-30. 
Smithe, F. B. 1975. Naturalist's color guide. Amer. Mus. Nat. Hist., New York. 
Stresemann, E. 1940. Die Vogel von Celebes. Teil III, 1. /. Orn. 88: 1-135. 

Vaurie, C. 1958. Remarks on some Corvidae of the Indo-Malaya and Australian region. Amer. Mus. Novit. 
1915: 1-13. 

White, C. M. N. & Bruce, M. D. 1986. The birds of Wallacea (Sulawesi, the Moluccas and Lesser Sunda Islands, 
Indonesia): an annotated checklist. BOU Checklist No. 7. British Ornithologists Union, London. 

Addresses: Fahry Nur Mallo, Dadang Dwi Putra, Herlina, Ihsan Nur Mallo, Abdul Rahman & Wahyu 
Raharjaningtrah, Celebes Bird Club, Jalan M. H. Thamrin 63 A, Palu 94111, Central Sulawesi, Indonesia. 
Pamela C. Rasmussen, Michigan State University Department of Zoology and Museum, West Circle 
Drive, East Lansing, MI 48824, USA, e-mail: rasmus39@msu.edu. Soekarja Somadikarta, Darjono & 
Yunus Masala, Museum Zoologicum Bogoriense, Zoologv Division, Research Center for Biology, 
Indonesian Institute of Sciences, Cibinong, Bogor 16911, Indonesia. Mochamad Indrawan (author for 
correspondence), Indonesian Ornithologists' Union, Gedung Kusnoto, LIPI Building, Jalan H. Juanda 
18, Bogor, Indonesia, e-mail: jamblang@cbn.net.id. Paul Sweet, American Museum of Natural Historv, 
New York, NY 10024-5192, USA. Philippe Verbelen, Auguste Van Ooststraat 28, 9050 Gentbmgge, 
Belgium, e-mail: Filip_Verbelen@ yahoo.fr. 



APPENDIX 

Measurements of adult males 3 of the Slender-billed Crow Corvus enca species group (after Vaurie 1958). 



Form 


N 


Wing length 


Tail length 


Bill length 
(measured 
from skull) 


Bill length 
(measured 
from nostril) 


Bill height 1. 


C. e. compilntor 


5 


316-343 (322) 


160-70 (165) 


65-69 (66.4) 


46-49 (47) 


14.0-15.5 (15) 


C. e. enca 


6 


282-293 (287) 


139-151 (143.5) 


55-60 (58) 


36-42 (39.5) 


12.5-13.5 (13) 


C. e. celebensis 


10 c 


255-298 (277) 


127-147 (136) 


53-58 (55) 


35-40 (38) 


12-15 (13.7) 


C. e. unicolor d 


2 


210, 213 


105, 111 


46, 46 


31,32 


12,12 


C. e. mangoli 


2 


260, 275 e 


133, 134 e 


59, 63 e 


41, 43 e 


13, 14 e 


C. e. violaceous 


3 


236, 253 (245) 


131-136 (134) 


50-53 (51.3) 


36-38 (36.7) 


12.0-13.5 (13) 


C. e. pusilus 


2 


255, 263 


134, 136 


51,53 


35, 38 


13, 14 


C. e. samarensis 


3' 


215-225 (220.7) 


102-113 (108) 


50-53 (51) 


35-37 (35.7) 


all 13 


C. typicus 


6 


203-214 (210) 


108-117(112) 


45-47 (46) 


32-34 (33) 


11-13(12.4) 


C. florensis 


1« 


226 


164 


48 


31 


12 


C. kubaryi 


6 


225-242 (234,6) 


150-162 (156.5) 


53-57 (55.6) 


38-42 (40) 


11-14(12.6) 



a Except for adult females or adult unsexed specimens mentioned in the footnotes 
b Upper half of the bill measured at the level of the nostril 

1 The type of C. c. celebensis, an adult male, has the follow ing measurements: wing, 280; tail, 135; bill from skull, 53: bill 

from the nostril, 36; height of bill, 15 
li Type of C. unicolor; both specimens are unsexed adults 
e Type of C. e. mangoli, adult male; the other specimen is an adult female 
' One male, one female, one unsexed, all adults 

8 This taxon is known also from only two specimens, the one measured being an adult female 



Frank E. Rheindt et al. 



181 



Bull. B.O.C. 2010 130(3) 



New biogeographic records in the avifauna of Peleng 
Island (Sulawesi, Indonesia), with taxonomic notes 
on some endemic taxa 

by Frank E. Rheindt, Filip Verbelen, Dadang Dzvi Pntra, 
Abdul Rahman & Mochamad Indrawan 

Received 28 September 2009 

Summary. — The island of Peleng is the largest of the Banggai archipelago. It is 14 
km south-east of eastern Sulawesi and 80 km west of the Sula Islands. However, 
despite Peleng's low degree of isolation, its bird community is characterised by 
unusually high endemism, with a surprisingly pronounced Sula avifaunal element. 
Little is known about the birds of Peleng, as the island has been largely neglected 
by collectors and field ornithologists alike. We present new data on the birds of 
Peleng, partially based on an intensive recent survey of the highland avifauna 
in the west of the island, but also on long-term research and conservation work 
at lower elevations. We report new elevational data for 23 species, as well as 16 
species new for the island. Most of the new island records fill artef actual gaps 
in the distribution of species known to occur on Sulawesi to the west and on the 
Sula Islands to the east. Four new island records are genuine eastward range 
extensions of Sulawesi taxa or westward extensions of Sula species. We provide 
details on the discovery, morphology and vocalisations of up to five apparently 
undescribed taxa, with one or two probably new species to science, although their 
scientific description awaits the collection of specimens. Lastly, we comment on the 
taxonomy of several Banggai birds that require urgent systematic revision using 
genetic or vocal data. 

The Banggai archipelago lies off the eastern peninsula of Sulawesi (Fig. 1). It covers 
almost 3,000 km 2 and numbers four main islands, with Peleng (2,406 km 2 ) the largest 
(Fig. 1). Peleng is immediately adjacent to the Sulawesi mainland, and the narrow Peleng 
Strait separating the two islands is just 14 km wide at its narrowest point. The island is 
divided into a large western, small central and intermediate eastern landmass, the central 
one being connected to the others by narrow isthmuses. Whilst the central and eastern parts 
are low-lying and barely exceed 500 m, the west rises to 969 m in its interior, with c.40% of 
its land above 700 m (Fig. 1). Despite Peleng's geographical predominance, the archipelago 
takes its name from the second-largest island, Banggai (Fig. 1), formerly the cultural hub of 
the region. To the east, a string of smaller islands almost connects the Banggai archipelago 
with Taliabu, the largest island of the Sula group (Fig. 1). The nearest distance from Banggai 
to Taliabu slightly exceeds 80 km. 

Despite its immediate vicinity to Sulawesi, the avifauna of the Banggai Islands exhibits 
many differences to that of its larger neighbour (see, e.g., White & Bruce 1986). The number of 
range-restricted and near-endemic bird species on the Banggai Islands is unusual compared 
to other Sulawesi satellite islands of a similar size and distance from the mainland, such 
as Muna or Butung, which display almost no avian endemism. The Banggai archipelago 
shares much of its endemism with the Sula Islands to the east (ICBP 1992, Sujatnika et al. 
1996, Stattersfield et al. 1998, Indrawan 2004), despite the distance to the Sula Islands being 
more than five times greater than to Sulawesi (Fig. 1). Consequently, the Banggai and Sula 



Frank E. Rheindt et al. 



182 



Bull. B.O.C. 2010 130(3) 



Islands have been accorded status as an Endemic Bird Area (ICBP 1992, Sujatnika et al. 1996, 
Stattersfield et al. 1998). In their initial assessment using the distributional and taxonomic 
knowledge of the day, ICBP (1992) listed nine range-restricted bird species shared by the 
two archipelagos. 

Whilst the faunal connection between Banggai and Sula has long puzzled zoologists, 
modern geological, palaeoclimatic and bathymetric data largely explain these biogeographic 
ties. Despite the vicinity to the Sulawesi mainland, the geological history of the Banggai 
archipelago is tied to that of the Sula Islands (Hall 2002). The two groups are composed 
of metamorphic and igneous continental rocks of Australian-New Guinea affinities, 
surrounded by shallow and deep marine Palaeozoic and Mesozoic sediments (Hall 2002). 
Together, they have been drifting west towards Sulawesi, closely approaching it within 
the last four million years (Hall 2002). Apart from their shared geological origin, the Sula 
and Banggai islands have also repeatedly been connected during c.20 glacial epochs within 
the last three million years that each lasted c. 10,000-50,000 years. These connections arose 
when glacial periods caused global sea levels to fall by up to 130 m (Voris 2000, Lambeck & 
Chappell 2001, Siddall et al. 2003, Bintanja et al. 2005, Thompson & Goldstein 2005, Caputo 



E ast Sulawesi p eiunsula 



(Central Sulawesi 
Province) 



XK 



I 



Banggai Island 



Taliabu Island 
(Sula archipelago) 




*~ 'l24°E 

Figure 1. (A) Location of Peleng Island in the Banggai 
archipelago adjacent to the Sulawesi mainland. Note that 
the second-largest island in the Banggai archipelago also 
bears the name Banggai. Peleng, Banggai, Bangkulu and 
several minor islands comprise the Banggai archipelago. (B) 
Location of the Banggai archipelago between the Sulawesi 
mainland and the Sula archipelago. Old provincial names 
on Sulawesi are in Indonesian: Sulawesi Utara = North 
Sulawesi, Sulawesi Tengah = Central Sulawesi, Sulawesi 
Tenggara = South-east Sulawesi, Sulawesi Selatan = South 
Sulawesi. 



Frank E. Rheindt et al. 



183 



Bull. B.O.C. 2010 130(3) 



2007) exposing areas of shallow sea, such as along the string of islands that connect the 
Sula and Banggai archipelagos. Despite their narrow extension, the Peleng Strait between 
Sulawesi and Peleng — in contrast — never accommodated a landbridge, being characterised 
by a deep-sea trench c.400-700 m deep (Becker et al. 2009). 

Its high level of endemism and easy accessibility notwithstanding, the Banggai group 
is one of the least-explored avifaunal hotspots in Indonesia. Whilst the Sula Islands have 
been targeted by recent avifaunal work (Davidson et al. 1991, Stones et al. 1997, Rheindt 
2010; B. King in litt. 2006; FV unpubL), the Banggai archipelago has been less visited. MI has 
undertaken periodic zoological research and long-term conservation work in the islands 
for 18 years (e.g. Indrawan et al. 1993, 2009). Since 2004, the Celebes Bird Club (2006, 2007, 

2008) has joined Mi's group, with a more recent focus on the largely unknown montane 
areas of Peleng. 

Peleng has undergone dramatic forest conversion in the past decades. The low-lying 
east and centre of the island may no longer harbour significant primary forest, and all 
we have seen here are patches of degraded secondary forest and smaller remnants of 
older secondary forest (MI, FER & FV pers. obs.). The western lowlands are also largely 
deforested, but habitat quality improves higher, with substantial patches of secondary 
forest above 600 m grading into primary forest at c.800 m (MI, DER & FV pers. obs.). Older 
villagers confirm that tall forest reached well into the lowlands 30-40 years ago. 

This paper addresses our limited knowledge of the avifauna of the Banggai Islands. 
Based on our long-term research and conservation work there (MI) and a recent intensive 
avian inventory of the unexplored highlands of Peleng (FER, FV, DDP, AR, MI), we 
present data on 16 new bird species for the Banggai archipelago, including preliminary 
documentation of 1-5 undescribed subspecies and / or species. We also present data on 23 
elevational range extensions or new elevational data from the Banggai Islands. In addition, 
we provide data that resolves or questions the taxonomic status of several endemic taxa that 
require phylogeographic attention. 

Study area and Methods 

Over the past 18 and five years, respectively, MI and the Celebes Bird Club have 
periodically conducted ornithological research at study sites throughout the Banggai 
Islands. Details of some of these were presented by Indrawan et al. (1991). The montane 
west of Peleng, around Tataba, was visited on 2-7 October 2004 (MI & I. Tinulele), 12 
September-11 October 2006 (MI, Y. Masala, A. Maleso & F. Masala), 27 April-17 May 

2007 (MI, Y. Masala, A. Maleso, F. Masala & D. S. Katiandagho), 18 January-9 February 

2008 (same observers as previous) and 23 March-13 April 2009 (DDP & AR; Celebes Bird 
Club). FER & FV visited the same area on 22-31 March 2009— and FV alone on 2-5 April 
2009 — and observed birds over a broad spectrum of habitats and elevations, from coastal 
coconut plantations to montane primary forest above 900 m. Subsequently, FV visited the 
lowlands of Peleng around the capital of Salakan on 5-8 April 2009 and searched for birds 
in degraded secondary lowland forest from sea level to c.100 m. Almost two weeks later, 
FER visited the same site on 20-21 April 2009. Since 1991, the eastern lowlands including 
Salakan were also subject to archipelago-wide multiple surveys by Indrawan et al. (1993, 
1997). The south-east part of western Peleng was explored to c.900 m on 1-7 May 2007 (MI 
& D. S. Katiandagho unpubl.). 

FV took bird photographs using a Canon Eos 40D digital camera and 100-400 mm lens, 
while FER used a Panasonic Lumix DMC-FZ18. Sound-recordings were made using an 
Edirol R-09 HR and a ME-66 Sennheiser directional microphone (FV) or a Sony TCM-200DV 
cassette recorder with inbuilt microphone (FER). Sonograms were prepared using Syrinx 



Frank E. Rheindt et al. 



184 



Bull. B.O.C. 2010 130(3) 



version 2.6h by John Burt (available at www.syrinxpc.com). Sound-recordings will be 
uploaded to the xeno-canto online sound library (www.xeno-canto.org/ asia) provided their 
quality is sufficient. In some cases, we have supplemented our data with our unpublished 
bio-acoustic material from elsewhere. 

Species accounts 

The following details some of the species recorded on Peleng during our field work, 
being new island records, new elevational records or noteworthy from a distributional or 
taxonomic perspective. Order and nomenclature principally follow White & Bruce (1986) 
and Coates & Bishop (1997) Species recorded by us but not included in these accounts are 
listed in Table 1. 

TABLE 1 

Species encountered during field work in Peleng but not included in the in the main text. 



Species name 

Purple Heron Ardea purpurea 
Little Egret Egretta garzetta 
Pacific Reef Egret E. s. sacra 
Little Heron Butorides striata javanica 
Brahminy Kite Haliastur Indus intermedins 
Barred Honey Buzzard Pemis c. celebensis 
Sulawesi Serpent Eagle Spilomis rufipectus sulaensis 
Black Eagle Ictinaetus m. malayensis 

Vinous-breasted Sparrowhawk Accipiter rhodogaster sulaensis 
Spotted Kestrel Falco moluccensis microbalius 
Sula Scrubfowl Megapodius bernsteinii 

Red-backed Buttonquail Turnix maculosus kinneari 

Slaty-legged Crake Rallina eurizonoides minahasa 
Barred Rail Gallirallus torquatus sulcirostris 

White-breasted Waterhen Amaurornis phoenicurus leucomelana 
Common Sandpiper Actitis hypoleucos' 
Sulawesi Black Pigeon Turacoena manadensis 

Brown Cuckoo Dove Macropygia amboinensis albicapilla 

Emerald Dove Chalcophaps i. indica 

Black-naped Fruit Dove Ptilinopus melanospilus chrysorrhpus 

Grey-cheeked Green Pigeon Treron g. griseicauda 

Ornate Lorikeet Trichoglossus ornatus 

Blue-backed Parrot Tanygnathus s. sumatmnus 

Rusty-breasted Cuckoo Cacomantis seipulcralis virescens 

Black-billed Koe] Eudynamys melanorhynchus 

Lesser Coucal Centropus bengalensis javanensis 

Great Eared Nightjar Eurostopodus macrotis macroptetus 

Grey-rumped Treeswift Hemiprocne longipennis wallacii 



Comments 

1 near sea level 
1 near sea level 

1 near sea level 

2 near sea level 

1 at c.750 m 

1 at c.700 m, 1 near sea level 

1 at c.350 m 

2 adults at a nest at c.550 m 
near sea level 

several seen and sound-recorded at c.100 m in 
degraded forest near Salakan (eastern Peleng) 

1 heard in agricultural land at c.100 m near Salakan 
(eastern Peleng) 

sound-recorded at c.650 m 

several family groups heard and seen near sea level in 
eastern Peleng 

common at sea level in eastern Peleng 

1 on a beach near Salakan (eastern Peleng) 

Several near sea level; 1 seen and <4 heard at 
C.750-900+ m 

common from sea level to at least 800 m 

common from sea level to 830 m 
near sea level 
near sea level 
near sea level 

common from sea level to at least 800 m 
common from sea level to over 900 m 
common from sea level to over 900 m 
occasional to common to ox er 900 m 



Frank E. Rheindt et al. 



185 



Bull. B.O.C. 2010 130(3) 



Glossy Swiftlet Collocalia e. esculenta 

Great-billed Kingfisher Halcyon melanorhyncha dichrorhyncha 



Pacific Swallow Hirundo tahitica javanica 
Golden-headed Cisticola Cisticola exilis rusticus 
Flyeater Gerygone sulphurea flaveola 
Grey-sfreaked Flycatcher Muscicapa griseistida 

Island Monarch Monarcha c. cinerascens 
White-breasted Woodswallow Artamus leucorynchus albiventer 
Ivory-backed Woodswallow A. monachus 
Grosbeak Starling Scissirostrum dubium 
Moluccan Starling Aplonis mysolensis sulaensis 
Brown-throated Sunbird Anthreptes malacensis extremus 
Olive-backed Sunbird Nectarinia jugularis robustirostris 
Black-faced Munia Lonchura molucca 



common from sea level to over 900 m 

several along the coast; 1 photographed on a beach in 
eastern Peleng had an extensive red base to the lower 
mandible (not shown) — see Indrawan et al. (1997) for 
comment on variability 

near sea level 

1 in agricultural land at c.100 m 

common in degraded habitat from sea level to 550 m 

still common on 22-31 March 2009, but absent on 3-8 
April and 20-21 April 2009 

common near sea level 

near sea level to at least 700 m 

near sea level 

common near sea level 

common near sea level 

common near sea level 

common near sea level 

common near sea level 



MALAYAN NIGHT HERON Gorsachius melanolophus kutteri 

An immature was flushed from a trail in primary forest in western Peleng at c.850 m (FV, 
FER; 28 March 2009). The bird landed a few metres away and was observed for c.20 seconds. 
Subsequently, it flew to a nearby tree, where it was observed for two minutes and was 
photographed (Fig. 2). Confusion with the similar Japanese Night Heron G. goisagi can be 
eliminated by the presence of white markings on the black crown. Gorsachius night herons 
are usually cryptic and shy, and are rarely observed. In Wallacea, G. melanolophus is known 
only from the Talaud Islands and from a single previous record on Peleng, assumed to be 
a straggler (Coates & Bishop 1997). This second record on Peleng at the end of the northern 
winter suggests that it may be a regular winter visitor, passage migrant or even resident. 

RUFOUS-BELLIED EAGLE Hieraaetus kienerii formosus 

An adult was observed over degraded scrub and woodland at c.300 m in western Peleng 
(FV; 4 April 2009). The presence of a black 'helmet' contrasting with the white throat and 
rufous belly confirmed the identification. This is the first record for the Banggai Islands, 
although Indrawan et ah (1997) mentioned a probable sighting on 31 August 1996. The 
species occurs on Sulawesi and the Sula Islands, so the Peleng record closes this gap. 
Despite the paucity of historical records on Sulawesi, there have been many records in the 
last 30 years (Davidson et al. 1991). The discrepancy between historical and modern records 
suggests that H. kienerii might be expanding in range and / or abundance, perhaps due to 
habitat alteration. The Peleng record may have to be interpreted within this context, or the 
recent increase in sightings may be an artefact of improved observer coverage. 

SPOTTED DOVE Streptopelia chinensis tigrina 

One was heard and then seen in degraded lowland scrub near Salakan (eastern Peleng) 
at c.100 m (FER; 21 April 2009). Identification was based on the distinctive white-spotted 
black hindneck collar. MI previously saw the species in open habitats on Peleng, but did 
not note locations and dates, as its occurrence is unsurprising. These are the first records 
for the island. Spotted Dove is widespread in Asia and is thought to have been introduced 



Frank E. Rheindt et al. 



186 



Bull. B.O.C. 2010 130(3) 



to Wallacea. It is currently expanding its range in response to habitat modification (Coates 
& Bishop 1997). The species has previously been recorded from Labobo in the Banggai 
archipelago (Coates & Bishop 1997). These Peleng records confirm ongoing expansion 
through the islands. 

GREEN IMPERIAL PIGEON Ducula aenea sulana 

Heard and seen occasionally in primary forest from c.750 to over 900 m in montane western 
Peleng (FER, FV; 22-23 March 2009). Also encountered occasionally in degraded lowland 
forest near sea level in eastern Peleng on 5-8 April 2009 (FV), 20-21 April 2009 (FER) and 
on unspecified dates (MI). Represented on the Banggai Islands by the range-restricted 
subspecies sulana, which otherwise occurs only on the Sula Islands (White & Bruce 1986, 
Coates & Bishop 1997), previous elevational data for D. a. sulana have been limited to 
Taliabu, where recent work revealed its presence to c.1,000 m (Rheindt 2010). Our new 
Peleng records establish a similarly wide elevational range on the Banggai archipelago. 

WHITE-BELLIED IMPERIAL PIGEON Ducula forsteni 

An adult was observed in the canopy of secondary forest in montane western Peleng at 
c.700 m on 2 October 2004 (MI). On a separate but undated occasion, the species was heard 
above 500 m in the south-east of western Peleng (MI). Subsequently, on 23-30 March 2009, 
D. forsteni was heard occasionally and seen in flight on a daily basis in forest from c.750 m 
to over 900 m in the same region (FV, FER). Identification was based on the distinctly grey 
underparts and head, and the green back and breast-band of this bulky species. The calls 
confirmed the identification, strongly resembling the hollow deeply resonant vocalisations 
we have heard on Sulawesi and Taliabu. These are the first records on the Banggai Islands, 
and close a gap in the species' range between Sulawesi and Taliabu (White & Bruce 1986, 
Coates & Bishop 1997). 

SUPERB FRUIT DOVE Ptilinopus superbus 

Common in secondary and primary forest from 400 m to over 900 m in montane western 
Peleng (FV, FER; 23-31 March 2009), where it was sound-recorded. Additionally, MI, DDP 
& AR commonly heard the species in western highland Peleng above 500 m on several 
occasions, including on 18 January-9 February 2008 and 23 March-13 April 2009. These 
are the first records for the Banggai Islands. Identification of this easily recognised species 
was confirmed by sound-recordings (Fig. 3). Superb Fruit Dove occurs in Sulawesi (P. s. 
temminckii) and the northern Moluccas (P. s. superbus), but peculiarly appears absent from 
the Sula Islands (White & Bruce 1986, Coates & Bishop 1997). The population on Peleng 
probably has closest affinities with P. s. temminckii. 



A - 




Figure 3. Recording of a hooting call series of Superb Fruit Dove Ptilinopus superbus at c.800 m on Peleng. 
X-axis = time (0.5 seconds per tick), y-axis = frequency (2 kHz per tick). Recording by F. Yerbelen. 



Frank E. Rheindt et al. 



187 



Bull. B.O.C. 2010 130(3) 





Figure 2. Malayan Night Heron Gorsachius melanolophus kutteri, western Peleng at c.850 m, 28 March 2009 (F. 
Verbelen) 

Figure 4. Golden-mantled Racquet-tail Prioniturus platurus, Peleng at over 900 m, March 2009 (F. Verbelen). 
Note the conspicuous grey sheen to the shoulder that may be distinctive of the Peleng population. 

Figure 6. Female Common Cicadabird Coracina tenuirostris pelingi, Peleng at c.700 m, March 2009 (F. 
Verbelen). Note the extensive cinnamon hue to the unstreaked underparts characteristic of this taxon. 




Figure 7. Hair-crested Drongo Dicrurus hottentottus banggaiensis, Peleng at c.600 m, March 2009 (F. Verbelen). 
Note the greyish irides. 

Figure 9. Slender-billed Crow Corvus enca, Peleng near sea level, April 2009 (F. Verbelen). Note the long, 
heavy bill (contra the vernacular name). 

Figure 11. Red-and-black Thrush Zoothera mendeni, lowland eastern Peleng, April 2009 (F. E. Rheindt). Note 
the all-black underparts. This may be the first photograph of a live bird. 




Figure 15. 'Peleng Leaf Warbler' Phylloscopus taxon novum, c.800 m on west Peleng, March 2009 (F. Verbelen). 
Note the yellowish tinge to the underparts slightly contrasting with the off-white throat and upper breast. 

Fig. 18. Drab Whistler Pachycephalia griseonota, Peleng at c.100 m (F. Verbelen). Note the strong contrast 
between the dark face and the white throat. 



Frank E. Rheindt et al. 



188 



Bull. B.O.C. 2010 130(3) 



BANGGAI FRUIT DOVE Ptilinopus subgularis 

Banggai Fruit Dove has long been considered conspecific with P. s. epia of Sulawesi and 
P. s. mangoliensis of Sula (e.g. White & Bruce 1986, Coates & Bishop 1997). However, a 
forthcoming analysis suggests that subgularis on the Banggai Islands merits biological 
species status, under the English name Banggai Fruit Dove (Rheindt & Verbelen in prep.). 
Two were observed foraging in the mid-canopy at a forest edge in montane western 
Peleng at c.800 m (MI; 3 October 2004). In the same region, MI also heard the species' 
distinct vocalisation on several undated occasions above 600 m, rarely lower. An active 
nest attended by an unsexed adult was found at c.800 m on 3 May 2007; it was a simple 
platform of small branches (MI). On 23-31 March 2009, the species was commonly heard in 
secondary to primary forest at C.500-900+ m in montane western Peleng (FER, FV), and was 
photographed once above 900 m (FV). Also photographed and sound-recorded in degraded 
forest in eastern Peleng near sea level on 5-8 April 2009 (FV) and 20-21 April 2009 (FER). 
These are the first published elevational data for the species. 

GOLDEN-MANTLED RACQUET-TAIL Prioniturus platurus 

Found in secondary and primary forest in montane western Peleng from c.650 m, becoming 
noticeably commoner at higher, undisturbed elevations (FV, FER; 23-31 March 2009). It 
was common around mountaintops above 900 m (FV, FER). On various visits to western 
Peleng, MI, DDP & AR also observed the species at 600-900 m on a near-daily basis. It was 
encountered occasionally in degraded forest in eastern Peleng near sea level on 5-8 April 
2009 (FV) and 20-21 April 2009 (FER), where the species was photographed (Fig. 4) and 
sound-recorded. These are the first data on the elevational range and status of the species 
on Peleng. The Peleng population is currently ascribed to nominate P. p. platurus from 
Sulawesi, whilst those in the Sula archipelago are treated as an endemic subspecies P. p. 
sinerubris (White & Bruce 1986, Coates & Bishop 1997). However, birds on Peleng possess 
a distinctive grey cast to their wing-coverts (Fig. 4; see also Indrawan et al. 1997) that we 
have neither seen in nominate birds from Sulawesi nor in P. p. sinerubris from Taliabu (FV 
& FER pers. obs.). The population on Peleng might constitute an undescribed endemic 
subspecies. 

SULA HANGING PARROT Loriculus sclaten ruber 

Common in most habitats in montane western Peleng, ranging from coconut plantations to 
primary forest, from sea level to almost 900 m (FV, FER; 22-31 March 2009). Also common 
in degraded lowland forest near sea level around Salakan in eastern Peleng on 5-8 April 
2009 (FV) and 20-21 April 2009 (FER), where it was photographed and sound-recorded 
(FV). MI, DDP & AR commonly observed the species in a similar range of habitats on 
Peleng during 18 January-9 February 2008 and 23 March-13 April 2009. We follow Collar 
(2007) in recognising the two distinct taxa from Sula and Banggai as L. sclateri, separate from 
Moluccan Hanging Parrot L. amabilis. Because of its recent recognition as a species, there 
have been few previous data on the elevational range and status of Sula Hanging Parrot. 
Indrawan et al. (1997) commonly saw the species in the lowlands but also encountered one 
at 600 m on Peleng. Davidson et al. (1991) encountered it only to 250 m on Taliabu, but it 
has subsequently been found above 700 m (Rheindt 2010). Our Peleng sightings confirm the 
broad elevational and habitat tolerance of this versatile species. 

MOLUCCAN KING PARROT Alisterus amboinensis versicolor 

Singles, pairs and small groups of 3-4 were occasionally seen in montane western Peleng 
at 800-900 m (MI; 2004, 2006, 2007), and 1-2 seen on only three occasions in secondary 



Frank E. Rheindt et al. 



189 



Bull. B.O.C. 2010 130(3) 



or primary forest in montane western Peleng at c.850-900 m (FE, FV; 25-30 March 2009). 
FV also photographed and sound-recorded the species in disturbed forest near sea level 
around Salakan in eastern Peleng (5-8 April 2009). Represented on Peleng by the endemic 
A. a. versicolor (White & Bruce 1986, Coates & Bishop 1997), but no data have been published 
on this subspecies' elevational range and status. It may be widely overlooked due to its 
cryptic and retiring nature and / or partially nocturnal behaviour (MI pers. obs.). 

DRONGO CUCKOO Surniculus lugubris musschenbroeki 

Repeated bouts of this species' distinctive ascending call series were heard in degraded 
secondary forest near Salakan in eastern Peleng at c.100 m (FER; 20-21 April 2009). This 
is the first record for the Banggai Islands (White & Bruce 1986, Coates & Bishop 1997). 
Although the call was not sound-recorded, confusion with other species can be eliminated 
given the unmistakable vocalisations of S. lugubris (a repeated series of level notes swiftly 
ascending the scale at roughly equal frequency intervals, unlike any other cuckoo's 
vocalisations). The species occurs on adjacent Sulawesi (Coates & Bishop 1997) and has 
presumably been overlooked in Peleng by previous workers, perhaps because S. lugubris is 
silent for much of the year. 

OWL Tyto sp. 

On 26 March 2009 at 19.00 h, FV & FER heard once but failed to sound-record a nearby 
Tyto in primary forest above 900 m in western Peleng. FER considered it to have a distinct 
hissing quality strongly reminiscent of Minahassa Masked Owl T. inexspectata and unlike 
the more screeching Sulawesi Masked Owl T. rosenbergii. However, FV was sceptical of the 
identity. Independently, on 4 April 2009, FV heard a Tyto vocalisation that he considered 
consistent with T. rosenbergii in an agricultural area near forest edge at 550 m, in an area 
of western Peleng where villagers are familiar with this sound. During various surveys of 
secondary forest, cultivation and open habitat in western Peleng from sea level to c.700 
m, MI has heard Tyto vocalisations, presumably T. rosenbergii, which he described as 'not 
hissing, but more prominent screeching, like a door on a rusty hinge'. According to White 
& Bruce (1986) and Coates & Bishop (1997), the genus Tyto is represented on Peleng by 
the endemic T. rosenbergii pelingensis. The location where FV & FER heard the owl on 26 
March 2009 was in primary forest >4 km from the nearest degraded areas. All other records 
were made in or near open or secondary habitat, and were considered (by the observers, 
FV & MI, respectively) consistent with the screeching vocalisation of T. rosenbergii. The 
occurrence of Tyto owls inside dense forest on Peleng raises the possibility that two Tyto 
taxa occur on the island. On Sulawesi, T. rosenbergii is usually known from open habitat and 
light woodland, being replaced in the forest interior by T. inexspectata. An important first 
step in elucidating the taxonomic affinities of Tyto owls on Peleng is to analyse the type of 
pelingensis in comparison with other taxa, and to acquire photographs or specimens of Tyto 
owls in different habitats on Peleng. 

BANGGAI SCOPS OWL Otus mendeni 

Common in degraded woodland to primary forest from sea level to over 900 m in western 
Peleng (FV, FER; 22-31 March 2009). During various visits to western Peleng, MI heard 
its call practically every night. Also heard and seen in the degraded lowlands of eastern 
Peleng (FV; 5-8 April 2009). It was photographed and sound-recorded (FV, MI). Our 
records provide the first data on the elevational range and habitat tolerance of this species. 
Taxonomic controversy has surrounded scops owls on the Banggai Islands (Indrawan et 
al. 1997). Banggai Scops Owl is often considered a subspecies of Moluccan Scops Owl O. 



Frank E. Rheindt et al. 



190 



Bull. B.O.C. 2010 130(3) 



magicus (e.g. Coates & Bishop 1997). However, its vocalisations differ dramatically from the 
latter and from Sulawesi Scops Owl O. manadensis. It presumably has much closer affinities 
to Sula Scops Owl O. sulaensis, itself usually considered a subspecies of O. magicus. Sula and 
Banggai Scops Owls are each afforded species status by a forthcoming taxonomic proposal 
partially based on the vocal and photographic material obtained during our work on Peleng 
(King et al. in prep.). 

WHITE-THROATED NEEDLETAIL Hirundapus caudacutus 

Approximately six singles and a flock of 15+ seen in western Peleng at c.750 to over 900 
m (FV & FER; 25 March-4 April 2009). Most sightings were prolonged and the observers 
confirmed the presence of an extensive white throat, which eliminates the unlikely Purple 
Needletail H. celebensis of Sulawesi and the Philippines, and Silver-backed Needletail H. 
cochinchinensis, which breeds in mainland Asia and winters south-east to Java. One was 
photographed. These records are the first for the Banggai Islands. However, the species is 
a widespread passage migrant in Wallacea (White & Bruce 1986, Coates & Bishop 1997), 
making occurrence on Peleng unsurprising. The lack of previous records is presumably due 
to low observer activity. 

SULAWESI SWIFTLET Aerodramus sororum 

On 27 March 2009, from a primary forest clearing above 900 m, FER & FV observed a 
swiftlet flock containing c.10 A. sororum and 20 Uniform Swiftlets A. vanikorensis, as well as 
periodically several Glossy Swiftlets Collocalia esculenta. Subsequently, monospecific flocks 
of A. sororum were seen and photographed at sea level in western Peleng on 31 March 
2009 (FER, FV). These are the first records of Sulawesi Swiftlet on the Banggai Islands. 
Identification was made under optimal conditions and involved direct comparison with the 
two other species. We follow Rheindt & Hutchinson (2007) in recognising the distinctive 
Sulawesi taxon A. sororum as a separate species from Halmahera Swiftlet A. infuscatus 
and Seram Swiftlet A. ceramensis. The birds we saw in Peleng were identical to A. sororum 
in their pale rump, eliminating confusion with the much darker rumped A. infuscatus of 
adjacent northern Maluku. 

UNIFORM SWIFTLET Aerodramus vanikorensis 

On 27 March 2009, from a primary forest clearing above 900 m, FER & FV observed a swiftlet 
flock containing c.20 A. vanikorensis and c.10 Sulawesi Swiftlets, as well as periodically 
several Glossy Swiftlets Collocalia esculenta. This is the first record of A. vanikorensis on the 
Banggai Islands. Identification was made under optimal conditions and involved direct 
comparison with the other two species. Compared to C. esculenta, the larger size and 
uniform dark underparts were noted, whilst unlike A. sororum the rump was concolorous 
with the rest of the upperparts. The absence of a pale rump was confirmed in good light on 
individuals at close range and directly compared with A. sororum at the same distance. We 
can therefore eliminate other swiftlets known from the region. The taxonomic affinities of 
Uniform Swiftlet on Peleng require investigation. On the adjacent Sulawesi mainland, the 
species is represented by A. v. aenigma, which might breed in the Banggai archipelago or 
visit Peleng on foraging trips. 

COLLARED KINGFISHER Halcyon c. chloris 

As well as numerous observations in the lowlands, the species was commonly seen and 
heard in degraded woodland and secondary forest to c.900 m in western Peleng (FV & FER, 
22-31 March 2009; MI, 27 April- 17 May 2007). The species has a wide elevational range 



Frank E. Rheindt et al. 



191 



Bull. B.O.C. 2010 130(3) 



from sea level to 1,850 m on Sulawesi (White & Bruce 1986, Coates & Bishop 1997). These 
are the first altitudinal data for the species on the Banggai Islands. 

RUDDY KINGFISHER Halcyon coromanda pelingensis 

Common in degraded lowland forest near sea level in eastern Peleng on 5-8 April 2008 
(FV) and 20-21 April 2008 (FER), where it was sound-recorded and photographed (FV). On 
24 March 2009, it was seen in old secondary forest in the highlands of western Peleng at 
c.750 m (FV). On the Banggai Islands, Ruddy Kingfisher is represented by the endemic H. 
c. pelingensis (White & Bruce 1986, Coates & Bishop 1997). Our records considerably extend 
its elevational range in Wallacea. H. c. rufa on Sulawesi has been recorded to 200 m (Coates 
& Bishop 1997), whilst H. c. sulana on Taliabu is known to 500 m (Rheindt 2010). 

RED-BELLIED PITTA Pitta erythrogaster dohertyi 

Heard on a daily basis in tall forest at c.550-750 m in montane western Peleng (FV, FER; 
22-31 March 2009), although only one was seen well and photographed. During subsequent 
visits to the degraded lowlands near Salakan in eastern Peleng (5-8 April 2009, FV; 20-21 
April 2009, FER), the species was commonly heard. FV obtained sound-recordings (Fig. 5) 
and photographs. P. erythrogaster is represented on the Banggai and Sula islands by the 
somewhat distinct-looking endemic P. e. dohertyi (Bruce & White 1986, Coates & Bishop 

A A 



E 



27 27.5 28 28.5 29 29.5 30 





1 

2 -I J 








1. — « 






30 


30. 15 15 


5 16 16.5 17 17.5 


18 18.5 19 19.5 20 20.5 2 



D 2 



40 40.5 41 41.5 42 42.5 43 43.5 44 44.5 9 9.5 10 10.5 11 11.5 12 12 46 46.5 47 47.5 48 

z-If 2 | G 



29 29.5 


30 


30.5 31 


31.5 


3i 47 47.5 48 


48.5 49 49 


H 














- 


> « t > 










1 1 


.5 2 


2.5 


3 3.5 4 4.5 


5 5.5 6 


I 








HP 0M 




46 46.5 


47 


47.5 48 


48.5 


49 49.5 50 50.5 


51 51.5 52 52.5 53 53.5 54 54.5 55 55.5 



Figure 5. Sonograms of Red-bellied Pitta Pitta erythrogaster vocalisations on Peleng sound-recorded by the 
authors, and on neighbouring islands for comparison. X-axis = time in seconds (0.5 seconds per tick), y-axis 
= frequency in kHz (2 kHz per tick). A-G involve the conventional disyllabic call, H-I refer to a less common 
secondary call, but both call types are given by P. e. dohertyi on Peleng / Taliabu and by subspecies on 
neighbouring islands. Note the great variability in duration and element spacing in the disyllabic call (A-G), 
even within members of the same subspecies (e.g. B-D). A: Talaud Islands (P. e. inspeculata), by F. Verbelen, 
in March 1997. B: Tangkoko National Park (North Sulawesi; P. e. celebensis), by B. Demeulemeester (date 
unknown). C: Tambun (North Sulawesi; P. e. celebensis), by B. Demeulemeester (date unknown). D: Batudaka 
(Togian Islands; P. e. celebensis), by F. Verbelen, in December 2008. E-F: Peleng Island (P. e. dohertyi), by F. 
Verbelen, in March 2009. G: Taliabu (Sula Islands; P. e. dohertyi), by F. Verbelen, in March 1997. H: Talaud 
Islands (P. e. inspeculata), by F. Verbelen, in March 1997. I: Peleng Island (P. e. dohertyi), by F. Verbelen, in 
March 2009. 



Frank E. Rheindt et al. 



192 



Bull. B.O.C. 2010 130(3) 



1997, Indrawan et al. 1997, Erritzoe 2003). The only previous information on the elevational 
range of this taxon is from Taliabu, where it has been reported as occurring from sea level 
to 600 m (Rheindt 2010). 

P. e. dohertyi has undergone a chequered taxonomic history. Most pre-1990 authorities, 
as well as Coates & Bishop (1997) and Erritzoe (2003), considered it a subspecies of P. 
erythrogaster. However, Sibley & Monroe (1990), Davidson et al. (1991) and Lambert & 
Woodcock (1996) considered dohertyi a separate species based on its head coloration, other 
minor plumage details, and its allegedly distinctive vocalisation, which the latter authors 
described as dissimilar to other taxa in the P. erythrogaster complex. Erritzoe (2003) dismissed 
the plumage differences as insufficient for species status because plumage variation in other 
subspecies of P. erythrogaster is also considerable. It appears that Lambert & Woodcock's 
(1996) description of its 'distinctive call' was apparently based on a poorly known secondary 
vocalisation also given by all neighbouring subspecies (see their sonogram and Fig. 5H-I). 
P. e. dohertyi on Peleng (Fig. 5E-F) and Taliabu (Fig. 5G) also give the same main disyllabic 
call as P. erythrogaster elsewhere in its range (Fig. 5A-D). Slight differences in duration and 
note spacing are apparent between P. e. dohertyi and other subspecies, but these are no more 
pronounced than between (and even within) other subspecies of P. erythrogaster (Fig. 5). In 
fact, vocal variation can be quite pronounced even individually, depending on the bird's 
level of agitation (FER & FV pers. obs.; R. O. Hutchinson in litt. 2009). For this reason, we 
reject any split of P. e. dohertyi. A thorough genetic analysis is needed before considering the 
division of P. erythrogaster into more than one species. 

SLATY CUCKOOSHRIKE Coracina schistacea 

Five observations of family groups of 3-A birds in secondary and primary forest in montane 
western Peleng at c.750 m to over 900 m (FV, FER; 23 March-4 April 2009), where the species 
was photographed and sound-recorded (FV). On 7 October 2004, MI observed a pair at c.450 
m near Alani and — on subsequent days — he occasionally saw individuals in the south- 
east of western Peleng at c.900 m. Considered primarily a lowland species, C. schistacea is 
endemic to the Banggai and Sula islands (White & Bruce 1986, Coates & Bishop 1997) and 
had previously been recorded to just 200 m on the Banggai Islands (Indrawan et al. 1997). 

COMMON CICADABIRD Coracina tenuirostris pelingi 

A female was seen at the summit of Kramat Mountain (in the south-east of western Peleng), 
and a pair was subsequently observed slightly lower at c.700 m (MI; 4 May 2007). One to 
seven individuals were seen on approximately six occasions in degraded to tall forest in 
montane western Peleng at c.650-850 m (FER, FV; 22-31 March 2009), where the species 
was photographed (Fig. 6) and sound-recorded. It was also seen in eastern Peleng near sea 
level on 5-8 April 2009 (FV) and 20-21 April 2009 (FER). On the Banggai Islands, the species 
is represented by endemic C. t. pelingi, for which no elevational data have been published 
(Coates & Bishop 1997). C. t. pelingi and the equally isolated C. t. obiensis from Obi Island 
are characterised by an extremely divergent female plumage that bears little resemblance 
to female plumages of other members of the complex (Fig. 6; Coates & Bishop 1997). Future 
work may confirm that the distinctiveness of C. t. pelingi is supported by genetic, acoustic 
or other morphological data, which might load it to be considered specifically. Current 
taxonomy divides the species into c\30 races, and a complete taxonomic review is surely 
needed. 



Frank E. Rheindt et al. 



193 



Bull. B.O.C. 2010 130(3) 



SULAWESI TRILLER Lalage leucopygialis 

A male was seen atop a bare tree in cultivation near the forest edge, at c.550 m, near 
Kokolomboi in western Peleng (MI; 6 October 2006). A silent male was photographed in a 
mixed-species canopy flock in secondary forest at c.750 m in western Peleng (FER, FV; 24 
March 2008). Previously recorded from Peleng, but its elevational range there was unknown 
(White & Bruce 1986, Coates & Bishop 1997). On Sulawesi, it ranges to 1,000 m, whilst on 
Taliabu (Sula Islands) it has not been seen higher than c.200 m (Davidson et al. 1991, Stones 
et al. 1997, Coates & Bishop 1997; FER pers. obs.). 

HAIR-CRESTED DRONGO Dicrurus hoitentottus banggaiensis 

Common in degraded woodland to tall forest from sea level to at least 750 m in montane 
western Peleng (FV, FER; 22-31 March 2009) and in the lowlands of eastern Peleng (FV, 5-8 
April 2009; FER, 20-21 April 2009). It was photographed (Fig. 7) and sound-recorded (FV). 
During his visits to Peleng, MI has recorded the species on a near-daily basis, mostly in the 
lowlands but also in the montane west. The regional classification of the Hair-crested Drongo 
is complicated, and current taxonomy may not do the evolutionary history of this complex 
justice (see Rheindt & Hutchinson 2007). Following older treatments. White & Bruce (1986) 
and Coates & Bishop (1997) attributed populations on the Banggai Islands to the Sulawesi 
subspecies D. h. leucops, which is distinct from most other races in having a strikingly white 
iris. White & Bruce (1986) explicitly mentioned that Banggai birds had previously been 
accorded subspecific status as D. h. banggaiensis due to their 'having a brown rather than 
white iris, but there is doubt as to the validity of this'. However, Indrawan et al. (1997) 
remarked that — although most birds they saw in the lowlands of the Banggai archipelago 
were white-eyed — several with brown irises were observed as well. This situation is akin 
to that on other satellite islands of Sulawesi, where D. h. leucops is supposedly present but 
dark-eyed birds occur, e.g. on Siau (FV & FER pers. obs.). Indrawan et al. (1997) suggested 
that brown-eyed birds in the Banggai Islands may belong to the previously unrecorded 
Spangled Drongo D. bracteatus. However, as there seems to be no cogent rationale for the 
taxonomic treatment that divides drongo populations in Wallacea into D. bracteatus in 
the east and D. hottentottus in the west (Rheindt & Hutchinson 2007), we suggest that the 
classification of brown-eyed birds in Banggai as D. bracteatus is unhelpful. 

Curiously, the great majority we saw in western Peleng above 400 m had grey to 
brown irides (Fig. 7), unlike the predominantly white-eyed birds observed in the lowlands 
by Indrawan et al. (1997). However, we also saw one or two individuals with very pale 
eyes, described as off-white. We observed birds with different eye colours together and 
giving identical vocalisations. Therefore, we doubt that the situation on Peleng mirrors 
that on Sulawesi, where a pale-eyed drongo species from the lowlands (D. h. leucops) and 
a dark-eyed montane species (Sulawesi Drongo D. montanus) replace each other. Instead, 
we assume there is one drongo species on Peleng that displays a range of eye colours, with 
dark irides predominating at higher elevations. Eye colour did not appear to be related to 
age, since vocally displaying adults with different eye colours were seen. 

One explanation for the variability of eye colours on Peleng could be varying selectional 
pressures along an elevational gradient, with pale eyes being selected over dark eyes at lower 
elevations and vice versa. A second scenario for the variability of eye colours on Peleng 
could be the ongoing gradual introgression of a newly colonising taxon, presumably white- 
eyed D. h. leucops of Sulawesi, into the ancestral Peleng drongo D. h. banggaiensis, which is 
perhaps closely related to brown-eyed D. h. pectoralis of Sula. Although only 14 km distant, 
Peleng and Sulawesi are divided by a deep-sea trench (Becker et al. 2009) that has never 
permitted land connections to form during glacial sea-level fluctuations that recur every 



Frank E. Rheindt et al. 



194 



Bull. B.O.C. 2010 130(3) 



c.100,000 years (Lambeck & Chappell 2001, Siddall et al. 2003, Bintanja et al 2005, Thompson 
& Goldstein 2005, Caputo 2007). On the other hand, sea levels between Sula and Banggai / 
Peleng are sufficiently shallow for landbridges to arise during glacial periods (Becker et al. 
2009). This potential scenario entails that dark-eyed populations of D. h. banggaiensis could 
be facing slow and gradual introgression on Peleng by colonising D. h. lencops from Sulawesi. 
The predominance of white-eyed birds in the lowlands of Peleng would also agree with this 
scenario, since colonisers would probably become established in the lowlands first. This 
taxonomic puzzle demands genetic elucidation. Meanwhile, we suggest that the previous 
treatment of drongos on the Banggai Islands as D. h. banggaiensis should be maintained until 
and unless further data prove this arrangement to be erroneous. 

NORTHERN GOLDEN BULBUL Thapsinillas longirostris harterti 

Occupies a wide spectrum of habitats, from undisturbed primary forest to degraded scrub 
and from sea level to over 900 m in montane western Peleng (FER, FV; 22-31 March 2009). 
Also seen in degraded lowland forest near sea level in eastern Peleng on 5-8 April (FV) and 
20-21 April 2009 (FER). It was photographed and sound-recorded. Furthermore, MI, DDP 
& AR observed the species in a similar range of habitats and elevations on a near-dailv basis 
during their multiple visits. Elevational data on T. 1. harterti, which is endemic to the Banggai 
Islands, have been lacking. Our records reveal that it occurs across the entire elevational 
spectrum on Peleng. We follow Fishpool & Tobias (2005) and Rheindt & Hutchinson (2007) 
in considering taxa from the northern Moluccas, Banggai, Sangihe and Togian islands as 
a species, T. longirostris, separate from taxa in the southern Moluccas, but future research 
will probably reveal the existence of several species-level taxa with different plumage and 
vocalisations within T. longirostris — akin to the species-level differences shown between 
taxa that comprise Southern Golden Bulbul T. affinis (Rheindt & Hutchinson 2007). 

BLACK-NAPED ORIOLE Oriolus chinensis frontalis 

Photographed and sound-recorded regularly in forest and woodland from sea level to c.850 
m on western Peleng (FV, FER; 22-31 March 2009). Encountered regularly in degraded 
lowland forest in eastern Peleng on 5-8 April (FV) and 20-21 April 2009 (FER). The 
population on the Banggai Islands is included within O. c. frontalis along with those on 
the Sula archipelago (White & Bruce 1986, Coates & Bishop 1997). Whilst the widespread 
Sulawesi O. c. celebensis ranges into the mountains, O. c. frontalis had been reported from 
sea level only to c.300 m on Taliabu (Davidson et al. 1991, Coates & Bishop 1997, Stones et 
al. 1997). Our montane records on Peleng — along with recent observations from Taliabu to 
800 m (Rheindt 2010) — establish that O. c. frontalis resembles other regional subspecies in 
its elevational range. 

BANGGAI CROW Coitus unicolor 

Recorded repeatedly by all authors. Details on the rediscovery of this species are published 
elsewhere in this issue (Indrawan et al. 2010, Mallo et al. 2010). 

SLENDER-BILLED CROW Coitus enca 

Common in coconut plantations and other agricultural land from sea level to t.300 m in 
western Peleng (FV & FER, 22 and 31 March 2009; MI, numerous records, including 18 
January-9 February 2008 and one at c.400 m at Alani on 7 October 2004). During a visit to 
montane western Peleng, one was seen above 900 m, flying overhead at a height of t\50 m, in 
undisturbed primary forest (FER, FV; 27 March 2009). The latter sighting clearlv involved C. 
enca and was made within minutes of seeing several C. unicolor, which species is expected at 



Frank E. Rheindt et al. 



195 



Bull. B.O.C. 2010 130(3) 



8.5 
Time (sec) 



higher elevations in undisturbed 
forest. This C. erica was 
presumably crossing the area 
without intending to land. 
Subsequently, C. enca was seen in 
degraded scrub near sea level in 
eastern Peleng on 5-8 April 2009 
(FV) and 20-21 April 2009 (FER), 
where it was sound-recorded 

(Fig 8) and photographed Fig ure 8- Sonogram of the calls of Slender-billed Crow Corvus enca 
Q , recorded at sea level on Peleng. X-axis = time (0.5 seconds per tick), 

' '* y-axis = frequency (2 kHz per tick). Recording by F. E. Rheindt. 

White & Bruce (1986) and 

Coates & Bishop (1997) did not list C. enca for the Banggai Islands, although Coates & 

Bishop (1997) noted that crows seen near habitation on Banggai and Peleng might pertain 

to this species. Indrawan et al. (1997) also reported the presence of a Corvus in the lowlands 

of the Banggai Islands that presumably referred to this species, but they too left the identity 

open. However, C. enca was identified on Peleng and Banggai in 2005 during searches for C. 

unicolor (B. King in litt. 2006, http:/ /www. kingbirdtours.com/news.html). C. enca appears 

to be a common resident of disturbed lowland habitat on the Banggai archipelago. It is 

unknown whether this population belongs to the Sulawesi subspecies C. e. celebensis or to 

Sula C. e. mangoli. Future bio-acoustic and morphological studies should seek to establish 

the taxonomic affinities of the Banggai population. 

On Peleng, C. enca seems to replace endemic C. unicolor in disturbed lowland habitat. 

The lack of historic records of C. enca on Peleng and Banggai may indicate recent colonisation 

following anthropogenic habitat modification. However, this hypothesis requires further 

research given that older villagers in western Peleng claim that 'the big lowland crow' was 

also present during their childhood, when undisturbed forest dominated low elevations on 

Peleng. 

RED-AND-BLACK THRUSH Zoothera mendeni 

A single — caught by local people who consider this bird uncommon — was given to MI on 
c.16 June 2008 at a locality in western Peleng between 150 m and 500 m. Prior to this, Y. 
Masala, a member of MPs party, observed one near Bobonggon on 4 May 2007. During their 
nine-day visit to montane western Peleng, FER & FV observed this bird only three times, 
on 22-26 March 2009 at c.450-650 m in secondary forest. FV sound-recorded the call note. 
Their sightings were made in small forest patches at the upper edge of the agricultural belt, 
presumably in the only suitable habitat locally remaining within the species' elevational 
range, which may not reach much higher. In the degraded lowlands near Salakan in eastern 
Peleng on 21 April 2009, FER sound-recorded (Fig. 10) and photographed (Fig. 11) one in a 
small patch of moderately undisturbed secondary forest at c.100 m. 

We follow Collar's (2004) proposal to regard Z. mendeni as specifically distinct from 
the very different-looking Red-backed Thrush Z. erythronota of Sulawesi. We also employ 
Collar's (2004) name, Red-and-black Thrush, rather than the more widespread English 
name Peleng Thrush. Although the species has to date only been recorded on Peleng 
within the Banggai archipelago, the latter name is unsuitable, because Davidson et al. (1991) 
discovered a new Zoothera population on Taliabu (Sula Islands) which on present evidence 
is doubtfully distinct from Z. mendeni (Collar 2004). 

Nothing has been published concerning the elevational range of Z. mendeni on 
Peleng, except that the type specimen was taken at 300 m (Clement & Hath way 2000). 



Frank E. Rheindt et al. 



196 



Bull. B.O.C. 2010 130(3) 



*W ft 



0 J ■ . . , , . , , 1 , I : . , : : , , , , 

7 7.5 8 8.5 9 9.5 10 10.5 11 11.5 12 12.5 13 13.5 14 14.5 15 15.5 16 16.5 17 17.5 18 18.5 

Time (sec) 

Figure 10. Sonogram of the song of Red-and-black Thrush Toother a mendeni recorded at 100 m on Peleng. The 
song is a strong, pleasing, melodious warble. X-axis = time (0.5 seconds per tick), y-axis = frequency (2 kHz 
per tick). Recording by F. E. Rheindt. 

The vocalisation of Z. mendeni is undescribed. Our records establish that the species may 
principally be restricted to lowland forest below 650 m, and might therefore be at risk 
due to the wholesale clearance of lowland forest on Peleng. The song (Fig. 10) is a very 
strong, melodious, pleasing and liquid series of notes typical of Zoothera dawn songs. It is 
similar to descriptions of the song of Z. erythronota, which has apparently not been sound- 
recorded (Clement & Hathway 2000). The call was a very high-pitched, typical Zoothera-like 
pseeeeeeee. 

SNOWY-BROWED FLYCATCHER Ficedula hyperythra (undescribed subspecies?) 
Seen by DDP in montane western Peleng at 800-900 m: on 10 April 2009, one was found 
damaged in a mist-net, presumably having been predated by a mouse; it had briefly been 
seen in the field at the same location on 9 April. This is the first record for the Banggai 
archipelago. The species is common in montane Sulawesi to the north and west (White & 
Bruce 1986, Coates & Bishop 1997) and has been recorded on Taliabu in the Sula archipelago 
to the east (Davidson et al. 1991, Stones et al. 1997, Rheindt 2010). The subspecific identity 
of birds on Peleng is uncertain: those on Taliabu are believed to involve an undescribed 
subspecies (Davidson et al 1991), which might mean that the Peleng population also 
deserves subspecific rank, unless subsumed with those on Taliabu or the adjacent taxon on 
Sulawesi. 

GRAY'S GRASSHOPPER WARBLER Locustella fasciolata 

On 23, 26 and 28 March 2009, a single was repeatedly heard giving its distinctive alarm 
call (Fig. 12) from a large weedy forest clearing at c.800 m (FV, FER). The same individual 
was probably involved on all three occasions. Twice (23 and 26 March), the bird was briefly 
seen. These are the first records of L. fasciolata on the Banggai Islands (White & Bruce 1986, 
Coates & Bishop 1997). Our sightings were brief but clearly involved a comparativelv large 




.5 1 1.5 2 2.5 3 3.5 4 4.5 5 5.5 6 6.5 7 7.5 8 8.5 9 9.5 10 10.5 11 11.5 12 

Time (sec) 



Figure 12. Sonogram of the distinctive alarm vocalisation of Grav's Grasshopper Warbler Locustella fasciolata 
recorded at 800 m on Peleng. The recording constitutes a rapid series of call doublets (terreck-terreck, terreck 
terreck-terreck . . .). Dark smudging at c.6 kHz is background noise of insects, \-a\is = time (0.5 seconds per 
tick), y-axis = frequency (2 kHz per tick). Recording by F. Verbelen. 



Frank E. Rheindt et al. 



197 



Bull. B.O.C. 2010 130(3) 



warbler with a bright white supercilium and solid brown (unstreaked) back. These details 
and the sound-recordings confirm its identification as L. fasciolata and preclude confusion 
with various Megahirus grassbirds, Acrocephalus reed warblers or Bradypterns bush warblers. 
A widespread winter visitor and passage migrant to northern Wallacea (Coates & Bishop 
1997), its occurrence on the Banggai Islands is unsurprising; the lack of previous records is 
probably reflective of low observer activity and the species' shy behaviour. 

MOUNTAIN TAILORBIRD Orthotomns cucidlatus (undescribed subspecies?) 
The. species' distinctive song was heard commonly, and singles were seen occasionally, in 
primary and secondary forest in montane western Peleng between 750 m and over 900 m 
(FER, FV; 22-31 March 2009). These are the first records for the Banggai Islands (White & 
Bruce 1986, Coates & Bishop 1997). Identification of this vocally conspicuous species was 
confirmed by sound-recordings (Fig. 13). The taxonomic affinities of the Peleng population 
are undetermined. On Sulawesi, Mountain Tailorbird is represented by four very similar 
subspecies, one of which (O. c. meisei) occurs in mountains on the eastern peninsula adjacent 
to Peleng. However, a population has also recently been discovered in the mountains of 
Taliabu, which is thought to represent an endemic subspecies (Davidson et al. 1991, Coates 
& Bishop 1997). A revision of all subspecies in the region, including the two undescribed 
populations, will be required to determine the validity of taxa and the affinities of birds on 
Peleng and Taliabu. 



47.5 48 48.5 49 49.5 58 50.5 51 51.5 52 5Z.5 53 53.5 54 54.5 55 55.5 56 56.5 57 57.5 58 58.5 59 59 

Time (sec) 

Figure 13. Sonogram of the song of Mountain Tailorbird Orthotomus cucidlatus recorded c.850 m on Peleng. 
The song is a single, melodious, high-pitched (near-) level note or a rapid succession of 2-4 such notes on 
different frequencies. X-axis = time (0.5 seconds per tick), y-axis = frequency (2 kHz per tick). Recording by 
F. Verbelen. 

ARCTIC WARBLER Phylloscopus borealis 

Loose associations involving several individuals of this Palearctic migrant were observed 
and photographed on 5-6 occasions in disturbed woodland to primary forest at 600-850 
m on western Peleng (FV, FER; 24 March-3 April 2009). They often associated with 
mixed flocks that also contained flowerpeckers (Dicaeum), honeyeaters (Myzomela) and an 




2 - 

o J - " — r - - , • ,~" - , — ' -- ' , - - - ' , — r , ■ , '■ ' v .- — ' •- v •- . • • 3 

.5 1 1.5 Z 2.5 3 3.5 4 4.5 5 5.5 6 6.5 7 7.5 8 

Time (sec) 

Figure 14. Sonogram of the song of Arctic Warbler Phylloscopus borealis recorded at c.750 m on Peleng. This 
vocalisation is a trill given principally during courtship on the breeding grounds. The black smudging at 5-6 
kHz is sound pollution by insects. X-axis = time (0.5 seconds per tick), y-axis = frequency (2 kHz per tick). 
Recording by F. Verbelen. 



Frank E. Rheindt et al. 



198 



Bull. B.O.C. 2010 130(3) 



undescribed leaf warbler (see following account). Identification was based on the white 
underparts, presence of one white wingbar and — primarily — song. The trill typically given 
on the Siberian breeding grounds during courtship was sound-recorded, confirming the 
identification (Fig. 14). Arctic Warbler is a widespread winter visitor to Wallacea, but has 
not previously been recorded in the Banggai Islands. Its occurrence here is unsurprising. 

TELENG LEAF WARBLER' Phylloscopus taxon novum 

On 23-30 March 2009, FER & FV repeatedly observed groups, pairs and singles of a leaf 
warbler other than Arctic Warbler P. borealis or any other migratory species known in 
Indonesia. They were observed frequently in primary and secondary forest from 700 m 
to over 900 m, being slightly commoner at higher elevations, and one was photographed 
(Fig. 15). It often associated with other canopy species, such as honeyeaters (Myzomela), 
flowerpeckers (Dicaeum) and even P. borealis. When these two Phylloscopus were seen 
together, the present species was easily separated by its smaller size and distinct underparts 
coloration, with the yellowish lower breast and belly contrasting with the off-white throat 
and upper breast. It also behaved differently from the twig-feeding P. borealis by keeping to 
heavier branches, along which it crept like a treecreeper (Certhia). We acquired numerous 
sound-recordings which confirm that it does not belong to any potential migrant visitor. 

The genus Phylloscopus has not previously been reported from the Banggai Islands 
(White & Bruce 1986, Coates & Bishop 1997). However, the mountains of adjacent Sulawesi 
are inhabited by Sulawesi Leaf Warbler P. sarasinorum (White & Bruce 1986, Coates & 
Bishop 1997), whilst there is a recently discovered but undescribed leaf warbler in montane 
Taliabu that perhaps belong to the Island Leaf Warbler P. poliocephahis complex (Davidson 
et al. 1991, Coates & Bishop 1997, Stones et al. 1997, Rheindt 2010). Preliminary comparison 
of photographs and sound-recordings suggests pronounced differences in underparts 
coloration and vocalisations between the 'Peleng Leaf Warbler', the undescribed Taliabu 
taxon and P. sarasinorum. The taxonomic affinity of the Peleng population requires acoustic, 
morphological and preferably genetic studies, incorporating all neighbouring taxa of the 
P. sarasinorum / poliocephahis complex, which might comprise up to a dozen species-level 
taxa (Rheindt & Hutchinson 2007); the undescribed forms on Taliabu and Peleng perhaps 
form part of this grouping. Detailed taxonomic research into the P. poliocephahis complex 
has been initiated with a view to resolving the position of some Indo-Papuan leaf warbler 
taxa (FER unpubl. data). 

BLACK-FRONTED WHITE-EYE Zosterops atrifrons subatrifrons 

Common in a variety of habitats ranging from degraded patches to primary forest, from sea 
level to above 900 m in western Peleng (FER, FV; 22-31 March 2009). Also encountered near- 
daily during multiple visits to the same area by MI & DDP. Subsequentlv, the species was 
found to be common near sea level in the east of the island on 5-8 April 2009 (FV) and 20-2 1 
April 2009 (FER). FV obtained sound-recordings (Fig. 16), and he and DDP photographed 
the species on Peleng. The population on Peleng is ascribed to Z. a. subatrifrons (Rasmussen 
et al. 2000), for which few elevational data have been published. On Sulawesi, Z. a. atrifrons 
and Z. a. surdus range from sea level to 1,500 m (White & Bruce 1986, Coates & Bishop 1997), 
whilst Z. a. sulaensis on the Sula archipelago was thought to be restricted to the lowlands 
(Davidson et al. 1991, Coates & Bishop L997, Stones el al. L997) but has recently been found 
commonly to 1,100 m on Taliabu (Rheindt 2010). Our Peleng observations demonstrate that 
the elevational range of Z. a. subatrifrons is comparable to neighbouring taxa. 

The taxonomy of/, atrifrons has recently been revised (Rasmussen cl al. 2000). Previously, 
most authors (e.g. White & Bruce L986, Coates & Bishop 1997) had included Sangihe White- 



Frank E. Rheindt et al. 



199 



Bull. B.O.C. 2010 130(3) 



ft f. F t; i 



5 5.5 6 6.5 7 7.5 8 8.5 9 9.5 10 10.5 11 11.5 12 12.5 13 13.5 14 14.5 15 15.5 16 16.5 17 

Time (sec) 



B 



h i m U if H. I . h V,tU 



41 41.5 42 42.6 43 43.5 44 44.5 45 45.5 46 46.5 47 47.5 48 48.5 49 49.6 50 50.5 51 51.5 52 52.5 

Time (sec) 



( s , D 



22 22.5 
Time (sec) 



Figure 16. Sonograms of the dawn song of Black-fronted White-eye Zosterops atrifrons from (A) Peleng 
Island (Z. a. subatrifrons; F. Verbelen), (B) Gunung Ambang, North Sulawesi (Z. a. atrifrons; F. Verbelen), 
(C) and (D) Taliabu Island, Sula archipelago (Z. a. sulaensis; (C) F. E. Rheindt and (D) by P. Davidson & A. 
J. Stones). All sonograms are at equal scale. X-axis = time (0.5 seconds per tick), y-axis = frequency (2 kHz 
per tick). Dawn songs are principally but not exclusively uttered at dawn. Note the dramatic differences in 
song structure, frequency and number and shape of elements in the three taxa. The black smudging at c.l 
kHz in (C) is mechanical sound pollution. Note that C and D were recorded at different sites on Taliabu at 
a 12-year interval. 

eye Z. nehrkorni and Seram White-eye Z. stalkeri in Z. atrifrons, until Rasmussen et al. (2000) 
demonstrated that these forms merit biological species status on account of pronounced 
morphological and / or acoustic differences. Concerning Z. a. sulaensis and Z. a. subatrifrons, 
Rasmussen et at. (2000) noted close similarities in coloration, but conspicuous differences in 
eye-ring width and other colour details between the Z. a. sulaensis / subatrifrons group on 
the one hand and the two mainland Sulawesi taxa (Z. a. atrifrons / surdus) on the other. They 
pointed out that Z. a. subatrifrons from Peleng appears somewhat intermediate between 
Sulawesi and Sula populations in these characters (see also Indrawan et al. 2008), but that its 
much closer affinities with Z. a. sulaensis are undeniable. Rasmussen et al.'s (2000) acoustic 
material, which included samples of the dawn song of Z. a. atrifrons (North Sulawesi), Z. a. 
surdus (Central Sulawesi) and Z. a. sulaensis (Sula), but unfortunately not Z. a. subatrifrons 
(Peleng), suggested vocal similarities between the two Sulawesi taxa, which in turn differed 
greatly from Z. a. sulaensis in song structure and frequency. These authors asserted that if 



Frank E. Rheindt et al. 



200 



Bull. B.O.C. 2010 130(3) 



Z. a. subatrifrons from Peleng did not exhibit a slight approximation in plumage characters 
towards the Sulawesi forms, 'the distinctiveness of sulaensis [and subatrifrons] both in 
morphology and in vocalizations as compared to the nominate is such that we would have 
unhesitatinglv recommended specific status'. However, thev were reluctant to propose a 
split, because 'if sulaensis were treated as specifically distinct, on morphology, subatrifrons 
must belong to the same species, and it is the name with priority. As we have no information 
on the vocalizations of subatrifrons, we are therefore presently unable to resolve this matter' 
(Rasmussen et al 2000). 

FY obtained numerous recordings of the dawn song of Z. a. subatrifrons, all of which 
possess an equal sound structure and frequency profile on sonograms (Fig. 16), confirming 
their taxonomic utility. Although Rasmussen et al. (2000) pointed to the vocalisations of 
Z. a. subatrifrons as the kev to solving the unresolved puzzle surrounding the taxonomic 
rank of Sula and Banggai populations, our Peleng recordings provide no easy solution, 
as thev do not clearly align with either their eastern (Z. a. sulaensis) or western / northern 
neighbours (Z. a. surdus / atrifrons). Note that our samples of Z. a. atrifrons and Z. a. sulaensis 
are virtually identical to sonograms in Rasmussen et al. (2000), although their recordings 
were not made at the same sites, thereby cormrming dawn song as a reliable taxonomic 
character (Fig. 16). Z. a. subatrifrons from Peleng exhibits a song structure less complex 
than in Z. a. atrifrons, with only slightly more than 50% of the elements per song bout, 
and a mean frequency range that is lower pitched by c.l kHz (4-9 kHz vs. 3-8 kHz). Even 
so, the shape of individual song elements in both taxa is similar, with a preponderance of 
descending hook-shaped notes at higher frequencies interspersed within a series of rising 
or punctual notes at lower frequencies (Fig. 16). Compared to Z. a. sulaensis, which displays 
an impoverished frequency range of 3-5 kHz, the song of Z. a. subatrifrons has pronounced 
differences in the shapes of individual elements, with ascending notes dommating over 
descending ones, although the number of elements per bout is roughly comparable between 
them (Fig. 16). 

Therefore, the song of Z. a. subatrifrons proves to be equally distinct from Z. a. atrifrons 
as it is from Z. a. sulaensis, and thus bears no information pointing to its closest phvlogenetic 
affinities. On the contrary, our recordings from Peleng suggest that Z. a. subatrifrons may 
deserve biological species rank, with Z. a. sulaensis also upgraded to species level. However, 
given the plumage similarities of the latter two (Rasmussen et al. 2000), we await further 
data, especially additional vocal samples from other parts of central (southern) Sulawesi, 
where an undescribed subspecies of Z. atrifrons has been reported (Rasmussen et al. 2000), 
before proposing such an arrangement. 

HENNA-TAILED JUNGLE FLYCATCHER Rhinonn/ias eolonus pelingensis 
On 3 October 2006, scattered secondaries, tertials and filoplumes of this species (probably 
predated) were found in old secondary forest near its edge, at Bobonggon at c.520 m 
(MI). A nearby cup-shaped nest on a young pandan plant c.30 cm above the ground was 
believed to belong to this species. It contained two brown chicks c.6-8 cm long with black- 
streaked upperparts (MI). Subsequently, a second nest — of mosses, placed in a pandan and 
apparently recently abandoned — was found in primary forest at Kramat at c.800 m (MI). 
On 5 May 2007, an adult was mist-netted, measured, photographed and released at Lado 
(MI). During their trip to montane western Peleng (22-31 March 2009), FY & FER heard the 
species commonly, and observed it occasionally in primary forest and degraded woodland 
from sea level to c.850 m. In the low lands of eastern Peleng on 3-8 April (FY) and 20-21 
April 2009 (FER), it was heard and seen several times in degraded secondary forest. The 
species was photographed and sound-recorded (FY). R. eolonus is probably endemic to 



Frank E. Rheindt et al. 



201 



Bull. B.O.C. 2010 130(3) 



the Sula and Banggai islands, although a specimen of doubtful provenance may be from 
eastern Sulawesi (White & Bruce 1986, Coates & Bishop 1997). On the Banggai Islands, it 
is represented by the endemic R. c. pelingensis, which has hitherto been recorded only on 
Peleng (Coates & Bishop 1997) and Labobo (Indrawan et al. 1997). It is generally unobtrusive 
(Davidson et al. 1991), and rare on Peleng, where Indrawan et al. (1993, 1997, 1998) did not 
find it during several weeks of field work (1993, 1998) in the low-lying east of the island. 
Its previous upper elevational limit had been reported as 300 m on Taliabu (Davidson et al. 
1991, Stones et al. 1997; FER pers. obs.). Our records from Peleng reveal that R. c. pelingensis 
may differ from the nominate subspecies in its much broader elevational range. Our 
records also demonstrate that, once its pleasing melodious song is learned, this shy and 
inconspicuous species proves much commoner than previously assumed, and may possess 
a broad tolerance of habitat degradation. 

BLACK-NAPED MONARCH Hypothymis azurea blasii 

Common in primary forest to degraded second growth in western Peleng from sea level 
to over 900 m (FER, FV; 22-31 March 2009). MI, DDP & AR also recorded the species in a 
wide range of habitats and elevations throughout western Peleng on numerous occasions. 
In the lowlands of eastern Peleng (FV, 5-9 April; FER, 20-21 April 2009), it was common, 
and was photographed and sound-recorded. The population on Peleng is ascribed to H. a. 
blasii from the Banggai and Sula archipelagos (White & Bruce 1986, Coates & Bishop 1997, 
Indrawan et al. 1997). The elevational range of this subspecies had been reported as sea 
level to 300 m on Taliabu (Davidson et al. 1991, Coates & Bishop 1997, Stones et al. 1997), 
although it has since been observed up to 900 m (Rheindt 2010). Our records from Peleng 
reveal the altitudinal range of H. a. blasii to be much more akin to that of other subspecies 
than previously assumed. 

CITRINE CANARY-FLYCATCHER Culicicapa helianthea helianthea 

Common from c.750 m to over 900 m in secondary and primary montane forest in western 
Peleng (FV, FER; 22-31 March 2009). It was not observed in the lowlands. C. h. helianthea 
is known from Peleng, but data on its elevational range were lacking (White & Bruce 1986, 
Coates & Bishop 1997). On Sulawesi, it occurs to 2,300 m, although it is rather commoner 
above 500 m (Coates & Bishop 1997). Its primarily montane range on Sulawesi may be 
mirrored on Peleng. On Taliabu and Mangole, it was previously known only from the 
lowlands (Davidson et al. 1991, Stones et al. 1997, Coates & Bishop 1997), but it has recently 
been found on Taliabu to c.800 m (Rheindt 2010). 

RUSTY-BELLIED FANTAIL Rhipidura teysmanni (undescribed subspecies?) 
Seen occasionally and heard more frequently in secondary to primary montane forest 
in western montane Peleng at c.750-900 m (FER, FV; 23-30 March 2009). FV obtained 
sound-recordings (Fig. 17) and photographs. In the same area, DDP, AR & MI occasionally 
observed the species during several visits. These are the first records for the Banggai 
archipelago. The species is widespread in the Sulawesi highlands, where up to three 
subspecies are recognised: nominate teysmanni on the Lompobattang Massif in south 
Sulawesi, toradja in the mountains of central and south-east Sulawesi and coomansi on the 
northern Minahasa Peninsula. Furthermore, another subspecies, sulaensis, inhabits montane 
Taliabu. The population on Peleng closes a distributional gap between Sulawesi and the 
Sula archipelago. 

The taxonomic affinity of the population on Peleng is contentious. In the field, all 
subspecies look extremely similar (Coates & Bishop 1997; FER pers. obs.), and the Peleng 



Frank E. Rheindt et al. 



202 



Bull. B.O.C. 2010 130(3) 



V 
A 



B 



5.5 6 6.5 7 7 1.5 2 2.5 3 3.5 
Time [sec] Time (sec) 



JT 



C 



1 1.5 2 2.5 3 3.5 A 4.5 5 5,5 
Time [sec] 



D 



Figure 17. Sonograms of the 
songs of Rusty-bellied Fantail 
Rhipidura teysmanni from 
(A) Gunung Ambang, North 
Sulawesi (R. t. coomansi; M. 
Catsis, source www.xeno-canto. 
org/asia); (B) and (C) Lore Lindu 
National Park, Central Sulawesi 
(R. t. toradja; F. E. Rheindt); (D) 
and (E) Taliabu Island, Sula 
archipelago (R. t. sidaensis; F. 
E. Rheindt); and (F) and (G) 
Peleng Island (F. Verbelen). All 
sonograms are at equal scale. 
X-axis = time (0.5 seconds per 
tick), y-axis = frequency (2 kFLz 
per tick). Note the difference in 
song structure, frequency range 
as well as presence (e.g. D, E) or 
absence (e.g. F, G) of alternating 
low- and high-pitched elements 
among the taxa. 



6 -I 
■■1 
2 
0 



1.5 



2.5 3 
Time [sec] 



E 



1.5 2 2.5 
Time [sec] 



G 



12.5 



13 



13.5 14 
Time [sec] 



14.5 



3.5 

6 
4 
2 
0 



4.5 



F 



19 19.5 20 20.5 21 21.5 
Time [sec] 



15 



population is no exception. At any given site, R. teysmanni has a large structural repertoire 
in songs, although most motifs clearly belong to the same general theme. Individual and 
agitation-specific variability necessitates a thorough acoustic analysis to assign Peleng birds 
subspecifically. However, a comparison of the major vocal features characteristic of some of 
the taxa provides some clues. Songs from northern and central Sulawesi consist of tinkling 
notes at c.3-7 kHz which can rapidly alternate between high- and low-pitched elements 
(Fig. 17 A, C), although descending strophes are less common (Fig. 17B). In sulaensis from 



Frank E. Rheindt et al. 



203 



Bull. B.O.C. 2010 130(3) 



Taliabu (Fig. 17D-E), the overall frequency is considerably lower than on Sulawesi (only 
c.2-5 kHz). At the same time, higher pitched notes in the song of sulaensis are less intense 
than on Sulawesi and only sporadically intersperse the stronger succession of lower 
pitched notes. The latter frequently end on a descending theme (Fig. 17D-E). This often- 
rigid sequence gives the song of sulaensis a lower pitched, more repetitive and less variable 
impression than that of toradja and coomansi from Sulawesi. 

Compared to the Sulawesi and Sula taxa, the population on Peleng is vocally distinct. 
Throughout our time on Peleng, we have only noted a single constant song type comprising 
4-7 .descending notes falling from c.3-5 kHz (Fig. 17F-G). This song type lacks the 
interspersed higher pitched notes common in sulaensis (Fig. 17D-E) and also differs from 
the descending songs on mainland Sulawesi (Fig. 17B) by virtue of the much narrower 
frequency range and slower delivery. On account of its characteristic vocalisations, we 
suggest the Peleng population of R. teysmanni merits recognition at subspecies level. 
However, its description must await further analyses and the collection of specimens. 

GOLDEN WHISTLER Pachycephala pectoralis pelengensis 

One was mist-netted, measured and photographed near Lado at c.650 m (5 May 2007; MI). 
More recently, DDP trapped the species on several occasions in montane western Peleng. 
During their visit to the same area on 22-31 March 2009, FV & FER observed it commonly 
in degraded scrub to primary forest, from sea level to over 900 m. The species was also 
observed near sea level in lowland secondary forest and scrub on several occasions during 
the following weeks. The population on Banggai and Peleng is thought to represent an 
endemic subspecies P. p. pelengensis (White & Bruce 1986, Coates & Bishop 1997). Elevational 
data for this endemic subspecies have not been published to date. Our records reveal that 
P. p. pelengensis has a wide elevational range similar to that of neighbouring subspecies 
(Coates & Bishop 1997). 

DRAB WHISTLER Pachycephala griseonota 

Singles or pairs were seen on four occasions (24, 26 and twice on 28 March 2009) between 
750 m and over 900 m in primary and old secondary forest in western Peleng (FER, FV). 
On 7 April 2009, FV photographed the species in a mixed-species flock in secondary forest 
in eastern Peleng near Salakan at c.100 m (Fig. 18). Ours are the first records in the Banggai 
archipelago. Identification of this drab and inconspicuous species was based on the birds' 
dark facial coloration contrasting noticeably with the pale throat (Fig. 18). 

P. griseonota is considered endemic to the Moluccas (including Sula). It is represented 
by different subspecies on each of the major Moluccan archipelagos (White & Bruce 1986, 
Coates & Bishop 1997). The geographically proximate subspecies to Peleng is P. g. lineolata 
from the Sula Islands of Taliabu, Seho and Sanana (White & Bruce 1986, Coates & Bishop 
1997). Subspecies of P. griseonota differ quite remarkably in their main body coloration and 
potentially in song (Coates & Bishop 1997; FER pers. obs. on Bum and Seram). We did 
not knowingly hear any P. griseonota on Peleng. However, the birds we observed strongly 
resembled those seen and photographed on Taliabu by FER only a few days later (Rheindt 
2010). Based on this superficial resemblance, we suspect that the Peleng population is 
probably attributable to P. g. lineolata and does not deserve subspecific recognition, but this 
awaits confirmation. 

HELMETED MYNA Basilornis galeatus 

A few seen daily, and the species was photographed and sound-recorded from 700 m to 
over 900 m in western Peleng (FER, FV; 22-31 March 2009). Noted daily in the lowlands 



Frank E. Rheindt et al. 



204 



Bull. B.O.C. 2010 130(3) 



of Peleng on 5-9 April 2009 (FV) and 20-21 April 2009 (FER). Seen on numerous occasions 
at 500-800 m in western Peleng (MI) feeding on fruits in forest habitats, in flocks of up to 
14 (2 October 2004). The species was usually seen in secondary forest with large clearings. 
Endemic to the Banggai and Sula islands (White & Bruce 1986, Coates & Bishop 1997), 
records on Banggai and Peleng had previously not exceeded 200 m (Indrawan et al. 1997). 
Our records reveal that the elevational range in the Banggai archipelago matches that on 
Sula, where it has been recorded to 1,100 m (Davidson et al. 1991, Coates & Bishop 1997, 
Stones et al 1997; FER pers. obs.). 

SULAWESI MYZOMELA Myzomela chloroptera (undescribed species?) 
Males and females were seen and photographed almost daily at flowering shrubs and trees 
in clearings and the forest interior in western Peleng, from 700 m to over 900 m (FY & FER; 
23-30 March 2009). These are the first records on Peleng, although K. D. Bishop saw an 
unidentified small honeyeater on Banggai Island in November 1981 (White & Bruce 1986). 
The identification of our birds was unambiguous, as there are no confusion species in the 
region with similar red (male) or red-faced (female) plumages. 

We regard Sulawesi Myzomela M. chloroptera as specifically distinct from neighbouring 
taxa (e.g. Wakolo Myzomela M. wakoloensis, Banda Myzomela M. boiei and Scarlet Myzomela 
M. sanguinolenta) based on plumage differences (following Salomonsen 1967, Wolters 1979, 
Rheindt & Hutchinson 2007, Higgins et ah 2008). From our brief observations, the birds 
on Peleng did not noticeably differ from those on mainland Sulawesi and Taliabu (Sula 
Islands). The species was found on Taliabu <20 years ago and the discoverers suggested 
it might represent an undescribed subspecies (Davidson et al. 1991, Stones et al. 1997). 
Meanwhile, most authors have provisionally subsumed the Taliabu population under 
nominate M. chloroptera from north and central Sulawesi, whilst acknowledging that future 
research may reveal it to be a new subspecies (Coates & Bishop 1997, Higgins et al. 2008). 
Further studies are needed to determine whether the population on Peleng merits treatment 
as an endemic subspecies or should be included within the nominate race from Sulawesi 
Alternatively, the Peleng birds may prove more closely related to the Taliabu population 
and may together form a novel subspecies. 

BLACK SUNBIRD Nectarinia aspasia auriceps 

Small numbers observed approximately once everv two days at flowering shrubs and 
trees in habitats from degraded orchards to undisturbed montane forest in "western Peleng, 
from sea level to over 900 m (FER, FV; 22-31 March 2009). Although previously recorded 
on Peleng, no elevational data have been published from there. Coates & Bishop (1997) 
placed the upper elevation on Sulawesi at 800 m, whilst Davidson et al. (1991) recorded the 
species to c.450 m on Taliabu. However, recent field observations indicate that these upper 
elevational limits for Sulawesi and Taliabu are too low by at least 300 m on both islands 
(FER pers. obs.). Our Peleng records reconfirm the broad elevational range of this taxon on 
smaller Wallacean islands. 

GREY-SIDED FLOWERPECKER Dicaeum celebicum sulaense 

Observed in a wide range of wooded habitats in western Peleng, from near sea level to above 
900 m (FER, FV; 22-31 March 2009). MI encountered it over a similarly wide elevational and 
habitat range. The population on the Banggai Islands is attributed to D. c. sulaense which 
otherwise occurs in the Sula archipelago (White & Bruce 1986, Coates & Bishop 1997), and 
indeed the distinctive grev (rather than black) abdominal stripe of this subspecies was 
visible on several males. No previous elevational data have been published for the Banggai 



Frank E. Rheindt et al. 



205 



Bull. B.O.C. 2010 130(3) 



Islands, although it occurs to 800+ m on Taliabu in the Sula Islands (Davidson et al. 1991, 
Coates & Bishop 1997, Stones et al. 1997). 

Discussion 

We provide details of 16 new bird records for the Banggai Islands, including at least one 
species (Teleng Leaf Warbler' Phylloscopus taxon novum) — and potentially five subspecies — 
that may be new taxa to science. New island records generally pertain to montane species 
that have previously gone unnoticed because most field workers have operated mainly 
in the lowlands (Ducula forsteni, Ptilinopus superbus, Orthotomns cucullatus, Myzomela 
chloroptera, Khipidura teysmanni and Phylloscopus taxon novum). On the other hand, several 
species might have been overlooked in the past due to their shy or inconspicuous nature, 
and because knowledge of their voice is prerequisite for detecting them (e.g. Surniculus 
lugubris and Locustella fasciolata). Other species may have avoided detection because they 
are difficult to identify in the field (e.g. Aerodramus vanikorensis, A. sororum, Corvus erica, 
L. fasciolata, Phylloscopus borealis, Phylloscopus taxon novum, and Pachycephala griseonota). 
One new record refers to a passage migrant that only occurs in the region during a short 
period (Hirundapus caudacutus), and two other new records pertain to species that may have 
expanded their ranges recently (Hieraaetus kienerii and Streptopelia chinensis). 

Twelve of our 16 new bird records refer to species that occur both to the east (Sula 
Islands) and to the north / west (Sulawesi): Hieraaetus kienerii, Ducula forsteni, Streptopelia 
chinensis, Hirundapus caudacutus, Aerodramus vanikorensis, A. sororum, Corvus enca, Locustella 
fasciolata, Phylloscopus borealis, Orthotomus cucullatus, Myzomela chloroptera and Khipidura 
teysmanni. These new records close an artefactual gap in their species' distributions. On the 
other hand, two of the new Banggai species are absent from the Sula archipelago, although 
they do occur on Sulawesi: Ptilinopus superbus and Surniculus lugubris. For these two, our 
new records establish a slight range extension from Sulawesi to its eastern satellite islands, 
although P. superbus also occurs on some of the northern Moluccas, rendering its absence 
on Taliabu even more surprising. Most significantly, one or two new Banggai records are 
of species that otherwise occur only to the east in the Sula archipelago and the Moluccas: 
Pachycephala griseonota and Phylloscopus poliocephalus. The latter is probably the species 
complex most closely related to the new Teleng Leaf Warbler' (unpubl. data). For these two 
species complexes, our new Banggai records constitute a considerable range extension from 
the Moluccas to Peleng in the immediate vicinity of Sulawesi. 

Finally, our field work has uncovered new taxonomic information not only pertaining 
to the new Phylloscopus taxon, but also the uncertain taxonomic affinities of several 
Banggai birds. Observations and photographs highlight the confusing taxonomic situation 
in Dicrurus hottentottus and suggest that the current treatment of Banggai birds within 
Sulawesi D. h. leucops is flawed. Novel morphological data call into question previous 
taxonomic treatment of the Banggai population of Prioniturus platurus. A population 
of Khipidura teysmanni on Peleng appears to be vocally distinct and — if corroborated — 
deserves recognition at subspecies level. Similarly, our vocal data are strongly suggestive of 
biological species status for Zosterops (atrifrons) subatrifrons, although we prefer to maintain 
subspecific treatment pending further data. Finally, sound-recordings demonstrate that 
Pitta erythrogaster dohertyi (occasionally treated as a species) should be treated at subspecific 
rank. 



Acknowledgements 

FER is indebted to Ditta-Sofie Rheindt for funding to facilitate this research. FV thanks his employer, 
Greenpeace Belgium, for permitting him sabbatical leave. Mi's surveys were supported by Nagao — Natural 



Frank E. Rheindt et al. 



206 



Bull. B.O.C. 2010 130(3) 



Environmental Funding (NEF), British Birds and Zoologische Gesellschaft fur Arten- und Populationsschutz 
e.V. (ZGAP). Rob O. Hutchinson kindly commented on an early draft of this paper. We owe a debt of 
gratitude to Pamela Rasmussen and Colin Trainor for refereeing this paper and providing helpful comments, 
as well as to Guv Kirwan for much-appreciated editorial assistance. Thanks are due to the people of 
Tetendeng village for sharing their indigenous knowledge. 

References: 

Becker, J. J., Sandwell, D. T v Smith, W. H. F., Brand, J v Binder, B., Depner, J., Fabre, D., Factor, J., Ingalls, S., 

Kim, S.-H., Ladner, R., Marks, K., Nelson, S., Pharaoh, A., Sharman, G., Trimmer, R., von Rosenburg, J., 

Wallace, G. & Weatherall, P. 2009. Global bathvmetrv and elevation data at 30 arc seconds resolution: 

SRTM30_PLUS. Marine Geodesy 32: 355-371. 
Bintanja, R., van de Wal, R. S. W. & Oerlemans, J. 2005. Modelled atmospheric temperatures and global sea 

level over the past million years. Nature 437: 125-128. 
Caputo, R. 2007. Sea level curves: perplexities of an end-user in morphotectonic applications. Global & 

Planetary Change 57: 417-423. 
CBC (Celebes Bird Club). 2006. Pengamatan bnrung di Pulau Peleng, Kepulauan Banggai, Sulawesi Tengah [Bird 

observations on Peleng Island, Banggai Islands, Central Sulawesi]. Cyclostyled manuscript. 
CBC (Celebes Bird Club). 2007. Laporan survey gagak Banggai Corvus unicolor di Pulau Peleng, Kepulauan 

Banggai, Provinsi Sulawesi Tengah [Observations on the Banggai Crow Corcus unicolor on Peleng Island, 

Banggai Islands, Central Sulawesi Province]. Cvclostvled manuscript. 
CBC (Celebes Bird Club). 2008. Pengamatan burung di Pulau Banggai dan Pulau Peleng, Kepulauan Baiiggai, 

Sulawesi Tengah [Bird observations on Banggai Island and Peleng Island, Banggai Islands, Central 

Sulawesi]. Cvclostvled manuscript. 
Clement, P. & Hathway, R. 2000. Tlirushes. Christopher Helm, London. 

Coates, B. J. & Bishop, K. D. 1997. A field guide to the birds ofWallacea. Dove Publications, Alderley. 
Collar, N. J. 2004. Species limits in some Indonesian thrushes. Torktail 20: 71-87. 

Collar, N. J. 2007. Taxonomic notes on some insular Loriculus hanging-parrots. Bull. Brit. Orn. CI. 127: 
97-107. 

Davidson, P. J. & Stones, T. 1993. Birding in the Sula Islands. Oriental Bird CI. Bull. 18: 59-63. 

Davidson, P. J., Lucking, R. S., Stones, A. J., Bean, N. J., Raharjaningtrah, W. & Banjaransari, H. 1991. Report 

on an ornithological survey ofTaliabu, Indonesia. Univ. of East Anglia, Norwich. 
Davidson, P., Stones, T. & Lucking, R. S. 1995. The conservation status of kev bird species on Taliabu and the 

Sula Islands, Indonesia. Bird Conserv. Intern. 5: 1-20. 
Erritzoe, J. 2003. Family Pittidae (pittas). Pp. 106-160 in del Hovo, I., Elliott, A. & Christie, D. A. (eds.) 

Handbook of the birds of the world, vol. 8. Lvnx Edicions, Barcelona. 
Fishpool, L. D. C. & Tobias, J. A. 2005. Family Pycnonotidae (bulbuls). Pp. 124-251 in del Hoyo, J., Elliott, A. 

& Christie, D. A. (eds.) Handbook of the birds of the world, vol. 10. Lynx Edicions, Barcelona. 
Hall, R. 2002. Cenozoic geological and plate tectonic evolution of Southeast Asia and the southwest Pacific: 

computer-based reconstructions, models and animations. J Asian Earth Sci. 20: 353—431. 
Higgins, P., Christidis, L. & Ford, H. 2008. Family Meliphagidae (honey eaters). Pp. 498-691 in del Hoyo, J., 

Elliott, A. & Christie, D. A. (eds.) Handbook of the birds of the -world, vol. 13. Lvnx Edicions, Barcelona. 
ICBP. 1992. Putting biodiversihj on the map: priorih/ areas for global conservation. International Council for Bird 

Preservation, Cambridge, UK. 
Indrawan, M. 2004. Avifaunal distribution and endemism in the Togian Islands, central Sulawesi, Indonesia. 

Ph.D. dissertation. Univ. of Indonesia, Jakarta. 
Indrawan, M., Fujita, M. S., Masala, Y. & Pesik, L. 1993. Status and conservation of Sula Scrubfowl [Megapbdius 

bernsteinii Schlegel 1866) in Banggai Islands, Sulawesi. Trop. Biodiver. 1: 113-130. 
Indrawan, M., Masala, Y. & Pesik, L. 1997. Recent bird observations from the Banggai Islands. Kukila 9: 

61-70. 

Indrawan, M., Masala, Y. & Pesik, L. 1998. Observations on the breeding behaviour of Sula Scrubfowl 
Megapodius bernsteinii in the Banggai Islands, Sulawesi, Indonesia. Torktail 13: 13-16. 

Indrawan, M., Rasmussen, P. C. & Sunarto. 2008. A new white-eve Zosterops from the Togian Islands, 
Sulawesi, Indonesia. Wilson J. Orn. 120: 1-9. 

Indrawan, M., Masala, Y. & Maleso, A. 2009. Leap of faith of the unconverted: participatory action research in 
Banggai Is., Central Sulawesi, Indonesia. Contribution to the Third International Field Ecology Symposium: 
assessing and restoring biodiversity in a human dominated landscape. Chiang Mai, Thailand, 12-15 Feb. 
2009. 

Indrawan, M., Masala, Y., Dwiputra, D., Nur, F., Mallo, Maleso, A., Salim, A., Masala, F., Tinulele, I., Pesik, 
I .. Katiandagho, D. S. & Sunosol (2010) Rediscovery of the Critically Endangered Banggai Crow Corvus 
unicolor, on Peleng Island, Indonesia, part 1: ecology. Bull. Brit. Orn. CI. 130: 154-165. 

Lambeck, K. & Chappell, J. 2001. Sea level change through the last glacial cycle. Science 292: 679-686. 

Lambert, F. & Woodcock, M. 1996. Pittas, broadbiUs and asities. Pica Press, Robertsbridge. 



Frank E. Rheindt et al. 



207 



Bull. B.O.C. 2010 130(3) 



Mallo, F. N., Putra, D. D., Rasmussen, P. C, Herlina, Somadikarta, S., Indrawan, M., Darjono, Mallo, I. 
N., Sweet, P., Rahman, A., Raharjaningtrah, W., Masala, Y. & Verbelen, P. (2010) Rediscovery of the 
Critically Endangered Banggai Crow Corvus unicolor on Peleng Island, Indonesia, part 2: taxonomy. 
Bull. Brit. Orn. CI. 130: 166-180. 

Rasmussen, P. C, Wardill, J. C, Lambert, F. R. & Riley, J. 2000. On the specific status of the Sangihe White- 
eye Zosterops nehrkorni, and the taxonomy of the Black-crowned White-eye Z. atrifrons complex. Forktail 
16: 69-80. 

Rheindt, F. E. 2010. New biogeographic records for the avifauna of Taliabu (Sula Islands, Indonesia), with 

preliminary documentation of two previously undiscovered taxa. Bull. Brit. Orn. CI. 130: 33-51. 
Rheindt, F. E. & Hutchinson, R. O. 2007. A photoshot odyssey through the confused avian taxonomy of 

Seram and Bum (southern Moluccas). BirdingASIA 7: 18-38. 
Rheiridt, F. E. & Verbelen, F. In prep. Species limits in the Maroon-chinned Fruit Dove Ptilinopus subgularis. 
Salomonsen, F. 1967. Family Meliphagidae, honeyeaters. Pp. 338-450 in Paynter, R. A. (ed.) Check-list of birds 

of the world, vol. 12. Mus. Comp. Zool., Cambridge, MA. 
Sibley, C. G. & Monroe, B. L. 1990. Distribution and taxonomy of the birds of the world. Yale Univ. Press, New 

Haven, CT. 

Siddall, M., Rohling, E. J., Almogi-Labin, A., Hemleben, C, Meischner, D., Schmelzer, I. & Smeed, D. A. 2003. 

Sea-level fluctuations during the last glacial cycle. Nature 423: 853-858. 
Stattersfield, A. J., Crosby, M. J., Long, A. J. & Wege, D. C. 1998. Endemic Bird Areas of the world: priorities for 

biodiversity conservation. BirdLife International, Cambridge, UK. 
Stones, A. J., Lucking R. S., Davidson P. J. & Raharjaningtrah, W. 1997. Checklist of the birds of the Sula 

Islands (1991), with particular reference to Taliabu. Kukila 9: 37-55. 
Sujatnika, Jepson, P., Soehartono, T. R., Crosby, M. J. & Mardiastuti, A. 1996. Indonesian biodiversity: the 

Endemic Bird Area approach. PHPA / BirdLife International-Indonesia Programme. 
Thompson, W. G. & Goldstein, S. L. 2005. Open-system coral ages reveal persistent suborbital sea-level 

cycles. Science 308: 401-404. 
Voris, H. K. 2000. Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time 

durations. /. Biogeogr. 27: 1153-1167. 
White, C. M. N. & Bruce, M. D. 1986. The birds of Wallacea (Sulawesi, the Moluccas and Lesser Sunda Islands, 

Indonesia): an annotated check-list. BOU Check-list No. 7. British Ornithologists' Union, Tring. 
Wolters, H. E. 1979. Die Vogelarten der Erde, Bd. 4. Paul Parey, Hamburg. 

Addresses: Frank E. Rheindt, Harvard University, Department of Organismic & Evolutionary Biology, 26 
Oxford Street, Cambridge, MA 02138, USA, e-mail: FrankRlieindt@yahoo.com.au. Filip Verbelen, 
Torrekensstraat 41, 9820 Munte-Merelbeke, Belgium, e-mail: Filip_Verbelen@yahoo.fr. Dadang Dwi 
Putra, e-mail: celebesbirdclub@yahoo.com. Mochamad Indrawan, e-mail: jamblang@cbn.net.id 

© British Ornithologists' Club 2010 



Appendix 

Because Fig. 6 in Rheindt (2010, Bull. Brit. Orn. CI. 130: 33-51) was not printed correctly, we take the 
opportunity to reproduce it here. Sonograms of vocalisations of Bradypterus bush warblers. X-axis = time 
in seconds (0.5 seconds per tick), y-axis = frequency in kHz (2 kHz per tick). All sonograms are at identical 
scale. (A) Taliabu' Bush Warbler Bradypterus sp. by F. E. Rheindt (April 2009, Taliabu); (B) Benguet Bush 
Warbler B. seebohmi by R. O. Hutchinson (February 2007, Mount Polis, Luzon, Philippines); (C) Russet 
Bush Warbler B. mandelli by D. Farrow (no date, 
Thailand, source: www.xeno-canto.org/asia); (D) 
Chestnut-backed Bush Warbler B. c. castaneus by 
P. Noakes (September 2006, Lore Lindu, central 
Sulawesi; source: www.xeno-canto.org/asia); (E) 
Chestnut-backed Bush Warbler B. c. musculus by R. 
O. Hutchinson (September 2006, Kobipoto Ridge, 
Seram). Dark areas below 5 kHz in sonogram A 
are mechanical sound pollution from equipment. 
Note that the undescribed Taliabu birds (A) 
more closely resemble B. mandelli (C) in terms of 
frequency (centred around 6 kHz), and resemble 
B. mandelli (C) and B. seebohmi (B) in exhibiting 
a single repeated call element, as opposed to the 
B. castaneus complex (D, E) whose vocalisations 
involve 2-3 call elements given in rapid succession. 
In acoustic impression, Taliabu birds are most 
similar but not identical to B. mandelli. 



















is I 


B 






j 1 41 1 c 






D 













Golo Maurer et al. 



208 



Bull. B.O.C. 2010 130(3) 



The eggs of the extinct Egyptian population of 
White-tailed Eagle Haliaeetus albicilla 

by Golo Maurer, Douglas G. D. Russell, Friederike Woog & Phillip Cassey 

Received 26 November 2009 

Summary. — Little is known concerning the biology of the now extinct Egyptian 
population of White-tailed Eagle Haliaeetus albicilla, and few specimens remain 
in museums to assess its alleged subspecific status. Here we describe three eggs 
collected near Lake Manzala and review the collection data and anecdotal reports 
about this species, to provide a better understanding of the biology of White-tailed 
Eagles in this southernmost part of their former breeding range. 

White-tailed Eagle Haliaeetus albicilla is now a rare and irregular winter visitor to Egypt 
(Goodman & Meininger 1989), but has long been claimed as a former breeding bird at the 
lakes of lower Egypt (Meinertzhagen 1930, Cramp & Simmons 1980, Goodman & Meininger 
1989). These claims are based solely on 19th-century published descriptions by the German 
explorers and ornithologists Martin Theodor von Heuglin (1824-76) and Alfred Edmund 
Brehm (1829-84), and observations by the British politician and agriculturalist, the Hon. 
Murray Finch-Hatton, 12th Earl of Winchilsea and seventh Earl of Nottingham (1851-98). 

Until now, data on egg specimens in museum collections have not been used to 
corroborate breeding by White-tailed Eagle in Egypt. The recent discovery of a single 
Egyptian H. albicilla egg amongst unregistered material at the Natural History Museum 
(NHM), Tring, has provided the opportunity to re-examine evidence of breeding bv H. 
albicilla in Egypt and to summarise published and specimen breeding data. In total, just 
three eggs of the Egyptian White-tailed Eagle are currently known in museums: the NHM 
Tring specimen and a clutch of two eggs held in Stuttgart at the Staatliches Museum fur 
Naturkunde (SMNS). 

Evidence of Haliaeetus albicilla breeding in Egypt 

The isolation of the Egyptian population from the White-tailed Eagle's core range and 
its supposed morphological distinctiveness from northern populations led both Theodor 
von Heuglin (1856) and A. E. Brehm (1856) to describe it as a new species from the environs 
of Lake Manzala: Haliaeetus cinereus von Heuglin, 1856 (February) and Haliaeetus funereus 
A. E. Brehm, 1856 (May / June) (Fig. 1). Both names were first published as nomina nuda by 
Brehm's father, Christian Ludwig Brehm (Brehm 1855). Sharpe (1874) only noted the use 
by Ludwig Brehm, placing both H. cinereus and H. funereus in synonymy with H. albicilla 
(Linnaeus, 1758) where they have remained. 

Travel in 1847-53 with Johann Wilhelm von Miiller (as secretary and assistant) gave 
A. E. Brehm his first opportunity to collect and study the birds of Egypt In an account 
on Haliaeetus species from Egypt, Brehm (1856) described White-tailed Eagles as follows: 
'During winter one can see one of them regularly on the lakes of lower and central Egypt, 
which to me appears to differ from Hal albicillus, which is why I consider it as a distinct, 
independent species. The bird stays in Egypt long into spring and, according to my Arab 
hunters, breeds at Lake Men/aleh [sic]' (translated from German b\ CM & F\V). 

At around the same time, in the early 1850s, von Heuglin also visited Egypt. His 
short (1856) description of White-tailed Eagles there stated: 'On the lakes of lower Egypt 



Golo Maurer et al. 



209 



Bull. B.O.C. 2010 130(3) 



lives a white-tailed sea eagle, which may differ from the northern one or at least represent 
a constant climatic variety. Specifically, the adult bird is completely ash-grey and the 
white tail-feathers, namely the outer ones, are speckled brownish on their outer vanes. 
Furthermore it may generally have somewhat smaller proportions. Near Damiette [sic] it is 
called 'Oqab' [name in Arabic] or Shometta [name in Arabic] and breeds there on collapsed 
reed stems in Arundo donax [giant cane] etc. — Should it prove to be a new species, I suggest 
the name Haliaetos cinerens for it.' (Translated from German by GM & FW.) 

In his later account of Egyptian White-tailed Eagles, von Heuglin (1869) made no 
reference to either his or Brehm's 1856 taxonomic descriptions, but again alluded to the 
population's distinctiveness and behaviour: 'The white-tailed sea eagle of Egypt can 
perhaps be regarded as a separate, smaller, climatic variety. It lives, in our experience, as a 
resident around the lagoons of lower Egypt, namely on lake Mazalah [sic]. Usually one sees 
it in pairs, even during winter, when incidentally the number of these audacious raptors 
is perhaps augmented by northern visitors. [ . . . ] In the extensive reed-forests around the 
Behereh (Lake Manzalah [sic] and surroundings) our bird builds its large nest in March. 
Here it often lacks suitable trees, it therefore resorts to the reed beds. In the tallest, densest 
and most impenetrable parts it folds reed stems in an area of a fathom until they form a solid 
basis for the actual nest which stands only a few feet above water level and is protected by 
overhanging reeds. A very large and flat nest stood on top of several acacia trees 2-3 feet in 
height, which shaded a low dune. We received a clutch with two almost un-incubated eggs; 
they are bluntly egg-shaped of 2". 7"' in length by 2".l'" in width, somewhat rough-shelled, 
dirty blue-greenish white with a few washed-out brown blotches and at different parts, 
finely speckled dark brown. On the Red Sea or the actual Nile I have never encountered the 
sea eagle.' (Translated from German by GM & FW.) 

Contradicting these descriptions of von Heuglin and Brehm, Saunders who examined 
skins obtained by Murray Finch-Hatton (Table 1) noted they were: 'very white around the 
head but not more so than in many European examples' (Meinertzhagen 1930). Von Heuglin 
gave some of his eggs collected in Africa to Richard Freiherr von Koenig-Warthausen for 
later description (Heuglin 1869). After his death in 1911, Koenig-Warthausen's egg collection 
remained at the residential castle of Sommershausen. In 1955, the collection comprising 
c. 12,500 eggs was donated to the SMNS by Elisabeth Baronin von Koenig-Warthausen. This 
egg collection holds two likely candidate eggs (Fig. 2) and information on the label (in the 
hand of Koenig-Warthausen) stored with these eggs states: 

Aegyptischer See=Adler, Haliaetos albicilla cinereus v. Heugl. 
Africa, Aegypten. Damiette [sic], 12 April 1861, 2 St. Gelege. Dr. Th. v. Heuglin. 
Nest auf einem Hiigelrucken auf Mimosengebiisch hoch aufgethurmt; briitet auch auf 
zusammen=geknickten Stengeln von Arundo donax. 
(Der alte Vogel ganz aschgrau mit aussen braunlich bespritzten Fahnen 
der weifien Schwanzfedern.) 



Egyptian Sea Eagle, Haliaetos albicilla var. cinereus v. Heugl. 
Africa, Egypt, Damietta, 12 April 1861, two specimens [in] clutch. Dr. Th. v. Heuglin. 
Nest on a ridge on a Mimosa shrub stacked tall; breeds also on folded stems of 

Arundo donax. 

(The adult bird is ash-grey with outer vanes of white tail-feathers maculated brownish). 
(Translated from the original German by GM & FW) 



Golo Maurer et al. 



210 



Bull. B.O.C. 2010 130(3) 



TABLE 1 



Collection data and measurements of known skin and egg specimens of White-tailed Eagles Haliaeetus 
albicilla from the Egyptian population. The mean and minimum measurements in the two bottom rows are 
based on 150 H. albicilla eggs from the core breeding range (Schonwetter 1960-92). 



Institution 


Specimen 


Register 


Collector 


Locality 


Date 


Length mm 


Breadth 


Weight 






number 








(inches) 


mm 


(g) 


AMNH 


Skin, Lectotype 


535537 


A. E. Brehm 


L. Menzaleh 


2.6. 1849 




(inches) 


Unknown 


Skin, Holotype? Unknown 


Heuglin 


Damiette 


Unknown 








Unknown 


Skin 


Unknown 


Finch-Hatton 


L. Menzaleh 


1873 








Unknown 


Skin 


Unknown 


Finch-Hatton 


L. Menzaleh 


1873 








Unknown 


Skin 


Unknown 


Unknown 


Desert of Suez 










SMNS 


Egg 


76113 


Heuglin 


Damiette 


12.4.1861 


68.6 (2.70) 


55.4 (2.18) 


10.7 


SMNS 


Egg 


76113 


Heuglin 


Damiette 


12.4.1861 


71.0 (2.79) 


56.8 (2.24) 


14.3 


NHM 


Egg 


2009.2.1 


Finch-Hatton 


L. Menzaleh 


11.1.1873 


72.1 (2.84) 


58.4 (2.29) 


14.7 


Schonwetter (1960-92) mean egg dimensions 






74.7 


57.1 


14.0 


Schonwetter (1960-92) minimum egg dimensions 






66.0 


53.0 


11.35 



This match between the published account (Heuglin 1869) and the label suggests that 
the SMNS eggs were obtained but not collected by Heuglin himself (other specimens in 
the Warthausen collection suggest he was near Sakkara at the time). Furthermore, the 
single measurement given for the two eggs matches the smaller of the two eggs held at the 
SMNS exactly. Heuglin (1869) also contains a colour reproduction of one of the H. albicilla 
eggs, which despite some 'artistic licence' is similar to the larger SMNS egg in pattern at 
the pointed, but not the blunt end. Despite Heuglin's detailed description, Shellev (1871) 
doubted the breeding of H. albicilla in Egypt. In contrast, Gurney (1871) drew attention 
to Heuglin's account, as well as noting an immature specimen from the 'Desert of Suez', 
Egypt, in the Museum of the Jardin des Plantes, Paris. 

The third egg (Fig. 3), held in Tring, has no accompanying label or other written 
documentation, but is legibly inscribed 'Haliaeetus albicilla, Lake Menzaleh [sic], 11 Jan 1873'. 
No further information as to the collector is recorded, but there is strong circumstantial 
evidence implicating Finch-Hatton. Meinertzhagen (1930) quoted, but gave no date for, 
correspondence between Finch-Hatton and the well-known British ornithologist, Howard 
Saunders (1835-1907) describing H. albicilla breeding in Egypt: ' . . . several nests of this 
species were found upon the ground in the reedy marshes of Lake Menzaleh [sic], and two 
adults were shot'. Saunders (1889) gave further details of nests found by Finch-Hatton: 'One 
found by the Hon. Murray Finch-Hatton (now Lord Winchilsea) in the marshes of Lower 
Egypt, resembled a gigantic nest of the Marsh-Harrier [Circus aeruginosus], being raised to 
a considerable height above the deep mud by which it was surrounded. Eggs, usually 2 
in number, dull white in colour, and measuring about 2'85 by 2'2 in., arc laid in Scotland 
in April; but as early as February or March in the southeast of Europe, and January in 
Egypt'. 

Saunders' account is significant for two reasons: firstly; he specifically mentioned 
Egyptian H. albicilla breeding in January rather than April; secondly, the measurements he 
quoted are very close to those of the NHM egg (Table 1). This suggests that Saunders may 
well have known details of or possessed the NHM egg at some point. Moreover, although 
the exact timing and details of Finch-Hatton's Egyptian visit are uncertain, it is clear that 
he was in Egypt at the time the egg was collected, as Chennells (1893) included reference 



Golo Maurer et al. 



211 



Bull. B.O.C. 2010 130(3) 




Figure 1. AMNH 535537, holotype of Haliaeetus funereus, from Lake Menzaleh [sic], Egypt, 2 June 1849. Top 
left and right: the same specimen in lateral and dorsal views. White tail-feathers but grey back eliminate both 
Pallas's H. leucoryphus and African Fish Eagles H. vocifer. Original label (bottom left) states that the plumage 
was worn on collection. Bottom right, AMNH label (Matt Shanley, © American Museum of Natural History, 
New York) 



^7*if^~ e^uiu iHOft. 

ajfrr- ""^f'- &-■-■<«•, it JjMt '■Zff-- * ■ 



■ 



Figure 2. SMNS 76113, Haliaeetus albicilla, Damiette, Egypt, 12 April 1861. Presumed clutch of two and 
accompanying handwritten label; size bar in mm (Friederike Woog, © Staatliches Museum fur Naturkunde, 
Stuttgart) 

Figure 3. BMNH E/2009.2.1, Haliaeetus albicilla, Lake Menzaleh [sic], Egypt, 11 January 1873 (four 90° 
rotations of the single egg on its polar axis); size bar in mm (Harry Taylor, © The Natural History Museum, 
Tring) 



Golo Maurer et al. 



212 



Bull. B.O.C. 2010 130(3) 



to his return from a voyage up the Nile to Shepheard's Hotel, Cairo, circa March 1873. 
Finch-Hatton was also well known for his 'eclectic pastimes' which included 'climbing 
(often up cliffs in pursuit of eagles' eggs, which he collected)' (Readman 2006). Although 
circumstantial, we propose it is likely that he collected the NHM egg during this trip, later 
corresponding with Howard Saunders on the subject. 

The NHM has no record of receiving an egg collection from Finch-Hatton, but did 
receive portions of Howard Saunders's collection both directly and via other collectors who 
obtained material from his collection, notably Henry Seebohm (1832-95) and the Revd. 
Francis Jourdain (1865-1940). In conclusion, the NHM egg was possibly collected by Finch- 
Hatton, later passed to Howard Saunders and came either directly to the NHM or indirectly 
with the Jourdain or Seebohm collections. 

No further eggs or skins (Table 1) appear to have been taken after 1873, which thus 
marks the last confirmed breeding in Egypt. Meinertzhagen (1930) noted that the eagles no 
longer bred at Manzala. The reasons for the population's disappearance remain uncertain. 
It is clear, however, that Lake Manzala, and its environs, experienced dramatic localised 
changes in the late 1800s: e.g. the establishment of Port Said, the building and opening of 
the Suez Canal in 1869, changes in agriculture, increasing commerce and early tourism all 
had significant effects on the flora and fauna of the area. Ebers (1878) noted: It is towards 
the north, in the vicinity of the lake of Menzaleh [sic], that the nature of the land seems to 
have undergone the most conspicuous change. Where formerly the Semitic herdsman could 
pasture innumerable cattle on the rich marshy land lie pools of bitter, brackish water'. 

We compared the eggs described with those collected from more temperate populations. 
Visually none of the three eggs differs from those of other White-tailed Eagles (Table 1). 
Equal-variance f-tests comparing the mean length, width and weight of the Egyptian 
population to the published average for H. albicilla eggs (Schonwetter 1960-92) were also 
non-significant (t 2 = -2.00, p = 0.18; t 2 = -0.14, p = 0.91; t 2 = -0.30, p = 0.79, respectively). The 
eggs also fall within the size range of eggs laid by two other Haliaeetus species reported 
as vagrants from Egypt, African Fish Eagle H. vocifer (Goodman & Meininger 1989) and, 
doubtfully, Pallas's Fish Eagle H. leucoryphus (Meinertzhagen 1930, Schonwetter 1960-92). 
The description of the Mimosa bush nest site bears resemblance to typical nesting sites of the 
Lappet-faced Vulture Torgos tracheliotus, but its eggs exceed in length those described here 
by at least 1 cm (Schonwetter 1960-92). 

Discussion 

The eggs described here corroborate the existence of a breeding population of H. 
albicilla in Egypt in the mid 1800s. This population represented one of only two breeding 
populations of the species in Africa and was at the southernmost limit of the White-tailed 
Eagle's range (Cramp & Simmons 1980, BirdLife International 2009). Other breeding 
attempts almost as far south have been reported for Algeria, Israel Syria, northern Iran and 
central Iraq, all of which populations are now believed extinct, except that in northern Iran 
(Evans 1994, Shirihai 1996, Isenmann & Moali 2000, Murdoch & Betton 2009). All three eggs 
were collected near Damietta at Lake Manzala (31°27'N, 31°50'E), and the spread of years 
of specimen collection, from the lectotype of H. funereus in 1849 (Hartert 1918) to the eggs 
in 1861 and 1873, suggests that White-tailed Eagles inhabited Lake Manzala continuously 
and were not just sporadic breeders as they were elsewhere in the south of their range, e.g. 
in Israel (Cramp & Simmons 1980). This period also stretches beyond the 20 years of known 
maximum age of H. albicilla (Cramp & Simmons 1980) further supporting the idea of an 
established breeding population at Lake Manzala. 



Golo Maurer et al. 



213 



Bull. B.O.C. 2010 130(3) 



The Egyptian H. albicilla eggs held at NHM and SMNS provide an opportunity to 
investigate the biology of this extinct population of White-tailed Eagles. Detailed study of 
the egg shells might reveal adaptations in pore density or shell thickness that could help to 
regulate water loss (Ar et al. 1974) in the hot climate of Lake Manzala, which differs from 
the cooler conditions of the eagle's core range (Cramp & Simmons 1980). However, we 
found no immediately obvious difference in size or appearance between the eggs described 
here and those of more northern populations. In addition, invasive techniques such as 
genetic sampling of the eggshell membrane (Lee & Prys-Jones 2008) might help clarify the 
taxdnomic status of the Egyptian White-tailed Eagles. Similarly, stable isotope analysis of 
shell membranes (Oppel et al. 2009) could assist in clarifying their taxonomic status and 
reveal whether they relied more on fish or waterbirds as food sources during egg laying. 

The descriptions of the Egyptian White-tailed Eagles and the data accompanying the 
eggs highlight two aspects of breeding biology in particular that set apart these populations 
from their northern conspecifics, regardless of taxonomic status: (1) an unusual choice of 
nest site and (2) an extended laying period of at least 6-7 months. Egyptian White-tailed 
Eagles at Manzala did not use the typically preferred nest sites of the species such as steep 
slopes, cliffs or trees (Cramp & Simmons 1980), but used low bushes or reed nests instead. 
In most extant populations of White-tailed Eagle, except Iceland, ground nesting is atypical, 
and occurs usually on islets or a small rocky island or skerry (Cramp & Simmons 1980); to 
our knowledge, nesting in reeds is unknown in extant populations. The slightly smaller 
Pallas's Fish Eagle, in contrast, regularly nests in reedbeds (Cramp & Simmons 1980). 

The eggs of White-tailed Eagle are similar in size and appearance to those of African 
and Pallas's Fish Eagles. Nonetheless, it seems unlikely that the specimens described here 
are eggs of either species. While the nest type might suggest Pallas's Fish Eagle, this species 
has been recorded as a vagrant to Egypt only once (Meinertzhagen 1930) and the sight 
record is considered doubtful (Goodman & Meininger 1989). Furthermore, Heuglin (1869) 
describes the Haliaeetus of Egypt as having white tail-feathers, lacking the distinctive black 
terminal band of Pallas's Fish Eagle, and the extant specimen clearly is Haliaeetus albicilla 
(P. R. Sweet pers. comm.). African Fish Eagle, too, is only a straggler to Egypt (Goodman & 
Meininger 1989) and Heuglin would surely have reported the presence of this very vocal 
eagle at Lake Manzala, as he was familiar with the species from the Blue and White Niles 
(Heuglin 1869). 

The laying period of the Egyptian White-tailed Eagles seems to have extended over 
most of the autumn to spring (October- April). The letter from Finch-Hatton quoted by 
Meinertzhagen (1930) states that young were close to fledging in January. Assuming 38 
days incubation and then 70 days until fledging (Cramp & Simmons 1980), laying would 
have occurred in October. The egg recently discovered at NHM was collected in January 
and probably freshly laid, judging by the two very small blowholes (Scharlemann 2001). 
Heuglin's eggs in SMNS were also 'hardly incubated' but were collected in mid April. In 
all extant populations the laying period is clearly more restricted, e.g. in Norway, Iceland, 
northern Russia and Sweden, eggs are laid late March and early April, with repeat laying to 
early May. In Germany, eggs are laid late February to April. In southern Europe and Russia 
the first eggs are laid in late January (Cramp & Simmons 1980). 

The H. albicilla eggs from the now extinct Egyptian population and their associated 
data highlight interesting differences from the typical breeding biology of White-tailed 
Eagle and illustrate the species' ability to adapt to a much wider variety of environmental 
conditions than currently recognised. In addition, the shells themselves can potentially 
provide an insight into the population's biology. 



Golo Maurer et al. 



214 



Bull. B.O.C. 2010 130(3) 



Acknowledgements 

We thank Helmar Maurer for help with deciphering old German measurements and Anita Gamauf and 
Mary LeCroy for information on the H. a. cinereus and H. a. funereus type specimens, respectively. We are 
also indebted to Frank Steinheimer and Robert Prys-Jones for comments on earlier drafts of this manuscript, 
and we thank Wilfried Schmid, Tadeusz Mizera, Duncan McNiven, Oliver Krone, Roy Dennis, Paul Sweet, 
Tom Trombone and two anonymous referees for their contributions. 

References: 

Ar, A., Paganelli, C. V., Reeves, R. B., Greene, D. G. & Rahn, H. 1974. The avian egg: water-vapor conductance, 

shell thickness, and functional pore area. Condor 76: 153-158. 
BirdLife International. 2009. Species factsheet: Haliaeetns albicilla: www.birdlife.org. 
Brehm, A. E. 1856. Die Sippe der Seeadler. Naumannia 6: 205-209. 

Brehm, C. L. 1855. Verzeichniss der europaischen Vogel nach den Species und Subspecies. Naumannia 5: 
266-300. 

Chennells, E. 1893. Recollections of an Egyptian princess by her English governess. W. Blackwood & Sons, 
Edinburgh. 

Cramp, S. & Simmons, K. E. L. (eds.) 1980. The handbook of the birds of the Western Palearctic, vol. 2. Oxford 
Univ. Press. 

Ebers, G. M. 1878. Egypt, descriptive, historical, and picturesque. Cassell, Petter, Galpin & Co., London. 

Evans, M. I. 1994. Important Bird Areas in the Middle East. BirdLife International, Cambridge, UK. 

Goodman, S. M. & Meininger, P. L. (eds.) 1989. The birds of Egypt. Oxford Univ. Press. 

Gurney, J. H. 1871. Letter to the editor. Ibis 13: 247-248. 

Hartert, E. 1918. Types of birds in the Tring Museum. Novit. Zool. 25: 4-63. 

Heuglin, M. T. 1856. Haliaetos cinereus. In Systematische Ubersicht der Vogel Nordost-Afrika's mit Einschluss 

der arabischen Kiiste, des rothen Meeres und der Nil-Quellen-Lander siidwarts bis zum 4. Grade nordl. 

Breite. Sitzungsberichte der kaiserlichen Akademie der Wissenschaften (math.-nat. Classe), Wien 19: 225-324. 
Heuglin, M. T. 1869. Ornithologie Nordost Afrika's, der Nilquelkn- und Kiisten-Gebiete des Rothen Meeres und des 

nordlichen Somal-Eandes. Verlag von Theodor Fischer, Cassel. 
Isenmann, P. & Moali, A. 2000. Oiseaux dAlgerie. Societe d'Etudes Ornithologiques de France, Paris. 
Lee, P. L. M. & Prys-Jones, R. P. 2008. Extracting DNA from museum bird eggs, and whole genome 

amplification of archive DNA. Mol. Ecol. Resources 8: 551-560. 
Meinertzhagen, R. 1930. Nicoll's birds of Egypt. Hugh Rees Ltd., London. 

Murdoch, D. A. & Betton, K. F. 2009. A checklist of the birds of Syria. Sandgrouse Suppl. 2: 1-48. 

Oppel, S., Powell, A. & O'Brien, D. 2009. Using eggshell membranes as a non-invasive tool to investigate the 

source of nutrients in avian eggs. /. Orn. 150: 109-115. 
Readman, P. 2006. Hatton, Murray Edward Gordon Finch-, Twelfth Earl of Winchilsea and Seventh Earl of 

Nottingham (1851-1898). Oxford Dictionary of National Biography, online edn., www.oxforddnb.com/ 

view/article/93824 (accessed 21 January 2010). 
Saunders, H. 1889. An illustrated manual of British birds. Gurney & Jackson, London. 

Scharlemann, J. P. W. 2001. Museum egg collections as stores of long-term phenological data. Intern. ]. 

Biometeorology 45: 208-211. 
Schonwetter, M. 1960-92. Handbuch der Oologie. Akademie Verlag, Berlin. 

Sharpe, R. B. 1874. Catalogue of the Accipitres, or diurnal birds of prey, in the collection of the British Museum, vol. 

1. Trustees of the Brit. Mus., London. 
Shelley, G. E. 1871. Contributions to the ornithology of Egypt. Ibis 13: 131-147. 
Shirihai, H. 1996. The birds of Israel. Academic Press, London. 

Addresses: Golo Maurer, Centre for Ornithology, School of Biosciences, University of Birmingham, Edgbaston 
B15 2TT, UK, e-mail: golo.maurer@gmx.net. Douglas G. D. Russell, Bird Group, Department of Zoology, 
The Natural History Museum, Akeman Street, Tring, Herts. HP23 6AP, UK, e-mail: d.russell@nhm. 
ac.uk. Friederike Woog, Staatliches Museum fiir Naturkunde, Rosenstein 1, 70191 Stuttgart. Germany, 
e-mail: woog.smns@naturkundemuseum-bw.de. Phillip Cassev, Centre for Ornithology, School of 
Biosciences, University of Birmingham, Edgbaston B15 2TT, UK, e-mail: p.cassev@bham.ac.uk 

© British Ornithologists' Club 2010 



Brian S. Meadows 



215 



Bull. B.O.C. 2010 130(3) 



On the status of Isabelline Lanius isabellinus, 
Turkestan L. phoenicuroides and Red-backed Shrikes 
L. collurio in the Eastern Province of Saudi Arabia 

by Brian S. Meadows 

Received 11 December 2009 

Summary. — Two races of Isabelline Shrike Lanius isabellinus have recently been 
given specific rank: L. isabellinus (Isabelline Shrike) and L. phoenicuroides (Turkestan 
Shrike). Both were formerly considered conspecific with Red-backed Shrike L. 
collurio. This note represents a preliminary analysis of their status at Jubail on 
the Persian Gulf, based on counts of the three species over a ten-year period. The 
data indicate that L. isabellinus is the main wintering species, being significantly 
attracted to recently landscaped areas; it is also an early-spring and late-autumn 
migrant. L. phoenicuroides is a later spring and an early-autumn migrant, while L. 
collurio is always most abundant in spring. 

Three closely related species of shrikes, Isabelline Lanius isabellinus, Turkestan L. 
phoenicuroides and Red-backed Shrikes L. collurio, are all regular visitors to the Arabian 
Peninsula, either as passage migrants or winter residents. However, information on their 
seasonal occurrence, preferred wintering habitat, numbers and overlap in occurrence on 
migration is still only partially availble. This is partly because all three were, until relatively 
recently, considered a single species and identification criteria for their separation — 
particularly for Isabelline Shrikes — is complex and has often been contentious. This note 
provides some additional information on their status in eastern Arabia — I follow Panov 
(2009) who argued the case for splitting Isabelline Shrike into two species (not three, contra 
Pearson 2000); these are L. phoenicuroides, which breeds in Central Asia and is considered 
monotypic, and all of the paler birds breeding in Mongolia and north-west China which are 
lumped together as L. isabellinus. 

Background 

I was resident in Saudi Arabia during the period 1983-2004 inclusive. The first ten years 
on the Red Sea at a new industrial city, Yanbu al-Sinaiyah (23°56'N, 38°14'E), were followed 
by the same period in a similar city on the Persian Gulf at Jubail al-Sinaiyah (27°01 / N, 
49°40'E). Both sites have been described by the Royal Commission for Jubail and Yanbu 
(1987). At Yanbu, Baldwin & Meadows (1988) did not attempt to systematically record 
the two species of isabelline shrikes, which were then considered only as races. However, 
during the ten years I was resident at Jubail I took field notes on all shrikes encountered 
and the following is a preliminary analysis of some of my findings. L. isabellinus is the sole 
wintering species and a passage migrant in small numbers in both spring and autumn, L. 
phoenicuroides is a relatively abundant passage migrant at both seasons, and L. collurio is 
almost exclusively a spring passage migrant. 

Identification criteria, methods and wintering habitat 

During each week I was resident in Jubail al-Sinaiyah I toured the city, which covers 
an area of c.920 km 2 , and searched for 'red-tailed' shrikes in suitable habitat, such as areas 



Brian S. Meadows 



216 



Bull. B.O.C. 2010 130(3) 



of shrubs and trees with significant adjacent ground cover, and recorded where birds 
were present. Observations were made on a daily basis but of over 20 potential sites only 
a few could be visited every day, although all were inspected at least once per week. 
Approximately 10% of the city had been established by 1994, in line with a master plan, but 
much of the city outside of the industrial parks and settlement zone was still completely 
undeveloped. Natural habitat in the form of barchan sand dunes, some Stipa steppe along 
the western boundary and a mix of low coastal dunes and salt-pans in the east remained 
throughout my residency. Not one working palm oasis, which are known to attract 
overwintering shrikes elsewhere in the Eastern Province, however, remained within the city 
boundaries and much of the natural habitat was of little attraction to shrikes except during 
exceptional 'falls' of migrants. 

Recently landscaped areas provided the majority (bar two) of the ovenvintering sites: 
a total of 15 man-made sites held shrikes in December-February and nine of these were 
occupied during three or more winters in 1994-2004. Optimal man-made habitat consisted 
of a mosaic of dense shrubs and small trees adjacent to irrigated grass lawns and flower beds 
with bare soil — mimicking natural shrike habitat. Such areas had been developed for coastal 
landscaping (there is now an 8-km corniche along the coast), small parks, mosque grounds 
plus gardens around offices within industrial parks and at a hotel. It was noticed that at 
one regular overwintering site, when an adjacent grass lawn was replaced with gravel, the 
shrikes left. Tall vegetation growing in and around land-treatment areas from septic tanks 
on temporary housing estates lacking main drainage were also used in successive years. Of 
two natural overwintering sites identified, one comprised vegetation surrounding a surface 
pool fed by late-autumn rains in the hollow of a large sand-dune, and the second Tamarisk- 
dominated scrub surrounding a groundwater-fed pool at the base of a coral outcrop on the 
coast. Some wintering birds always remained well hidden within bushes from where thev 
pounced on their prey — unlike grey shrikes L. meridionalis / L. pallidirostris, which normally 
used exposed perches atop bushes as lookouts — and because of this behaviour it was easv to 
under-estimate the numbers of wintering L. isabellinus without repeat visits / long periods 
of observation. In addition, similar landscaped habitat in coastal Saudi Arabia between 
Jubail and Al-Khobar (26°17 / N, 50°12'E) was also attractive to ovenvintering L. isabellinus, 
albeit with significant differences in numbers during different winters as at Jubail. Highest 
densities of wintering birds were often found in the garden on the Saudi Arabia-Bahrain 
causeway (e.g. at least ten on 25 December 2002). 

As indicated above all the overwintering shrikes were considered to be L. isabellinus. 
Identification in the field, however, can be extremely difficult due to overlap in features, 
while published descriptions rarely take into account different perceptions of colour 
between observers. Ideally, all birds should be mist-netted for feather analysis, but this was 
impossible because of security concerns, especially as many were in public places. The best 
consistent features I found for separating adult L. isabellinus from L. phoenicuroides were 
the paler upperparts (including crown to lower back) — resulting in less contrast between 
the upper- and underparts, much less-contrasting facial features with an inconspicuous 
white supercilium and a relatively indistinct narrow dark eye-mask, normally confined 
to behind the eye, and a much duller red (considered cinnamon) rump and tail (the latter 
possibly shorter on many birds); all of the latter features combine to give an overall pallid 
appearance. Variation in the size of the white wing-patch was found to be of limited value 
for specific identification in the field. All obvious hybrids and birds that I could not assign 
to species (some of which were probably birds of the 'karelini' type) have been excluded 
from Table 1. It is possible, however, that a few individuals were misidentified, but this is 
unlikely to affect iriy general conclusions concerning wintering status and passage periods 



Brian S. Meadows 



217 



Bull. B.O.C. 2010 130(3) 



of the two species at Jubail. No attempt to identify races of L. isabellinus was made, although 
most were probably of the nominate form. Separation of L. collurio from L. isabellinus and L. 
phoenicuroides was relatively straightforward using modern field guides. Optical aids were 
normally limited to 10 x binoculars but on the Arabian Peninsula, compared to temperate 
latitudes, light conditions were usually excellent. 

Migration 

Data on migration periods, for the purpose of this account, covers March-May and 
September-November (Table 1). Table 1 shows the total number of birds found at Jubail 
al-Sinaiyah; each month has been divided into early (1-15, inclusive) and later periods, plus 
the number of bird days. The data cover the autumn of 1994 to the end of spring in 2004 
(with the exception — in 1998 — of the second half of September and first 15 days of October). 
It is recognised that using these criteria for migration data, for early March and late 
November, in particular, there is likely to be some overlap between wintering individuals 
and migrants, especially for L. isabellinus, while in some years passage can even continue 
until early December (e.g. a 'fall' of five L. isabellinus in a reedswamp surrounded by desert 
on 6 December 2002 — left by 9 December — in a year when there had been negligible passage 
earlier). March departure dates in different years also varied by up to 22 days, based on 
sightings of individually recognisable birds that were known to have overwintered in the 
city (these have been excluded from Table 1). 

Discussion 

My observations show that L. isabellinus is the only species that overwinters, which 
conclusion was also made by Hirschfeld (1995) on Bahrain, albeit he had no data on the 
situation in Saudi Arabia at the time. However, this was also probably the case, in retrospect, 
of the three birds reported overwintering on the Red Sea coast (Baldwin & Meadows 1989). 
Migrants of this species arrive later and pass through earlier than L. phoenicuroides, with 
relatively few remaining into April and none apparently occurring until October (Table 1). 
L. phoenicuroides passes through mainly from the second half of March until early May and 



TABLE 1 

Occurrence of Isabelline Lanius isabellinus, Turkestan L. phoenicuroides and Red-backed Shrikes L. collurio at 
Jubail, Eastern Province, Saudi Arabia, with each month 'divided' into two halves. 





L. isabellinus 




L. phoenicuroides 




L. collurio 






First 


Second 


First 


Second 


First 


Second 


March 


49/49 


27/34 


16/8 


83/43 


0/0 


0/0 


April 


10/9 


0/0 


56/35 


89/57 


0/0 


341/99 


May 


0/0 


0/0 


35/26 


3/3 


653/99 


142/47 


September 


0/0 


0/0 


52/38 


113/49 


0/0 


2/2 


October 


4/4 


40/32 


48/29 


28/19 


0/0 


0/0 


November 


27/29 


34/34 


19/10 


4/3 


0/0 


0/0 



TABLE 2 

Occurrence of Red-backed Shrikes Lanius collurio at Yanbu (1984-92) 



Spring (March-May) 

Autumn (August-October) 

Years recorded: spring 3/9, autumn 9/9. 



Bird days 
6 

113 



No. of birds 
6 

262 



Brian S. Meadows 



218 



Bull. B.O.C. 2010 130(3) 



again from late August with a peak usually in September. In addition, mention can be made 
of two individuals seen in July (6-17 July 1994 and 17 July 2003) which were considered to 
be local breeders that had dispersed — the species breeds on the opposite side of the Persian 
Gulf (Porter et ah 1966) and has bred at least once in Arabia (Eriksen & Jennings 2006). L. 
phoenicuroides winters much further south than L. isabellinus, some individuals regularly 
reaching as far south as north-east Tanzania (Lefranc & Worfolk 1997). Britton (1980) stated 
that the species frequents dry woodland, bushland, scrub and cultivation from sea level 
to c.2,000 m; in central Kenya, where I lived prior to taking up residence in Saudi Arabia, 
I found that they often overwintered in verdant riverine habitat — far less arid than many 
natural habitats utilised by L. isabellinus, but apparently still in drier country than L. collurio 
wintering even further south in Africa. 

L. collurio passes through Jubail mainly during the first two weeks of May with the 
vanguard from mid April; in 1996 there was a very heavy fall in late April. In some years, 
stragglers (usually) females are still passing through in June (latest 23 June 2004). The 
peak in May coincided with the appearance of large numbers of other spring migrants, 
especially Common Whitethroats Sylvia communis, which are frequently killed by shrikes. 
There were no July records. In autumn it is scarce, with only two records (both in September 
2002) during ten years' residence in Eastern Province. This is in complete contrast to my 
experience at Yanbu al-Sinaiyah, where the species is rare in spring (Table 2). In spring most 
probably enter Arabia via the south-west of the peninsula in association with a rain belt, 
which is prevalent at this season, between the Gulf of Aden and along the Red Sea coast 
as far north as 20°N. It is, however, an annual migrant in autumn. The presumed earliest- 
returning bird at Yanbu was on 24 July 1992 (an immature that stayed until 10 August) but 
with maturing landscaped areas the possibility of occasional breeding within the city, as is 
already the case for some other Palearctic summer migrants at Yanbu, cannot be ruled out 
in the future. In spring, the results at Jubail, and its known scarcity along the northern Red 
Sea coast as a spring migrant, indicate that any individuals arriving on the Persian Gulf 
heading for Western Europe via the Levant would migrate almost due west after departing. 
A bird ringed in the Czech Republic in June was recovered the following May in the Eastern 
Province (Hirschfeld 1995). It is, however, not known what percentage of the birds seen at 
Jubail was heading for Western Europe or the Near East, vis-a-vis those migrating to Central 
Asia, as subspecific identification of L. collurio was not attempted. 

Acknowledgements 

I thank Andrew Lassey and Lars Svenssson for constructive comments on a draft of this paper. 
References: 

Baldwin, P. J. & Meadows, B. S. 1988. Birds ofMadinat Yanbu al-Sinaiyah and its hinterland. Royal Commission 

for Jubail and Yanbu, Riyadh. 
Britton, P. L. (ed.) 1980. Birds of East Africa. E. Afr. Nat. Hist. Soc, Nairobi. 
Eriksen, J. & Jennings, M. C. 2006. First breeding of Red-tailed Shrike in Arabia. Phoenix 22: 1-2. 
Hirschfeld, E. 1995. Birds in Bahrain. Hobby Publications, Dubai. 

Lefranc, N. & Worfolk, T. 1997. Shrikes: a guide to the shrikes of the world. Pica Press, Robertsbridge. 
Panov, E. 2009. On the nomenclature of the so-called Isabelline Shrike. Sandgrouse 31: 163-170 
Pearson, D. J. 2000. The races of the Isabelline Shrike Lanius isabellinus and their nomenclature. Bull. Brit. 
Orn. CI. 120: 22-27. 

Porter, R. F., Christensen, S. & Schiermacker-Hansen, P. 1996. Field guide to the birds of the Middle East. T. & 
A. D. Poyser, London. 

Royal Commission for Jubail and Yanbu. 1987. Jubail and Yanbu industrial cities - ten years of accomplishments. 
Riyadh. 

Address: 9 Old Hall Lane, Walton-on-the-Naze, Essex C014 8LE, UK, e-mail: BrianSMeadows@lycos.coni 
© British Ornithologists' Club 2010 



Richard Schodde 



219 



Bull. B.O.C. 2010 130(3) 



The identity and sources of Palaeornis anthopeplus 
Lear, 1831, and P. melanura Lear, 1832 (Regent Parrot), 
and their neotypification 

by Richard Schodde 

Received 25 March 2010 

Summary. — Evidence from morphology and historical exploration is combined 
to show that the now-lost type material of the two senior specific names for the 
Australian Regent Parrot, anthopeplus Lear, 1831, and melanura Lear, 1832, originally 
came from south-west Australia. This finding answers 20th century dispute over 
the type locality, and supports neotypification that had been designated to settle 
the names on the south-western subspecies. 



Endemic to Australia, the brilliant mustard-yellow Regent Parrot Polytelis anthopeplus 
(Lear, 1831), occurs in two widely separated isolates in the south-west and inland south- 
east of the continent. It was named Palaeornis anthopeplus by Edward Lear from a single 
figure in feminine plumage in pt. 8, October 1831, of his (1830-32) Illustrations of the family 
of Psittacidae, or parrots. In that work he later published another single figure of the much 
brighter, black-tailed adult male as a different species, Palaeornis melanura (pt. 12, 1832). 
Neither figure was accompanied by a reference to its geographic source, nor a designation 
as type; and the individual specimens on which the plates were based are currently 
presumed lost (Schodde 1993). Until a review of geographic variation (Schodde 1993), 
differences between eastern and western isolates had attracted little attention. Peters (1937) 
and Forshaw (1969, 1974) recognised none. Later, when Forshaw (1981: 158) accepted the 
isolates as separate subspecies, following Mathews (1915) and Condon (1975), he did so 
with stated reluctance. 

When separating the isolates, Mathews (1915) described the western as new (westralis) 
because he had previously 'restricted' the type locality of both anthopeplus and melanura 
to 'New South Wales' in the east (Mathews 1912a). Even though made arbitrarily and 
without explanation, this restriction was accepted unquestioningly until 1993. The 
procedure nevertheless is not recognised by the International code of zoological nomenclature, 
hereafter 'the Code' (ICZN 1985, 1999), and is to be corrected if shown to be 'erroneous' 
(Recommendations 72H (b) and 76A.2 respectively). This was the course that I took in 
my revision of the Regent Parrot in 1993, concluding from the tones of Lear's figures 
of anthopeplus and melanura and historical circumstances, that the types of these names 
came from south-west Australia, not the east (Schodde 1993). Accordingly, neotypes were 
designated to establish the point; and the eastern isolate, un-named as a consequence, 
was described as the new subspecies, monarchoides. Prima facie grounds for neotypification 
under Art. 75 of the Code (ICZN 1985, 1999) were the loss of original type material and 
the conflicting type localities for anthopeplus and melanura which confuse application of 
the names. Exacerbating that confusion, Mees (2004) then defended Mathews' designation 
of 'New South Wales' as the type locality for anthopeplus, arguing that I had shifted it to 
south-west Australia on insufficient grounds and erred by designating neotypes illegally. 
Thus the purpose of this paper is to establish as far as possible the identity and source of 
the material in Lear's original figures. To do this I have compared further specimen material 
with information in original literature and the facts of early exploration in Australia. 



Richard Schodde 



220 



Bull. B.O.C. 2010 130(3) 



The issue hinges on evidence for the type locality of anthopeplus and melanura. Using 
only secondary references, Mees (2004) challenged my conclusions (Schodde 1993) on the 
following grounds: (i) Mathews (1912a, 1915) found that Lear's plate of anthopeplus 'did not 
show subspecific characters either way', (ii) I agreed with this view, and (iii) I conceded that 
early, pre-1832 'specimens from eastern Australia (italics mine) could have been received 
(by Lear) through trade channels, such as the famous firm Leadbeater'. Here Mees misread 
both Mathews' and my accounts. I can find no evidence that Mathews ever commented 
on the subspecific identity of Lear's figures of anthopeplus and melanura; certainly there is 
nothing in any of the references mentioned by Mees. Nor did I agree with Mathews on 
the characters of Lear's plate of anthopeplus: Mathews never published on the subject. As 
for the supposition that material of Regent Parrots could have reached Lear from eastern 
Australia, this too I neither stated nor implied. More crucially, Mees clouded the issue by 
misreading his quotation from my study (Schodde 1993). I wrote: 'Lear's (1830-2) superb 
figures of Palaeornis anthopeplus and P. melanura, nevertheless, also match the western form'. 
Here Mees took the word 'also' to imply that Lear's figures agreed with the eastern as well, 
whereas its context in the paragraph does quite the opposite, reinforcing instead the point 
that the figures match the western form alone. 

The fact is that Mathews' (1912a) restriction of the type localities of anthopeplus and 
melanura, made in his first sketchy and unreferenced listing of type localities for Australian 
birds, itself undermines the case for 'New South Wales'. Mathews rarely concerned himself 
deeply with tracking down type localities for pre-Gouldian names, routinely restricting 
them to 'New South Wales': that was the region where British colonisation of Australia 
began and the source of most Australian specimens in the first decades of the 19th century. 
In the case of anthopeplus and melanura, moreover, he was constrained by a lapse, recording 
the geographic range of the Regent Parrot as 'New South Wales, Victoria, South Australia' 
and omitting south-west Australia (Mathews 1912a). Thus the assigned type locality 'New 
South Wales' for these names was not based on rational choice between south-west and 
south-east Australia, but on a faulty ad hoc notion of species distribution. Even as a guess 
it was flawed. 

Real evidence for the geographic origin of Lear's material of anthopeplus and melanura 
comes from three sources. One is the identity of the figures in Lear's plates. Collections 
not previously available to me from south-west Australia (n=14 ^,.6 ?$ in the American 
Museum of Natural History and Australian National Wildlife Collection), including fresh 
adult female material, reveal that one of the most trenchant morphological differences 
between western and eastern isolates is the body tone of feminine plumage. It is a difference 
so far little stressed in literature. Western females and immatures are mid olive-green often 
but not always washed with a dulling grey, whereas eastern females and immatures are 
much brighter citrine-green with a distinct yellowish cast, particularly on the face and rump 
/uppertail-coverts. Even though shown only side-on, the tones of these areas of plumage 
in Lear's plate of anthopeplus are clearly greenish and greyish olive respectively. Adult 
western males are similarly, though less markedly, duller than the bright mustard of yellow 
eastern males, the dusky olive tone of their backs often washing well up onto the head. The 
sexual difference in body tone between adult males and females immatures, moreover, is 
noticeably greater in south-west Australia. With the same yellow cast, eastern females and 
immatures are merely duller than adult males, w hereas western females and immatures 
are much greener than their males. Here, despite his tendency to brighten colours in the 
birds he painted, I ear's life-like figures of both anthopeplus and melanura match the plumage 
tones and sex / age contrasts of the western, not eastern form, corroborating my earlier 
assessment (Schodde 1993, 1997). 



Richard Schodde 



221 



Bull. B.O.C. 2010 130(3) 



The second piece of evidence comes from the circumstances of early ornithological 
exploration in Australia up to 1831-32 when anthopeplus and melanura were described 
(Mathews 1912b). By then, the range of the Regent Parrot in the south-west had been 
penetrated by the garrisoning of King George Sound (Albany) from 1826 and settlement 
along the Swan River in 1829-31 (The encyclopaedia of Australia 1983: Western Australia). 
There Regent Parrots were found by John Gilbert only a decade later (Gould 1845). It is from 
these sources that Lear got material for his folio of other south-west Australian parrots: 
Calyptorhynchus baudinii Lear, Platycercus stanleyii Vigors = P. icterotis icterotis (Kuhl), 
Platytercus pileatus Vigors = Purpureicephalus spurius (Kuhl) and Platycercus baueri Lear = 
Barnardius zonarius semitorquatus (Kuhl). In contrast, the range of the eastern Regent Parrot 
in the inland Murray mallee was, with the exception of a single venture, ornithological 
terra incognita until 1836 when Surveyor-General Thomas Mitchell reached the junction of 
the Murray and Darling Rivers (The encyclopaedia of Australia 1983: Exploration by Land). 
Earlier access was simply not possible. At 800 km from Sydney, 500 km from Melbourne 
and c.200 km from Adelaide, this region could only be approached at that time by large, 
well-equipped expeditions supplied from those centres. Melbourne, apart from failed and 
under-resourced penal settlements at Sorrento in 1803-04 and Western Port in 1826-28, 
was not established until 1835 (The encyclopaedia of Australia 1983: Victoria). Adelaide only 
followed a year later. And, until Mitchell's expedition, Sydney was too far away, across not 
only the Blue Mountains but also the inhospitable Hay Plains. 

The single exceptional venture was Charles Sturt's voyage down the Murrumbidgee 
and Murray rivers in 1830. By remarkable coincidence, Sturt did collect Regent Parrots, 
as I reported (Schodde 1993), preparing as skins a pair of 'Yellow King Parrots' out of a 
dozen or so shot (Sturt 1834, pi. opp. p. 191, Stenhouse 1830). Yet, whereas material from 
Sturt's more northerly expedition to the upper Darling River a year before could have 
reached London, including perhaps the type of Cacatua leadbeateri (Vigors), the skins from 
the Murray-Murrumbidgee expedition were passed to Sturt's commanding officer in 
Sydney, Lt.-Colonel Patrick Lindsay; and Lindsay sent them directly to Robert Jameson, 
professor of natural history at the University Museum in Edinburgh in late 1830 (Stenhouse 
1830, Whittell 1954: 97). One specimen, the female, still survives. Lear, who then worked 
in London on material from the Australian colonies provided instead by the Zoological 
Society of London at Regent's Park, Lord Stanley, N. A. Vigors, and the natural history 
dealers B. & J. Leadbeater (Hyman 1980: 20-22, Tree 1991: 38), would not have seen them; 
he apparently never visited Edinburgh, and certainly not before the end of 1832. Thus, in 
the absence of connection between Sturt's specimens and Lear's lost material of anthopeplus 
and melanura, the source of the latter can only be south-west Australia. 

The third piece of evidence comes from the discovery of the possible holotype of 
Palaeornis anthopeplus Lear in the World Museum, Liverpool. It is labelled as a female, WML 
no. 3577, in the collection of Lord Stanley, 13th Earl of Derby, from the London traders 
B. & J. Leadbeater, but it lacks further data (C. T. Fisher pers. comm.). Lear had access to 
Stanley's collections for his work on parrots (Tree 1991: 49). Yet however likely it is that this 
was the specimen of anthopeplus illustrated by him, there is no explicit reference to Lear on 
its label or in the World Museum register. Nor is there clear evidence that this specimen 
was in Lord Stanley's or the Leadbeaters' possession by mid 1831 when Lear painted 
anthopeplus (C. T. Fisher pers. comm.). Even so, the skin has wings and tail worn in the way 
of a captive live bird, the very subject that Lear preferred to illustrate, and it bears several 
remarkable similarities to the original figure of anthopeplus: (i) the same shoulder pattern 
with extensively hidden pale green wing-coverts and broad blue-black outer margining, (ii) 
the same dull rump, and (iii) the same wash of green across forehead and face contrasting 



Richard Schodde 



222 



Bull. B.O.C. 2010 130(3) 



with a quite dusky olive back. Its tail, though shorter, has evidently been broken, leaving 
its moderately demarcated dark greyish-olive breast as the only anomaly. Although the 
specimen is unprovenanced, its generally olive body tone and dull rump identify it with 
the south-west Australian form. This is further evidence that, whether type material or 
not, specimens of Regent Parrots available in London around Lear's time came from that 
region. Even the female figured 14 years later by Gould (1845) in his The birds of Australia is 
visibly of the south-western form, no doubt collected by John Gilbert. The British Museum 
of Natural History in London did receive early material of the eastern form from Charles 
Sturt and Sir George Grey, but not until the early-mid 1840s from their periods as respective 
Assistant Commissioner of Lands (Surveys) and Governor in South Australia (cf. Salvadori 
1891: 480). 

So comprehensive is the combined evidence for a south-west Australian source for 
Lear's material that one could well ask whether there is any point to neotypification. 
Yet, without firm evidence that WML 3577 in Liverpool is original type material, a prima 
facie case still exists for neotypification of both Palaeornis anthopephis Lear and P. melanura 
Lear under the Code (ICZN 1999). It is a case strengthened by Mees' (2004) challenge. 
Had the type localities of anthopephis and melanura been shifted to south-west Australia 
on more questionable grounds, his charges would have substance. But as the grounds 
are circumstantially sound, the charges lose force. Thus neotypification is the outcome of 
work that was, as Mees (2004) himself admitted, revisory, which supercedes Mees' claim 
that the designation was illegal, made as an end in itself (Art. 75.2). It also satisfies the 
critical conditions of Art. 75.3.1, namely, that its express purpose is to resolve complex and 
contradictory problems by clarifying the taxonomic status or type locality of nominal taxa. 
Even the most casual reader will appreciate that this requirement is met due to the dispute 
over type localities. As for the issue of stability raised by Mees (2004), it can be well argued 
that eastern and western subspecies of the Regent Parrot were recognised so infrequently 
and with such little confidence until 1993 that neotypification reflecting the realities of type 
source then outweighed any drawbacks from shifting the name anthopephis from eastern 
to western isolates. This view has since gained widespread acceptance, the shift having 
been adopted widely in international (Collar 1997, Juniper & Parr 1998, Dickinson 2003) as 
well as national Australian (Schodde 1997, Higgins 1999, Forshaw 2002, Sindel & Gill 2003) 
literature. Today usage is such that reverting to pre-neotypification nomenclature based on 
the old erroneous type localities of Mathews would have the very destabilising effect that 
the Code seeks to avoid. 

Until WML 3577 can be confirmed as original type material, neotypification of 
Palaeornis anthopephis Lear and P. melanura Lear (Schodde 1993) should continue to stand 
because: (i) it fulfills all qualifying conditions required for neotypification by both the third 
(Art. 75 (b) and (d)) and fourth (Art. 75.3) editions of the Code (ICZN 1985, 1999), and (ii) it 
settles and protects nomenclature now in widespread use. Although, under Art. 86.3 (ICZN 
1999), only conditions for neotypification under the current edition of the Code need to be 
satisfied, I have quoted the equivalent requirements in the previous edition as well because 
it was that edition under which neotypification was originally effected and later challenged 
(Mees 2004). If it is subsequently shown that WML 3577 is the holotype of anthopeplus Lear, 
no further name shifting will result because that specimen is of the south-west Australian 
subspecies. 

Acknowledgements 

I thank my colleagues I eo Joseph for his counsel on the framing of this paper, and Clemency 1 . Fisher 
(Liverpool) for information on Edward I ear and his sources of material, and for allowing me to examine 
material of Polytelis anthopeplus in I iverpool in L998; W alter hock and Mar} 1 eCroj also provided helpful 



Richard Schodde 



223 



Bull. B.O.C. 2010 130(3) 



and clarifying suggestions. The National Library of Australia made available Lear's folio on parrots for study. 
Research for this paper was part-supported by a Collections Study Grant from the Dept. of Ornithology, 
American Museum of Natural History, New York. 

References: 

Collar, N. J. 1997. Family Psittacidae (parrots). Pp. 280-477 in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.) 

Handbook of the birds of the world, vol. 4. Lynx Edicions, Barcelona. 
Condon, H. T. 1975. Checklist of the birds of Australia part 1 non-passerines. Royal Australasian Ornithologists 

Union, Melbourne. 

Dickinson, E. C. (ed.) 2003. The Howard and Moore complete checklist of the birds of the world. Third edn. 

Christopher Helm, London. 
Forshaw, J. M. 1969. Australian parrots. Lansdowne Press, Melbourne. 
Forshaw, J. M. 1974. Parrots of the world. Lansdowne Editions, Melbourne. 
Forshaw, J. M. 1981. Australian parrots. Second edn. Lansdowne Editions, Melbourne. 
Forshaw, J. M. 2002. Australian parrots. Third edn. Alexander Editions, Robina, Queensland. 
Gould, J. 1845. The birds of Australia. Pt. XVIII, pi. 16 and text in vol. V. John Gould, London. 
Higgins, P. J. (ed.) 1999. Handbook of Australian, New Zealand and Antarctic birds, vol. 4. Oxford Univ. Press, 

Melbourne. 

Hyman, S. 1980. Edward Lear's birds. Wellfleet Press, Seacaucus, NJ. 

International Commission on Zoological Nomenclature (ICZN). 1985. International code of zoological 
nomenclature. Third edn. International Trust for Zoological Nomenclature, c/o The Natural History 
Museum, London. 

International Commission on Zoological Nomenclature (ICZN). 1999. International code of zoological 
nomenclature. Fourth edn. International Trust for Zoological Nomenclature, c/o The Natural History 
Museum, London. 

Juniper, T. & Parr, M. 1998. Parrots: a guide to the parrots of the world. Pica. Press, Robertsbridge. 

Lear, E. 1830-32 (as 1832). Illustrations of the family of Psittacidae, or parrots. E. Lear, London. 

Mathews, G. M. 1912a. A reference-list to the birds of Australia. Novit. Zool. 18: 171-446. 

Mathews, G. M. 1912b. Dates of issue of Lear's Illustr. Psittacidae and of the Verhandelingen over de 

Naturlijke Geschiedenis: Land-en Volkenkunde. Austral Avian Rec. 1: 23-24. 
Mathews, G. M. 1915. Additions and corrections to my list of the birds of Australia. Austral Avian Rec. 2: 

123-133. 

Mees, G. F. 2004. Comment on the type-locality and nomenclature of the Regent Parrot Polytelis anthopeplus 

(Lear, 1831). Zool. Meded. Leiden 78: 205-208. 
Peters, J. L. 1937. Check-list of birds of the world, vol. 3. Mus. Comp. Zool., Harvard. 

Salvadori, T. 1891. A catalogue of the birds in the British Museum, vol. 20. Trustees of the Brit. Mus. (Nat. Hist.), 
London. 

Schodde, R. 1993. Geographic forms of the Regent Parrot Polytelis anthopeplus (Lear), and their type localities. 

Bull. Brit. Orn. CI. 113: 44-47. 
Schodde, R. 1997. Psittacidae. Pp. 109-218 in Houston, W. W. K. & Wells, A. (eds.) Zoological catalogue of 

Australia, vol. 37.2. CSIRO Publishing, Melbourne. 
Sindel, S. & Gill, J. 2003. Australian coral-billed parrots The Alisterus, Aprosmictus and Polytelis genera. Singil 

Press, Austral, New South Wales. 
Stenhouse, J. H. 1930. Birds collected by Captain Sturt in 1830 on the "Banks of the River Murray". Emu 30: 

138-140. 

Sturt, C. 1934. Two expeditions into the interior of southern Australia, during the years 1828, 1829, 1830 and 1831, 

vol. 2. Smith, Elder & Co., London. 
The Encyclopaedia of Australia. 1983. Fourth edn. Grolier Society of Australia, Sydney. 
Tree, I. 1991. The ruling passion of John Gould. A biography of the bird man. Barrie & Jenkins, London. 
Whittell, H. M. 1954. The literature of Australian birds: a history and bibliography of Australian ornithology, pt. 1. 

Paterson Brokensha, Perth. 

Address: c/o Australian Biological Resources Study, G.P.O. Box 787, Canberra City, ACT 2601, Australia. 



© British Ornithologists' Club 2010 



Johan Ingels et al. 



224 



Bull. B.O.C. 2010 130(3) 



White Wagtail Motacilla alba, a vagrant to Barbados, 
Trinidad and French Guiana 

by Johan Ingels, Olivier Claessens, Thomas Luglia, Patrick Ingremeau & 

Martyn Kenefick 

Received 9 February 2010 

White Wagtail Motacilla alba is mainly an Old World species, widely distributed as a 
breeder from south-east Greenland over the entire Palearctic and south-east Asia to north- 
west Alaska. In winter its range also extends south to central Africa and southern Asia 
(Alstrom & Mild 2003). In North America White Wagtail is represented by two subspecies, 
M. a. ocularis and M. a. lugens (Alstrom & Mild 2003, Tyler 2004). M. a. ocularis breeds in 
westernmost Alaska and has wandered south to California and Baja California in Mexico, 
whilst M. a. lugens occasionally breeds in coastal Alaska and is a rare vagrant south to 
western North America. Both subspecies have also been recorded in south-east North 
America, in North Carolina, South Carolina, Florida and Louisiana (Howell & Webb 1995, 
AOU 1998, Buckley et al. 2009). Palearctic M. a. alba is also a rare vagrant to Florida (March), 
Quebec (May) and North Carolina (October) (Buckley et al. 2009). In early 1987, M. a. alba 
was recorded on Barbados, and at the end of 1987 probably also in Trinidad (ffrench 1991, 
Kenefick et al. 2007, Buckley et al. 2009, Oatman in prep.). 

We report here one observation substantiated with photographs of a White Wagtail of 
the subspecies alba, and a brief view of another White Wagtail, from French Guiana, the first 
for this species on the South American continent. We also discuss a recent White Wagtail on 
Trinidad, together with an overview of earlier records on Barbados and on Trinidad. 

Observations in French Guiana 

One morning between 10 and 15 September 2009, M. Clement (pers: comm.) saw 
a White Wagtail in his garden at km 10 along the road to Apatou (c.05°25'N, 54°04'W), 
south of Saint-Laurent-du-Maroni in western French 
Guiana, and c.50 km inland. It flew low over the lawn 
on leaving the bank of a small pond in the backyard. 
Its greyish upperparts, whitish underparts, long tail 
and undulating flight, 1.0-1.5 m above the ground, 
were unmistakable. However, the observation was not 
submitted to the French Guiana Rarities Committee 
(Comite d'Homologation de Guyane, CHG), and 
therefore could not be evaluated. 

On 26 October 2009, TL & PI were travelling with 
a group of birders on the Approuage River in eastern 
French Guiana. As they passed ilet Lezard (c.04°09'N, 
52°23'W), c.90 km inland and c.225 km from the site 
where the wagtail was seen in September, they saw 
three birds foraging amongst low weeds on a gravelly 
sandbar in the middle of the river. One was a Spotted 
Sandpiper Actitis macularius, another a White-rumped 
Sandpiper Calidris fuscicollis, but the third was clearly 
a wagtail — a small, tall-legged passerine, walking with 




Figures 1-2. White Wagtail Motacilla 
a. alba, ilet Lezard, Approuage River, 
French Guiana, 26 October 2009 (Patrick 
Ingremeau) 



Johan Ingels et al. 



225 



Bull. B.O.C. 2010 130(3) 



a long wagging tail while bobbing its head. Its grey upperparts, white underparts, two 
white wingbars and an obvious black breast-band are typical of M. a. alba, a form with 
which most of the observers were familiar in France. Although it proved shy, PI was able 
to photograph the bird (Figs. 1-2); it was not seen subsequently. The absence of a black 
eyestripe or a 'white shoulder' eliminates M. a. ocularis and M. a. lugens respectively, whilst 
the white flanks and grey rump eliminate M. a. yarrellii, which is essentially resident in the 
British Isles (Alstrom & Mild 2003). Its uniform greyish forehead, crown, nape and mantle 
indicated a first-year or an adult in winter plumage, probably a female. It was accepted by 
the CHG as the first White Wagtail for French Guiana. 

Vagrant Motacilla alba on Barbados and Trinidad 

On 28 January 1987, a first-year or adult male White Wagtail of the nominate race 
M. a. alba was found at Bridgetown Harbour (c.13°05'N, 59°37'W) on Barbados (Norton 
1987). The combination of plain white face and throat plus a black crown and breast-band 
eliminated M. a. lugens and M. a. ocularis (Buckley et al. 2009). 

On 26 December 1987-2 January 1988, a White Wagtail was seen and photographed at 
Aripo Agricultural Research Station (c.lO°38'N, 61°14'W) in northern Trinidad by a group 
of birders led by F. Oatman. It was not identified to subspecies (ffrench 1991, Kenefick & 
Hayes 2006, Kenefick et al. 2007), but was accepted by the Trinidad & Tobago Rare Bird 
Committee as the first M. alba for South America (Hayes & White 2000), though Kenefick 
& Hayes (2006) preferred to consider the record as hypothetical. Recently an original 
photograph turned up and is set to be published (Oatman in prep.). 

On 27 September 2009, a group of British birders led by experienced local guide M. 
Ramlal observed a wagtail at the same agricultural research station where the White 
Wagtail was seen in 1987-88 (S. J. Tyler pers. comm.). Ramlal had also seen that wagtail, 
and all observers were familiar with the British subspecies M. a. yarrellii. Although they 
could not identify the subspecies involved, there is no doubt as to its identity as a White 
Wagtail. 

Discussion 

As Barbados is usually considered part of North America, the 1987 record on Trinidad 
was the first for this species in South America (Hayes & White 2000, Oatman in prep.). 
Although the White Wagtail is not yet included in the main list of the birds of South 
America, the photograph of the wagtail at the Aripo Agricultural Research Station is 
mentioned in the South American Classification Committee's 'Hypothetical list' (Remsen et 
al. 2010). The Approuague bird thus constitutes the first confirmed record of White Wagtail 
for continental South America. 

The White Wagtails seen in 1987 on Barbados and in 2009 in French Guiana were 
identified as M. a. alba, which breeds in continental western Europe. Northernmost 
populations migrate in September and October to their winter quarters in south-west 
Europe and northern Africa (Alstrom & Mild 2003). The occurrence of White Wagtails in the 
southern Lesser Antilles and north-east South America in September-January is consistent 
with migrants being diverted west by strong north-east trade winds prevailing over the 
Atlantic Ocean at that season (V. Kousky pers. comm.; Kenefick & Hayes 2006). 

The cluster of Trinidad and Guiana records in 2009 is striking in being distributed over 
a relatively small area, relative to the distances travelled by the birds. Moreover, there is no 
reason to assume only one individual was involved. Rather, since wagtails usually migrate 
in small parties, it is more likely that such a party was diverted during migration in autumn 



Johan Ingels et al. 



226 



Bull. B.O.C. 2010 130(3) 



2009 and those individuals then wandered between the southern West Indies and French 
Guiana. 

Acknowledgements 

We are grateful to Michel Clement for providing details of his observation, to John Arvin, P. A. Buckley, 
Floyd Hayes, Robin Restall, Kabelo Senyatso, Stephanie Tyler and Graham White for details of the 1987-88 
observations, to Georges Olioso for helping to age the wagtail found along the Approuage River, and to the 
Comite d'Homologation de Guyane for information concerning the record's validation. We thank Michel 
Barataud, Sylvie Giosa, Fabrice Hibert, Frederic Leblanc, Pierre Terret and Laurent Tillon for companionship 
in the field. Frederik Brammer and P. A. Buckley commented on drafts of this note, and Per Alstrom 
confirmed the subspecific identifications. 

References: 

Alstrom, P. & Mild, K. 2003. Pipits & wagtails of Europe, Asia and North America: identification and systematics. 

Christopher Helm, London. 
American Ornithologists' Union (AOU). 1998. Check-list of North American birds. Seventh edn. American 

Ornithologists' Union, Washington DC. 
Buckley, P. A., Massiah, E. B., Hutt, M. B., Buckley, F. G. & Hutt, H. F. 2009. The birds of Barbados: an 

annotated checklist. BOU Checklist No. 24. British Ornithologists' Union & British Ornithologists' Club, 

Peterborough. 

ffrench, R. 1991. A guide to the birds of Trinidad & Tobago. Second edn. Christopher Helm, London. 

Hayes, F. E. & White, G. 2000. First report of the Trinidad and Tobago Rare Bird Committee. /. Trinidad & 

Tobago Field Nat. CI. 1999-2000: 39-45. 
Howell, S. N. G. & Webb, S. 1995. A guide to the birds of Mexico and northern Central America. Oxford Univ. 

Press. 

Kenefick, M. & Hayes, F. E. 2006. Transatlantic vagrancy of Palearctic birds in Trinidad and Tobago. /. Carib. 
Orn. 19: 61-72. 

Kenefick, M., Restall, R. & Hayes, F. E. 2007. Birds of Trinidad & Tobago. Christopher Helm, London. 
Norton, R. 1987. West Indies region, winter 1986-1987. Amer. Birds 41: 334-335. 

Oatman, F. in prep. First record of White Wagtail (Motacilla alba) for Trinidad and South America. /. Carib. 
Orn. 

Remsen, J. V., Cadena, C. D., Jamarillo, A., Nores, M., Pacheco, J. F., Robbins, M. B., Schulenberg, T. S., Stiles, 
F. G., Stotz, D. F. & Zimmer, K. J. 2010. A classification of the bird species of South America. Version 12 
January 2010. www.museum.lsu.edu/~Remsen/SACCBaseline.html. 

Tyler, S. J. 2004. Family Motacillidae (pipits and wagtails). Pp. 686-786 in del Hoyo, J., Elliott, A. & Christie, 
D. A. (eds.) Handbook of the birds of the world, vol. 9. Lynx Edicions, Barcelona. 

Addresses: Johan Ingels, Galgenberglaan 9, B-9070 Destelbergen, Belgium, e-mail: johan. ingels@skvnet. 
be. Olivier Claessens, 31 rue Bernard Palissy, F-77210 Avon, France, e-mail: oclaessens@wanadoo. 
fr. Thomas Luglia, Residence Novaparc, N°16, batiment D, 1892 route de Raban, F-97300 Cayenne 
(French Guiana), France, e-mail: tluglia@yahoo.fr. Patrick Ingremeau, 15 rue Edward Telon, F-97354 
Remire-Monrjoly, (French Guiana) France, e-mail: patrick.ingremeau@laposte.net. Martvn Kenefick, 
36 Newalloville Avenue, San Juan, Trinidad, Republic of Trinidad & Tobago, e-mail: mart\Tikenefick@ 
hotmail.com 



© British Ornithologists' Club 2010 



D. A. Turner 



227 



Bull. B.O.C. 2010 130(3) 



The correct type locality of Cisticola chiniana humilis 
Madarasz, 1904, with comments concerning the true 
identity of the collector 

by D. A. Turner 

Received 9 February 2010 

Madarasz (1904) described Cisticola humilis from two females collected in 'Gebirge 
Lettema (EA)' on 28 March and 11 April 1904 by 'Koloman Katona'. Lynes (1930) in 
discussing C. chiniana humilis gave the type locality as Settima Mts., Kenya Colony, and in 
his subsequent list of localities and dates referred to the type of humilis as being from the 
Settima Mts. in Naivasha District. Settima Mts. was retained as the type locality for humilis 
by Friedmann (1937), Jackson & Sclater (1938) and Mackworth-Praed & Grant (1955), all 
clearly following Lynes (1930) as their authority. 

Unfortunately, Lynes had clearly confused 'Gebirge Lettema (EA)' with Settima, a 
high part of the Aberdare Mts. in central Kenya east of Lake Naivasha. In fact 'Gebirge 
Lettema (EA)' refers to the Lettema (or Lelatema) Mts. south of Moshi in northern Tanzania. 
Madarasz (1904) gave the name Koloman Katona as the collector of the type specimens, 
which was none other than Kalman Kittenberger, a Hungarian explorer, hunter, naturalist 
and collector of natural history specimens for the Hungarian National Museum in Budapest 
(Prys-Jones et al. 2008). He undertook two expeditions to German East Africa (later 
Tanganyika), in 1903-06, largely in the Kilimanjaro- Arusha-Moshi-Lake Jipe area, and 
from 1908-12, when he explored the area immediately east of Lake Victoria, now known 
as the Mara-Serengeti region of northern Tanzania. Other than traveling from Mombasa to 
Voi by train and then on foot to Kilimanjaro in January 1903, Kittenberger spent all his time 
in German East Africa, though he was in Loliondo District in January 1910 and his type 
of Sarothrura affinis antonii was collected in an area astride the modern Kenya-Tanzanian 
border. Kittenberger (1958-59), in one of his few papers in English, detailed his East African 
collecting expeditions, and commented on the name Katona. It appears that during his 
absence from Hungary the then Director of the National Museum in Budapest, arbitrarily 
applied instead of his real name, the name 'Katona'. In fact, Kittenberger himself never 
changed his name; it was only his brothers who 'Magyarized' their name to Katona. 

In the same document Kittenberger further confirmed the locality and dates of collection 
of C. c. humilis specimens as the Lettema Mts. on 28 March, 11 April and 28 May 1904. His 
sketch map clearly shows the position of the type locality (written Letatama Mts.) due 
south of Moshi. Modern maps of East Africa show this range as the Lelatema Mts., part of 
which being more widely known as the Merelani Hills, source of the gemstone Tanzanite. In 
common with the great majority of the specimens Kittenberger collected, all his C. c. humilis 
were deposited in the Hungarian National Museum, where they unfortunately perished in 
the fire that destroyed the bird collection in 1956 (Prys-Jones et al. 2008). 

The correct type locality of C. c. humilis therefore should be the Lelatema Mountains 
south of Moshi, northern Tanzania, at c.03°45'S, 37°20'E, collected by Kalman Kittenberger. 
This further extends the distribution of C. c. humilis from the western and central highlands 
of Kenya south to the Kilimanjaro-Moshi area of northern Tanzania, where it meets and 
quite possibly intergrades with C. c. ukamba. 

Acknowledgements 

I thank Dr R. Prys-Jones and R. J. Dowsett for their advice and comments during the preparation of this 
note. 



D. A. Turner 



22S 



BuU. B.O.C. 2010 130(3) 



References: 

Friedmann, H. 1937. Birds collected b\j the Childs Frick expedition to Ethiopia & Kenya Colony. Part 2 — Passeres. 

Smithsonian Institution, Washington DC. 
Jackson, F. J. & Sclater, W. L. 1938. Tlie birds of Kenya Colony and the Uganda Protectorate, vol. 2. Gurney & 

Jackson, London. 

Kittenberger, K. 1958-59. My ornithological collecting expeditions in East Africa. Aqnila 65: 11-37; 66: 53-87. 
Lynes, H. 1930. Review of the genus Cisticola. Ibis 12(6) (Suppl.): 1-673. 

Mackworth-Praed, C. W. & Grant, C. H. B. 1955. African handbook of birds: eastern and north-eastern Africa, vol. 

2. Longmans, London. 
Madarasz, G. 1904. Cisticola humUis n. sp. Orn. Monatsb. 12: 168. 

Prys-Jones, R., Fuisz, T. I. & Willard, D. 2005. An unfortunate and neglected collector of African birds. Pp. 
59-80 in Faczanyi, O. (ed.) Commemoration for Kdlmdn Kittenberger. Memorial meeting in the Hungarian 
Academy of Sciences. Orszagos Magyar Vadaszkamara, Budapest. [In Hungarian and English.] 

Address: P.O. Box 1651, Xaivasha 20117, Kenya. 

© British Ornithologists' Club 2010 

Merops oreobates (Sharpe 1892): a monotypic species or not? 

by D. A. Turner 

Received 9 February 2010 

Prior to Fry's (1969) major contribution on the evolution and svstematics of bee- 
eaters, it had been generally accepted by most authors including Jackson & Sclater (1938), 
Chapin (1939), Peters (1945), Boetticher (1951) and White (1965) that Cinnamon-chested 
Bee-eater Merops oreobates (Sharpe 1S92) is nothing more than a race of M lafresnayii Guerin- 
Meneville, 1S43. However, Grant & Mackworth-Praed (1937) had considered (mainlv on 
morphological grounds) that lafresnayii more closely resembles Blue-breasted Bee-eater M. 
variegatus Yieillot, 1817, than M.l. oreobates, and had proposed that lafresnayii be considered 
a race of variegatus, thereby leaving M oreobates a distinct monotvpic species of the East 
African highlands. This position was subsequently followed bv Mackworth-Praed & Grant 
(1952) but clearly rejected by White (1965). More recently, Fry (1984), Fry et al. (1988), Fry 
(2001) and Dickinson (2003) have all followed Grant & Mackworth-Praed (1937) and Fry 
(1969) in considering lafresnayii a race of variegatus. 

Throughout the greater part of its range in West, Central and East Africa, Al. variegatus 
is a bird of damp lowland grassland and lakeside vegetation (Chapin 1939, Benson et 
al. 1971, Button 1980, Zimmerman et al 1996, Dowsett et al. 2008), but the subspecies M. 
v. bangweoloensis does reach 2,000 m in swampy areas of the Ufipa Plateau, south-west 
Tanzania (D. Mover & R. j. Dowsett pers. comm.). This is in direct contrast with Al. oreobates, 
which throughout its range is a montane species of open forest, forest edges and woodlands 
at l,h00-2,300 m (Zimmerman et al. 1996). In Ethiopia lafresnayii is largely confined to the 
Rift Valley and adjacent highlands, favouring a variety of forest habitats between 530 m and 
1,830 m (Ash & Atkins 2009). 

Morphologically, lafresnayii is intermediate between variegatus and oreobates, being 
closer to the former in coloration, but nearer the latter in size and habitat preference. 
Vocalisations of lafresnayii are reportedly identical to those of oreobates but totally unlike 
variegatus (B. Finch pers. comm.). In Chappuis (2000) some vocals of variegatus are either 
a rather hard Hup, Hup, or slightly softer and more prolonged (e.g., a pair displaying), in 
contrast to the vocals of oreobates which are much higher pitched. Van Someren (1922) had 
commented that specimens of oreobates from the Turkwell (Gorge) area of north-west Kenya 
are sometimes very like Ethiopian birds, having the blue forehead, supercilium and neck- 



D. A. Turner 



229 



Bull. B.O.C. 2010 130(3) 



patch. Recent photographs of birds in typical oreobates habitat at Malewa River Lodge, at 
2,200 m, in the central Rift Valley of Kenya north of Lake Naivasha, and from Kakamega 
Forest (1,700 m) in western Kenya show birds with a prominent blue supercilium and, in 
the case of the Malewa bird, a bright violet-blue neck-band. 

Fry (1984) posed the question: 'is the large blue-gorgeted bird in the highlands 
of Ethiopia (lafresnayii) conspecific with the large black-gorgeted one in the highlands 
further south (oreobates), or with the small blue-gorgeted one of neighbouring lowlands 
(variegatus)?' '. Clearly inclining to the latter view, he felt that the two highland forms were 
independent derivatives of lowland M. variegatus, the Ethiopian population more recently 
so than the East African form on account of it showing similar characters (colour of forehead, 
supercilium and neck-band). Nevertheless, Fry (1984) doubted that unanimity would ever 
be reached on this problem, and that further revision might be necessary in the future. 

While it is probable that oreobates and lafresnayii are independently derived from 
variegatus, with components of variegatus appearing in both highland forms (not just 
lafresnayii as earlier thought by Grant & Mackworth-Praed, and Fry), with clear vocal and 
habitat differences between variegatus and the other two, surely oreobates can no longer 
be considered a monotypic species confined to the montane forests of East Africa? With 
lafresnayii having priority, oreobates would revert to Merops lafresnayii oreobates (Sharpe, 
1892) following White (1965). Meanwhile, it is hoped that DNA sequencing of both forms 
will be possible in the near future. 

Acknowledgements 

I thank R. J. Dowsett and Franchise Dowsett-Lemaire for their valued advice and comments during the 
preparation of this note. I also thank Ron Demey, David Mover and Brian Finch for their remarks, but above 
all I am grateful to Richard & Billy Fairburn for the remarkable photographs of a bee-eater taken at Malewa 
River Lodge near Naivasha, Kenya, which initiated this short note. 

References: 

Ash, J. & Atkins, J. 2009. Birds of Ethiopia and Eritrea. An atlas of distribution. Christopher Helm, London. 
Benson, C W., Brooke, R. K., Dowsett, R. J. & Irwin, M. P. S. 1971. The birds of Zambia. Collins, London. 
Boetticher, H. von. 1951. La systematique des guepiers. Oiseau & R.F.O. 5(21): 194-199. 

Britton, P. L. (ed.) 1980. Birds of East Africa, their habitat, status and distribution. E. Afr. Nat. Hist. Soc, Nairobi. 

Chapin, J. P. 1939. Phe birds of the Belgian Congo, pt. 2. Bull. Amer. Mus. Nat. Hist. 75: 1-632. 

Chappuis, C. 2000. Oiseaux dAfrique (African bird sounds), 2. West and Central Africa. CDs. Societe d'Etudes 

Ornithologiques de France, Paris & British Library, London. 
Dickinson, E. C. (ed.) 2003. The Howard and Moore complete checklist of the birds of the world. Phird edn. 

Christopher Helm, London. 
Dowsett, R. J., Aspinwall, D. & Dowsett-Lemaire, F. 2008. The birds of Zambia: an atlas and handbook. Pauraco 

Press & Aves, Liege. 

Fry, C. H. 1969. Phe evolution and systematics of bee-eaters (Meropidae). Ibis 111: 557-592. 
Fry, C. H. 1984. The bee-eaters. P. & A. D. Poyser, Calton. 

Fry, C. H. 2001. Family Meropidae (bee-eaters). Pp. 286-341 in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.) 

Handbook of the birds of the world, vol. 6. Lynx Edicions, Barcelona. 
Fry, C H., Keith, S. & Urban, E. K. (eds.) 1988. The birds of Africa, vol. 3. Academic Press, London. 
Grant, C. H. B. & Mackworth-Praed, C. W. 1937. On the relationship of Melittophagus variegatus and 

Melittophagus lafresnayii. Bull. Brit. Om. CI. 57: 129-130. 
Jackson, F. J. J. & Sclater, W. L. 1938. The birds of Kenya Colony and the Uganda Protectorate. Gurney & Jackson, 

London. 

Mackworth-Praed, C. W. & Grant, C. H. B. 1952. African handbook of birds: eastern and north-eastern Africa, vol. 
1. Longmans, London. 

Peters, J. L. 1945. Check-list of birds of the world, vol. 5. Mus. Comp. Zool., Cambridge, MA. 
van Someren, V. G. L. 1922. Notes on the birds of East Africa. Novit. Zool. 29: 1-246. 
White, C M. N. 1965. A revised check-list of African non-passerine birds. Govt. Printer, Lusaka. 
Zimmerman, D. A., Firmer, D. A. & Pearson, D. J. 1996. Birds of Kenya and northern Tanzania. Christopher 
Helm, London. 

Address: P.O. Box 1651, Naivasha 20117, Kenya. 

© British Ornithologists' Club 2010 



Robert Prys-Jones & Nigel Cleere 



230 



Bull. B.O.C. 2010 130(3) 



The type specimen of Bonin Grosbeak Chaunoproctus 

ferreorostris 

by Robert Prys-Jones & Nigel Cleere 

Received 2 March 2010 

In their type catalogue of passerines held in the collection of the Natural History Museum 
(BMNH), Warren & Harrison (1971) recorded specimen BMNH 1855.12.19.39, which they 
considered an adult male but was referred to by Vigors (1839) as probably juvenile, as the 
holotype of Bonin Grosbeak Chaunoproctus ferreorostris (Vigors, 1829). However, Dickinson 
et al. (2001) refuted this and referred to BMNH 1855.12.19.39 as a lectotype of C. ferreorostris, 
on the basis that both Vigors (1839) and Sharpe (1888) had referred to two specimens, the 
other being BMNH 1855.12.19.71, noted by Vigors (1839) as probably adult on the grounds 
that 'Were we to judge from analogy, the more brilliantly plumaged bird would be the 
young, the more plainly coloured the adult; as is the case in the nearly allied group, the Pine 
Grosbeak, Corythus enucleator, Cuv.' (Vigors 1839: 22). These two specimens differ greatly in 
coloration, 1855.12.19.39 having much red in its plumage that 1855.12.19.71 entirely lacks. 

Although Vigors (1839: 22) did note that There are two specimens of this species in the 
collection, differing, as above described, in their colours', in his very brief type description 
he mentioned only one (Vigors 1829), describing it using the identical Latin wording that he 
used in 1839 for the specimen he there defined as probably juvenile. Dickinson et al. (2001) 
are therefore incorrect that two syntypes ever existed, and specimen 1855.12.19.39 is indeed 
a holotype not a lectotype. 

Warren herself had clearly originally been confused, as there is an initialled pencil 
annotation by her on the label of 1855.12.19.71 stating 'syntype. Another is selected'. She 
apparently derived this opinion from Sharpe (1888: 31), who wrote 'Voy. H.M.S. 'Sulphur.' 
(Types of species)' against his entry for the specimens. Sharpe was wrong about the voyage 
and that both specimens had type status, as Warren noted both for the voyage (Warren 
& Harrison 1971) and for the type status, regarding which she annotated 'no female was 
describ(ed)' in pencil against the entry for C. ferreorostris in an NHM library copy of Sharpe 
(1888) that she used in her types work. 

References: 

Dickinson, E. C, Morioka, H. & Walters, M. P. 2001. Systematic notes on Asian birds. 19. Type material front 
Japan in The Natural History Museum, Tring, U.K. Zool. Verhand. Leiden 335: 215-227. 

Sharpe, R. B. 1888. Catalogue of the birds in the British Museum, vol. 12. Trustees of the Brit. Mus., London. 

Vigors, N. A. 1829. Sketches in ornithology: on some species of birds from the north-w est coast of America. 
Zool. /. 4: 352-358. 

Vigors, N. A. 1839. Ornithology. Pp. 13-40 in Richardson, J., Vigors, N. A., Lay, G. T., Bennett, E. T., Owen, 
R., Gray, J. E., Buckland, W. & Sowerby, G. B. (eds.) The zoology of Captain Beechey's voyage. Henry G. 
Bohn, London. 

Warren, R. L. M. & Harrison, C. ). O. 1971. Type-specimens of birds in the British Museum (Natural History), vol. 
2. Trustees of the Brit. Mus. (Nat. Hist.), London. 

Address: Bird Group, Department of Zoology, The Natural History Museum, Akeman Street, Tring, Herts. 
HP23 6AP, UK. 

© British Ornithologists' Club 2010 



Norbert Bahr 



231 



Bull. B.O.C. 2010 130(3) 



A new name for a subspecies of New World hawk 

by Norbert Bahr 

Received 9 March 2010 

Until recently, the phylogeny and systematics of birds of prey were based on 
morphological and behavioural traits (Stresemann & Amadon 1979, Wolters 1976, Amadon 
& Bull 1988, Thiollay 1994), which are often prone to convergence due to similarities in 
habitat use and prey spectra. With the development of molecular genetics and sophisticated 
statistical methods within the last two decades, it is now possible to study phylogenetic 
relationships within the Accipitridae more objectively, with the result that several recent 
molecular studies have revealed a far more complex picture of relationships at all taxonomic 
levels than hitherto supposed (Wink & Sauer-Gurth 2004, Helbig et al 2005, Lerner & 
Mindell 2005, Kocum 2006, 2008, Griffiths et al 2007, Haring et al 2007). Many genera, as 
currently circumscribed (Stresemann & Amadon 1979, Sibley & Monroe 1990, Thiollay 
1994, Ferguson-Lees & Christie 2001), do not form natural groups, but are of para- or even 
polyphyletic origin. This is especially true for the booted eagles and the buteonine hawks 
and kites, for which several taxonomic changes have been recommended or proposed (e.g. 
Riesing et al 2003, Lerner & Mindell 2005, Clark & Schmitt 2006, Haring et al 2007). 

For more than a century, ten species of Neotropical buteonine hawks have usually 
been placed in the genus Leucopternis Kaup, 1847. Several phylogenetic studies, based on 
mitochondrial and nuclear markers, have convincingly shown that Leucopternis is highly 
polyphyletic (Lerner & Mindell 2005, Kocum 2006, Amaral et al 2006, 2009, Lerner et al 2008), 
forming six different clades that are not each others closest relatives. Amaral et al (2009) 
erected new monotypic genera for two of the most aberrant species (now Cryptoleucopteryx 
plumbeus and Amadonastur lacernulatus), moved L. schistaceus to the genus Bnteogallus, and 
resurrected the long-synonymized genera Morphnarchus Ridgway, 1920 (for L. princeps) and 
Psendastnr Blyth, 1850 (for L. albicollis, L. occidentalis and L. polionotus), leaving just melanops 
(the type species of Leucopternis), kuhli and semiplumbeus in Leucopternis. However, the latter 
six species (genera Psendastnr and Leucopternis of Amaral et al. 2009) are genetically nestled 
within Buteo and should, according to Kocum (2006) and Lerner et al. (2008), be included 
in that genus along with the monotypic genera Asturina and Geranoaetus (cf. Hellmayr 
& Conover 1949, Riesing et al. 2003, Lerner & Mindell 2005, Clark & Schmitt 2006, for 
supporting data) and, depending on the genus concept applied, also the more distantly 
related, likewise monophyletic Rupornis, Percnohierax, Parabuteo and Morphnarchus. 

Accepting here the well-supported fusion of 'core' Leucopternis (including melanops, 
kuhli and semiplumbeus) , Pseudastur (including albicollis, occidentalis and polionotus), Asturina 
and Geranoaetus with Buteo, following the above-mentioned studies, we have a three-fold 
homonymy concerning the name costaricensis in the newly circumscribed Buteo. The oldest 
name is Buteo jamaicensis costaricensis Ridgway, 1874. Asturina nitida costaricensis Swann, 
1922, would become Buteo nitidus costaricensis, but that secondary homonym was already 
eliminated by Hellmayr & Conover (1949), who replaced it with Buteo nitidus blakei. 
The third name is Leucopternis albicollis costaricensis W. L. Sclater, 1919, for which, to my 
knowledge, no alternative name is available in synonymy if the species is moved to the 
genus Buteo. Accordingly I propose for it: 



Buteo albicollis delhoyoi, nom. nov. 



Norbert Bahr 



232 



Bull. B.O.C. 2010 130(3) 



Following Art. 72.7. of the Code (ICZN 1999), the new name takes the type of 
Leucopternis ghiesbreghti costaricensis W. L. Sclater, 1919, under which name the taxon was 
originally described. 

The new name honours the Spanish ornithologist Josep del Hoyo, initiator and editor 
of the monumental and magnificent Handbook of the birds of the world, for his outstanding 
contribution to bird conservation and ornithological science. 

Acknowledgements 

I thank E. C. Dickinson, G. M. Kirwan, A. P. Peterson, R. Schodde and F. D. Steinheimer for their helpful 
comments and suggestions. 

References: 

Amadon, D. & Bull, J. 1988. Hawks and owls of the world. An annotated list of species, with the genus Otus 

by Joe T. Marshall and Ben F. King. Proc. West. Found. Vert. Zool. 3: 295-357. 
Clark, W. S. & Schmitt, N. J. 2006. Melanistic specimen of Black-chested Buzzard-Eagle {Geranoaetus 

melanoleucus), with comments on the species' taxonomic position. /. Raptor Res. 40: 86-88. 
Amaral, F. S. R., Miller, M. J., Silveira, L. F., Bermingham, E. & Wajntal, A. 2006. Polyphyly of the hawk 

genera Leucopternis and Buteogallus (Aves, Accipitridae): multiple habitat shifts during the Neotropical 

buteonine diversification. BMC Evol. Biol. 6(10). 
Amaral, F. R., Sheldon, F. H., Gamauf, A., Haring, E., Riesing, M., Silveira, L. F. & Wajntal, A. 2009. Patterns 

and processes of diversification in a widespread and ecologically diverse avian group, the buteonine 

hawks (Aves, Accipitridae). Mol. Phyl. & Evol. 53: 703-715. 
Ferguson-Lees, J. & Christie, D. A. 2001. Raptors of the world. Christopher Helm, London. 
Griffiths, C. S., Barrowclough, G. F., Groth, J. G. & Mertz, L. A. 2007. Phylogeny, diversity, and classification 

of the Accipitridae based on DNA sequences of the RAG-1 exon. /. Avian Biol. 38: 587-602. 
Haring, E., Kvaloy, K., Gjershaug, J.-O., Rov, N. & Gamauf, A. 2007. Convergent evolution and paraphvlv 

of the hawk-eagles of the genus Spizaetus {Axes, Accipitridae) — phylogenetic analyses based on 

mitochondrial markers. /. Zool. Syst. Evol. Res. 45: 353-365. 
Helbig, A. J., Kocum, A., Seibold, I. & Braun, M. J. 2005. A multi-gene phylogeny of aquiline eagles (Aves: 

Accipitridae) reveals extensive paraphvlv at the genus level. Mol. Phyl. & Evol. 35: 147-164. 
Hellmavr, C. E. & Conover, B. 1949. Catalogue of birds of the Americas. Field Mas. Nat. Hist. Zool. Ser. 13, 

1(4): 1-358. 

International Commission on Zoological Nomenclature (ICZN) 1999. International code of zoological 
nomenclature. Fourth edn. International Trust for Zoological Nomenclature, c/o The Natural Historv 
Museum, London. 

Kocum, A. 2006. Phylogenie der Accipitriformes (Greifvogel) anhand verschiedener nuclearer und 

mitochondrialer DNA-Sequenzen. Dissertation. Ernst-Moritz-Arndt -Univ. Greifswald. 
Kocum, A. 2008. Phylogenie der Accipitriformes (Greifvogel) anhand verschiedener nuclearer und 

mitochondrialer DNA-Sequenzen. Vogelivarte 46: 141-143. 
Kruckenhauser, L., Haring, E., Pinsker, W., Riesing, M. J., Winkler, H., Wink, M. & Gamauf, A. 2004. Genetic 

vs. morphological differentiation of Old World buzzards (genus Buteo, Accipitridae). Zool. Scripta 33: 

197-211. 

Lerner, H. R. L., Klaver, M. C. & Mindell, D. P. 2008. Molecular phylogeny of the buteonine birds of prev 

(Accipitridae). Auk 125: 304-315. 
Lerner, H. R. L. & Mindell, D. P. 2005. Phylogeny of eagles, Old World vultures, and other Accipitridae based 

on nuclear and mitochondrial DNA. Mol. Phyl. & Evol. 37: 327-346. 
Riesing, M. J., Kruckenhauser, L., Gamauf, A. & Haring, E. 2003. Molecular phylogeny of the genus Buteo 

(Aves: Accipitridae) based on mitochondrial marker sequences. Mol. Phyl. & Evol. 27: 328-342. 
Sibley, C. G. & Monroe, B. L. 1990. Distribution and taxonomy of birds of the world. Yale Univ. Press, New Haven, 

CT & London. 

Stresemann, E. & Amadon, D. 1979. Order Falconiformes. Pp. 271—425 in Mavr, E. & Cottrell, G. W. (eds.) 

Check-list of birds of the world, vol. 1. Second edn. Mus. Comp. Zool., Cambridge, M A. 
Thiollay, J. M. 1994. Family Accipitridae (hawks and eagles). Pp. 52-205 in del Hovo, J., Elliott, A. & Sargatal, 

J. (eds.) Handbook of the birds of the world, vol. 2. Lvnx Edicions, Barcelona. 
Wink, M. & Sauer-Giirth H. 2004. Phylogenetic relationships in diurnal raptors based on nucleotide 

sequences of mitochondrial and nuclear markers. Pp. 483-498 in Chancellor, R. D. & Mevburg, B.-L . 

(eds.) Raptors worldwide. WWGBP & MME / BirdLife Hungary, Budapest. 
Wolters, H. E. 1976. Die Vogelarten der Erde. Lieferung 2. Paul Parev, Hamburg & Berlin. 

Address: Zur Fahre 10, D-29693 Ahlden, Germanv, e-mail: xenoglaux@t-online.de 

© British Ornithologists' Club 2010 



BOC Office 

P.O. Box 417, Peterborough PE7 3FX, UK 
E-mail: boc.office@bou.org.uk. Website: www.boc-online.org 
Tel. & Fax: +44 (0) 1733 844 820. 



MEMBERSHIP 

Subscription rates for 2010 were due for renewal from 1 January 2010. 

Please note that a single subscription rate of £20 applies regardless of whether the subscriber is a member of 
the BOU or not. The US$ alternative is no longer available. 

All paid-up members receive (postage free) four issues of the Bulletin (including index). 

Membership correspondence and applications for membership, changes of address and all other membership 
related items should be addressed to the BOC Office (above). No registered items should be sent to the P.O. 
Box. Contact BOC Office for direct mail of such items. For general Club correspondence see below. 

INSTITUTIONAL SUBSCRIBERS & APPLICATIONS FOR BACK NUMBERS 
OR OTHER CLUB PUBLICATIONS 

The Bulletin, together with annual index, may be purchased (postage free) by Institutional Subscribers, on 
payment of an annual subscription of £40 to the BOC Office (above) or via the BOC website (www.boc-online. 
org). Please note that the US$ option is no longer available. Back issues of the Bulletin are available from the 
BOC Office (above). BOC Occasional Publications and other BOC publications are available from the BOC 
Office or online from the BOC website (www.boc-online.org). 

Ideas for future publications and policy should be referred direct to the BOC: Dr D. R. Wells, BOU/BOC 
Commissioning Editor, c/o BOC Office, P.O. Box 417, Peterborough, PE7 3FX, UK. 

PAYMENTS 

All amounts quoted are net, should be paid in £ Sterling and sent to the BOC Office (above). Other currencies 
are not accepted. Other currency users can pay by credit card from which the Sterling amount will be 
deducted and the amount in your local currency will be indicated on your card statement. All cheques or 
drafts should be made payable to British Ornithologists' Club. Direct bank transfers can be made to Barclays 
Bank, Wavertree Boulevard, Liverpool L7 9PQ. Sort Code: 20-00-87. Account no: 10211540, with confirmation 
to the BOC Office (above). 

CLUB CORRESPONDENCE 

Correspondence on all general Club matters should be addressed to: The Hon. Secretary, S. A. H. (Tony) 
Statham, Ashlyns Lodge, Chesham Road, Berkhamsted, Herts. HP4 2ST, UK. E-mail: boc.sec@bou.org.uk. See 
inside front cover for details of Club meetings. 

COMMITTEE 

Miss H. Baker (Chairman) (2009) D. J. Fisher (Hon. Website Manager) (2007) 

Dr R. P. Prys-Jones (V ice-Chairman) (2009) S. M. S. Gregory (2009) 

S. A. H. Statham (Hon. Secretary) (2004) K. Heron Jones (2009) 

D. J. Montier (Hon. Treasurer) (1997) C. W. R. Storey (2009) 

M. J. Walton (2008) 

Ex-officio members 

Hon. Editor: G. M. Kirwan (1 January 2004) 

Chairman of BOU/BOC Joint Publications Committee (JPC): Revd. T. W. Gladwin 
Administration Manager: S. P. Dudley (2005) 
BOU/BOC Commissioning Editor: Dr D. R. Wells (2009) 



Registered Charity No. 279583 



Bulletin of the British Ornithologists' Club 

ISSN 0007-1595 
Edited by Guy M. Kirwan 

Volume 130, Number 3, pages 153-232 



CONTENTS 

Club Announcements 153 

INDRAWAN, M., MASALA, Y., DWIPUTRA, D., MALLO, F. N., MALESO, A., SALIM, A., 
MASALA, R, TINULELE, L, PESIK, L., KATIANDAGHO, D. S. & SUNOSOL Rediscovery of the 
Critically Endangered Banggai Crow Corous unicolor on Peleng Island, Indonesia, part 1: 
ecology 154 

MALLO, F. N., PUTRA, D. D., RASMUSSEN, P. C, HERLINA, SOMADIKARTA, S., INDRAWAN, 
M., DARJONO, MALLO, I. N., SWEET, P., RAHMAN, A., RAHARJANINGTRAH, W., MASALA, Y. 
& VERBELEN, P. Rediscovery of the Critically Endangered Banggai Crow Corvus unicolor on Peleng 
Island, Indonesia, part 2: taxonomy 166 

RHEINDT, F. E., VERBELEN, F., PUTRA, D. D., RAHMAN, A. & INDRAWAN, M. New 
biogeographic records in the avifauna of Peleng Island (Sulawesi, Indonesia), with taxonomic 
notes on some endemic taxa 181 

MAURER, G., RUSSELL, D. G. D., WOOG, F. & CASSEY, P. The eggs of the extinct Egyptian 

population of White-tailed Eagle Haliaeetus albicilla 208 

MEADOWS, B. S. On the status of Isabelline Lanius isabellinus, Turkestan L. phoenicuroides and 

Red-backed Shrikes L. collurio in the Eastern Province of Saudi Arabia 215 

SCHODDE, R. The identity and sources of Palaeomis anthopeplus Lear, 1831, and 

P. melanura Lear, 1832 (Regent Parrot), and their neotypification 219 

INGELS, J., CLAESSENS, O., LUGLIA, T., INGREMEAU, P. & KENEFICK, M. White Wagtail 

Motacilla alba, a vagrant to Barbados, Trinidad and French Guiana 224 

TURNER, D. A. The correct type locality of Cisticola chiniana humilis Madarasz, 1904, with comments 

concerning the true identity of the collector 227 

TURNER, D. A. Merops oreobates (Sharpe 1892): a monotypic species or not? 228 

PRYS-JONES, R. & CLEERE, N. The type specimen of Bonin Grosbeak Chawwproctus ferreorostris 230 

BAHR, N. A new name for a subspecies of New World hawk 231 



EDITORIAL BOARD 

Murray Bruce, R. T. Chesser, Edward C. Dickinson, Franchise Dowsett-Lemaire, Steven M. S. Gregorv, Jose 
Fernando Pacheco, Robert B. Payne, Pamela C. Rasmussen, Cees Roselaar, Thomas S. Schulenberg. Lars 

Svensson 

Authors are invited to submit papers on topics relating to the broad themes of taxonomy and distribution of 
birds. Descriptions of new species of birds are especiallv welcome and will be given priority to ensure rapid 
publication, subject to successful passage through the normal peer review procedure, and wherever possible 
should be accompanied by colour photographs or paintings. On submission, manuscripts, double-spaced and 
with wide margins, should be sent to the Editor, Guy Kirwan, preferably bv e-mail, to GMKirwan@aol.com. 
Alternatively, two copies of manuscripts, typed on one side of the paper, may be submitted to the Editor. 
74 Waddington Street, Norwich NR2 4JS, UK. Where appropriate halt-tone photographs may be included 
and, where essential to illustrate important points, the Editor will consider the inclusion of colour figures (if 
possible, authors should obtain funding to support the inclusion of such colour illustrations). 

As far as possible, review, return of manuscripts for revision and subsequent stages of the publication 
process will be undertaken electronically. 

For instructions on style, see the inside rear cover of Bulletin 130(1) or the BOC website. 

Registered Charity No. 279583 
© British Ornithologists Club 2010 

www.boc-online.org 



Printed on acid-free paper. 
Published by the British Ornithologists' Club 
l vpeset by Alcedo Publishing of Arizona. USA, and printed bv Latimer Trend, UK 



British Ornithologists' Club 




Volume 130 No. 4 
December 2010 



MEETINGS are normally held on the ground floor of the Sherfield Building of Imperial College, South 
Kensington, London, SW7. The suite is called the Tower Rooms and meetings will take place in Section A 
with the entrance opposite the Queen's Tower in the main quadrangle . The nearest Tube station is at South 
Kensington; a map of the area will be sent on request. (Limited car parking facilities can be reserved at a 
special reduced charge of £5, on prior application to the Chairman.) 

The evening will commence with a talk beginning at 6.00 pm. After the talk the cash bar will open 
so that attendees can socialise and at c.7.30 pm there will be a light buffet supper costing £15 per person for 
those who have ordered it in advance. Vegetarian and gluten-free options will be available for those who have 
requested them when booking. 

Meetings are open to all, not just BOC members. There is no charge to attend the talk and it is not 
necessary to book, but it would be helpful if you could notify the Chairman in advance to give us an idea 
how many people will be attending. 



FORTHCOMING MEETINGS 
See also BOC website: http://www.boc-online.org 



29 March — Joe Tobias — Singing in the rainforest: ornithological adventures in Amazonia 

Abstract: The forests of the Amazon basin support an incredible number of bird species, up to 600 at a single 
locality, and yet even the most basic details of their biology remain very poorly known. This talk describes 
the results of recent field work in Peru, Bolivia and Brazil, and hopes to shed a little light on some abiding 
mysteries, from the duet song of the antbirds to the origins of Amazonian diversity. 

Biography: Joe Tobias studied the behavioural ecology of Robins Erithacus rubecula in Cambridge Botanical 
Gardens for his PhD, before working in international bird conservation for a decade. He returned to academia 
to study the evolutionary biology of tropical birds, and is now a lecturer based at the Edward Grev Institute 
for Field Ornithologv in Oxford. 

Those wanting to order the buffet supper should apply to the Chairman (address below) by 15 March 2011 



14 June — Annual General Meeting — ■followed by short talks 

Details will appear in the next Bulletin. 

Those wanting to order the buffet supper should apply to the Chairman (address below) by 31 May 2011 



The Chairman: Helen Baker, 60 Townfield, Rickmansworth, Herts. WD3 7DD UK. Tel. +44 (0)1923 772441. 
I -mail: Helen. bakerbO@tiscali.co.uk 



BOC Office 

P.O. Box 417, Peterborough PE7 3FX, UK 
E-mail: boc.office@bou.org.uk. Website: www.boc-online.org 
Tel. & Fax: +44 (0) 1733 844 820. 



Club Announcements 



233 



Bull. B.O.C. 2010 130(4) 



Bulletin of the 

BRITISH ORNITHOLOGISTS' CLUB 



Vol. 130 No. 4 Published 14 December 2010 



CLUB ANNOUNCEMENTS 

Chairman's message: important changes to evening meetings 

As I mentioned in the June Bulletin, we are reducing the number of Club meetings to just four in 2011 and 
we are also changing the format. There will be three evening meetings each commencing with a talk at 
6.00 pm. Thereafter the bar will open and at 7.30 pm there will be refreshments for those who have booked 
them in advance. There will be no charge for attending the meeting and no need to book in advance unless 
ordering refreshments. Also, in an attempt to increase attendance, we will be advertising the talks locally and 
in birdwatching magazines in the UK. 

Details of the first two evening meetings appear opposite. We expect the third to be in September. Our 
fourth meeting will be an all-day event, which we are hoping to organise jointly with another club on a 
Saturday in November. The provisional date is 12 November. It will be held in London. Details will be placed 
on the website as soon as possible. 

Tony Statham is resigning as Hon. Secretary with effect from 31 December but will remain on the 
Committee until the AGM. I would like to thank him for all the work that he has done for the Club. Robert 
Prys-Jones is taking over as acting Hon. Secretary and David Fisher will become acting Vice-Chairman. I will 
serve as meetings organiser. 

Helen Baker 



The 959th meeting of the Club was held on Tuesday 26 January 2010 in the Sherfield Building, Imperial 
College, South Kensington, London, SW7. Fourteen members and six guests were present. 

Members attending were: Miss H. BAKER (Chairman), S. E. CHAPMAN, F. M. GAUNTLETT, R. 
H. KETTLE, R. R. LANGLEY, D. J. MONTIER, P. J. OLIVER, R. C. PRICE, Dr R. P. PRYS-JONES, R. J. 
PRYTHERCH, P. J. SELLAR, S. A. H. STATHAM, C. W. R. STOREY and M. J. WALTON. 

Guests attending were: C. BOWDEN (Speaker), Mrs M. A. GAUNTLETT, Mrs A. J. McDONALD, Mrs 
M. MONTIER, Mrs H. PRICE and Ms N. RICHARDS. 

After dinner, Chris Bowden gave an informative talk on Conserving the Northern Bald Ibis Geronticus 
eremita — what's being done to halt centuries of decline in Morocco, Syria, Turkey and elsewhere. The historical range 
and significance of Northern Bald Ibis starts in ancient Egypt where it had its own hieroglyphic symbol, and 
some recent work suggests it may already have been declining 4,000 years ago. Its disappearance was better 
documented from the European Alps >400 years ago, and since 1900 the range contraction has continued in 
North Africa and the Middle East, but most sharply since the 1950s when DDT and probably hunting caused 
extinction in the wild in Turkey (in 1989). The discovery of three relict pairs in Syria in 2002 was a welcome 
surprise, but even given the 100 pairs in Morocco at two coastal sites the species is still classified as Critically 
Endangered. 

Feeding habitat is essentially open steppe and agricultural fields, and its diet a wide range of 
invertebrate and small vertebrate prey. The species breeds on ledges on inaccessible cliffs within 20 
km of extensive feeding habitat. It is highly social, usually breeding and foraging in groups, and in the 
non-breeding period can congregate even more, making the species potentially vulnerable to one-off events. 
The Moroccan birds were afforded considerable protection when the Moroccan government declared the 
Souss-Massa National Park near Agadir in 1991, and the boundary of the park includes most feeding and 
breeding areas. RSPB research commenced in 1994 to identify actions to conserve the species. A key element 
has been recruiting and training seven local wardens, who were appointed from adjacent villages. They 
monitor the birds, help prevent disturbance by fishermen and tourists, and informally interact with local 
communities to inform them of the bird's importance. More specific interventions have been the provision 
of safe freshwater drinking points, which improve breeding productivity, as well as very occasional predator 
control. Systematic data collected in the foraging areas have been crucial for securing the protection of 
some key areas otherwise threatened with development for tourism. A related piece of work demonstrated 
that fallow areas left uncultivated for 2+ years support far higher lizard populations, and maintaining this 
regime may prove key to the long-term survival of the ibis. Half of the ibis population breeds just outside 
the national park, at Tamri, and this area urgently requires greater protection. The population was just 59 



Club Announcements 



234 



Bull. B.O.C. 2010 130(4) 



breeding pairs in 1997, following a mystery die-off, but had increased to 108 pairs by 2009 largely due to 
some of the above measures. 

The eastern population winters in Ethiopia, as revealed by recent satellite tracking of the Syrian 
breeders, whilst Moroccan birds are much more sedentary. Learning more about the route and causes of 
mortalitv has alreadv raised the alarm that hunting may well be a key reason for recent declines and urgentlv 
needs to be addressed. 

Semi-vvild (Turkey) and (mainly European) zoo populations are far more numerous than the wild 
birds. At Birecik (Turkey) the birds are free flying for six months, and recent release trials have shown 
promising signs of the potential to re-establish wild populations and even to supplement the precariously 
tiny Syrian population. An international group (the International Advisor}- Group for Northern Bald 
Ibis) established in 1999 has successfully helped channel efforts and resources, more recently through input 
to an International Species Action Plan. By involving key expertise representing the diverse interest groups 
and range state governments, and most recently via www.iagnbi.org where reports and priorities are 
readilv available, there is now coordinated guidance available to help the species improve its still precarious 
status*. 



The 962nd meeting of the Club was held on Tuesday 22 June 2010 in the Sherfield Building, Imperial College, 
South Kensington, London, SW7. Fifteen members and two guests were present. 

Members attending were: Miss H. BAKER {Chairman), Cdr. M. B. CASEMENT RN, Prof. R. A. CHEKE, 
F. M. GAUXTLETT, Dr L. D. C. FISHPOOL (Speaker), A. GIBBS, D. GRIFFIN", R. H. KETTLE, R. R. LAXGLEY, 
Dr C. F. MANX, D. J. MOXTIER, P. J. OLIVER. Dr R. P. PRYS-JONES, S. A. H. STATHAM and M. J. 
WALTON. 

Guests attending were: Mrs C. R. CASEMENT and Mrs M. A. GAUXTLETT. 

After dinner, Dr Lincoln Fishpool gave an interesting and comprehensive talk on BirdLife International's 
Important Bird Area programme: a global perspective. Important Bird Areas (IB As) are the sites-based component 
of BirdLife s conservation work. The origins of IBAs date to the late 1970s, when ICBP, the forerunner 
of BirdLife, was asked to help develop the means to implement the EU's Bird Directive. Since then, the 
programme has become global and over 10,000 IBAs have now been identified worldwide. 

IBAs are identified using a set of standardised selection categories using data gathered locallv, 
analysed national!}- and coordinated regionally, and it is these connections that are one of the reasons for the 
programme's success. One measure of this has been the designation of new protected areas — for example, 
as the result of a ten-country project in Africa, the proportion of IBAs with legal protection increased from 

Information for >200 countries and territories has been published in seven regional directories and over 
120 national publications, while boundaries have been digitised for c.95°o of sites. With the majority of sites 
now identified, at least on land, emphasis is shifting to monitoring. Using a simple methodology, information 
is collected locallv, largelv bv volunteers, to produce indicators of 'state', 'pressure' and 'response' for each 
site. These can be integrated to provide assessments of status and trends at IBAs nationally and regionally, 
which have powerful advocacy messages. 

While IBA coverage now extends to almost all terrestrial and freshwater parts of the globe, this is 
not the case for the marine environment. Methods for IBA identification at sea are still being developed, 
including, for example, exploring how the results of seabird satellite tracking can be used to inform IBA 
boundary designation. BirdLife is collaborating uith Wetlands International and other organisations to 
develop a 'Critical Site Network Tool' for waterbirds in the region covered bv the Africa-Eurasian Waterbird 
Agreement. Combining IBA information with International Waterbird Census data, the 'Wings Over 
Wetlands' project has looked at site networks from a flvwavs perspective. This has included assessments 
of how complete the coverage of each population is, based on comparisons of total numbers at known sites 
with the size of the population as a whole, therebv pointing up potential gaps. The tool can be seen at www. 
wingsoverwetlands.org csntool. 

IBA networks are also being examined for their likely resilience in the face of projected climate change 
between now and 20S0. This includes assessments of the scale of projected turnover of prioritv species at 
sites. Such studies have also highlighted those sites whose climates are not anticipated to change significantly 
over this period, heightening their importance for conservation. 



REVIEW 

Cleere, N. 2010. Nightjars of the uvrld. Wild Guides, Maidenhead. 464 pages, many maps and 580 colour 
photographs. UK£45.00. 

Covering not only nightjars, but also potoos, frogmouths, owlet-nightjars and the remarkable Oilbird 
Steatornis caripensis, this is a truly lavish production and verv welcome, notwithstanding that three other 
major reviews of the Caprimulgiformes have appeared in little over a decade. A series of short introductory 
chapters treat expected topics including general biology and taxonomy, but set the scene for what is to come 



Club Announcements 



235 



Bull. B.O.C. 2010 130(4) 



in being superbly illustrated. Some stunning images appear in this part of the book; those of Pennant-winged 
Nightjar Macrodipteryx vexillarius, Standard-winged Nightjar M. longipennis and Sickle-winged Nightjar 
Eleothreptus anomalus all on p. 30, and the 'frycatching' Long-tailed Potoo Nyctibius aethereus are personal 
favourites. Thereafter the individual accounts treat 135 species, i.e. 16 more than in Cleere (1998) and 17 
more than in Holyoak (2001), and this still does not take account of yet more potential species-level taxa 
in South America alone. 'New' species recognised here include Tepui Nightjar Antrostomus roraimae (split 
from Band-winged Nightjar A. longirostris), Palau Nightjar Caprimulgus phalaena (split from Jungle Nightjar 
C. indicus), Indochinese Frogmouth Batrachostomus continentalis (split from Javan Frogmouth B. javensis) and 
Solomons Frogmouth Rigidipenna inexpectata (split from Marbled Frogmouth Podargus ocellatus). It is worth 
mentioning that only in half of these cases does the text make explicit the background, which seems an 
oversight. 

Each species account typically covers 2-4 pages, occasionally six, of which only one page is devoted to 
text and maps. As already intimated, the standard of the field photography is stunningly high. One imagines 
that if the same author had attempted a similar guide in the 1990s, when his Pica Press monograph appeared, 
the result would have been substantially different and many more taxa would have relied on use of specimen 
images. In any case, some of the museum 'studies' used here augment photos of live birds, rather than being 
mere substitutes. It is surprising, however, that all four images of the relatively abundant Tawny-collared 
Nightjar Antrostomus salvini are of specimens. Each photograph is labelled as' to age, sex and racial identity, 
wherever possible or relevant. The credits, including locality, date and photographer's name, comprise one 
of the book's end sections, but are well laid out, permitting the reader to very swiftly find the relevant details, 
unlike in some guides where such information is less accessibly presented. On the negative side, it might also 
be noted that for South American localities at least, use of accents is massively flawed and quite a few other 
spelling mistakes have crept in too, despite two named editors! 

The very brief texts cover length, identification, main confusion species, vocalisations, habitat, breeding, 
range (including that for different subspecies, where appropriate), and status, as well as the IUCN Red List 
category as of 2009. Their brevity means that in a handful of cases, quite some white space goes 'begging' 
(see, for examples, pp. 102, 110, 122 and 134). Thumbnail outline sketches of both sexes in flight to show 
the distribution of pale markings in the wings and tail would have been useful 'fillers', at least for all of 
the Caprimulgidae. Multiple generic changes are recognised by Cleere based on new genetic and other 
evidence, most notably with the resurrection of Antrostomus for many Western Hemisphere nightjars 
formerly placed in Caprimulgus. With characteristic 'bad' timing, yet another paper substantially resolving 
our understanding of Caprimulgiform generic relationships appeared just too late to be taken into account. 
It would be interesting to know Cleere's rationale for persisting to use a hyphen in Donaldson-Smith's 
Nightjar Caprimulgus donaldsoni, when both the explorer himself (see the title page to Through unknown 
African countries, published in 1897; www.biodiversitylibrary.org/item/45895#9) and his contemporaries 
did without. Sharpe, for instance, who named several taxa for him, including the nightjar, always referred to 
Donaldson Smith (e.g. Bull. But. Orn. CI. 4: 28-29, 32, 41; 5: 14). 

Two maps are provided for every species, one 'identifying' the species' range on a world map, the 
second depicting the distribution in some detail. The maps represent one of the weakest components, in 
my experience. Although visually pleasing, quite some of the New World species are compromised by 
inaccuracies. Neither Hispaniolan Nightjar Antrostomus ekmani, much less Least Poorwill Siphonorhis brewsteri, 
occurs throughout Hispaniola, as Latta et al. (2006, Birds of the Dominican Republic and Haiti, Christopher 
Helm) made abundantly clear, while Todd's Nightjar A. heterurus is mapped for extreme north-west Guyana, 
but the first and all subsequent country records are from the far south (see Milensky et al., 2009, Bull. Brit. 
Orn. CI. 129: 119-120). Given that the text is so brief on this (and other topics), that the maps should be as 
accurate as possible becomes doubly important, especially as this could impact identification, an aid to 
which is apparently one of the book's principal aims. Other examples of missed distributional data include 
the following. Spot-tailed Nightjar A. maculicaudus and Ladder-tailed Nightjar Hydropsalis climacocerca 
both range across the rio Araguaia into Tocantins (Pinheiro & Dornas, 2009, Biota Neotropica 9: 187-205), 
Silky-tailed Nightjar Antrostomus seriocaudatus occurs further south in Brazil than shown (Rupp et al, 2007, 
Rev. Bras. Orn. 15: 605-608), Least Nighthawk Chordeiles pusillus is reasonably widespread across suitable 
habitat in the interior of southern and eastern Brazil, e.g. in Minas Gerais, but also south to Rio Grande do Sul 
(Sick, 1997, Ornitologia brasileira, Ed. Nova Fronteira; Repenning & Fontana, 2008, Rev. Bras. Orn. 16: 58-63), 
while Long-tailed Potoo occurs over the eastern Brazilian littoral from Bahia to Parana, not, as shown, over 
the northern Cerrado zone (Sick op. cit.). I have personally observed the latter species in four different states 
in the relevant region, and to 1,100 m (considerably higher than the maximum elevation given by Cleere). 
Given the 'barrage' of publications on the distributions of Neotropical birds, in particular, in recent years, it 
is unsurprising that the author has been unable to keep abreast of everything, but then it might have been 
wise to enlist (more) assistance? 

These criticisms aside this book has, dare I say it, set a new standard in avian photographic guides. 
Expensive perhaps, but not for the amount of work that has gone into its preparation, and remember too that 
a percentage of all sales is donated to BirdLife International. Some might dismiss it as not sitting comfortably 
in any genre, neither a monograph nor a complete identification guide, and certainly not a coffee-table book, 



Club Announcements 



236 



Bull. B.O.C. 2010 130(4) 



but I'm certain that just as many others will simply enjoy it for being the visual feast that it undoubtedly is. 
Cleere will, I'm sure, stimulate more than a few of his readers to track down these nocturnal treats, and I 
have a feeling that he has also sown the seeds for similar guides to other groups. 

Guy M. Kirzvan 



REFEREES 

I am grateful to the following, who have reviewed manuscripts submitted to the Bulletin during the last 
year (those who refereed more than one manuscript are denoted by an asterisk in parentheses): Alexandre 
Aleixo, Per Alstrom, Richard C. Banks, Bruce Beehler, Walter Boles, W. R. P. Bourne (*), Frederik Brammer, 
Mark Brazil, Vincent Bretagnolle (*), Michael Brooke, Paul Buckley, Peter Castell, Santiago Claramunt (*), 
Anthonv S. Cheke, R. Terry Chesser, Diego Cisneros-Heredia, William S. Clark (*), Nigel Cleere (*), Mario 
Cohn-Haft, Nigel J. Collar, Charles T. Collins, Martin Collinson, Ron Demey (*), Edward C. Dickinson (*), 
Robert J. Dowsett, Francoise Dowsett-Lemaire, Guy Dutson (*), Clemency T. Fisher, Juan F. Freile (*), Hilary 
Frv, Anita Gamauf, Steven M. S. Gregory (*), George Henderson, Robert O. Hutchinson, Mike Imber, Johan 
Ingels, Morton L. Isler, Oliver Komar, Reiko Kurosawa, P. Andrew Lassey, Paul J. Leader, Mary LeCrov, 
Jeremv Lindsell, Huw Llovd, Wayne Longmore (*), Clive Mann, Ian McAllan, Peter Meininger, Hirovuki 
Morioka, Julian O'Halloran, Fabio Olmos, Penny Olsen, David Parkin, Jose Fernando Pacheco (*), Robert B. 
Payne, Alan Peterson (*), Theunis Piersma, H. Douglas Pratt (*), Thane Pratt (*), Robert Prys-Jones (*), Pamela 
C. Rasmussen (*), Robin Restall, Jon Riley, Mark B. Robbins, C. S. Roselaar (*), Tatiana Santander, Richard 
Schodde (*), Chris Sharpe, Frank Steinheimer (*), Lars Svensson (*), Colin Trainor, David R. Wells, Andrew 
Whittaker, Gary Wiles, Bruce Young and Kevin J. Zimmer (*). — The Hox. Editor 



Luis Sandoval et al. 



237 



Bull. B.O.C. 2010 130(4) 



Recent records of new and rare bird species in Costa Rica 

Luis Sandoval, Cesar Sanchez, Esteban Biamonte, Jim R. Zook, Julio E. 
Sanchez, Daniel Martinez, Daryl Loth & Jerry O'Donahoe 

Received 2 December 2009 



Summary. — We report new data on distribution, colonisation and breeding of 17 
species recently recorded in Costa Rica for the first time, such as Greater Shearwater 
Puffinus gravis and Savanna Hawk Buteogallus meridionalis, as well as information 
for nine other species with few previous records in Costa Rica, e.g. Green-winged 
Teal Anas crecca, Ocellated Poorwill Nyctiphrynus ocellatus and Chipping Sparrow 
Spizella passerina. The majority of new records involve species that have expanded 
their range north from Panama (11 species), due principally to deforestation. 



Since the publication of Stiles & Skutch (1989), the distribution and abundance of some 
resident (Sandoval 2004, Sandoval & Ellis 2006) and migratory species has changed in Costa 
Rica (Garrigues & Dean 2007). For example, species such as Melodious Blackbird Dives 
dives have become common throughout the country (Sanchez et al. 1998). Furthermore, 
19 species have been recorded for the first time, primarily from the Pacific south-west, 
the Caribbean coast, and on Cocos Island (Acevedo-Gutierrez 1994, Sanchez et al. 1998, 
Barrantes et al. 2002, Solano-Ugalde & Herrera 2005, Garrigues & Dean 2007, Obando et al. 
2007a, 2008). Most recently recorded species inhabit open areas, forest edge or secondary 
forest (Sanchez et al. 1998, Garrigues & Dean 2007), all of which habitats have recently 
increased in Costa Rica due to 
deforestation (Roxero-Bixby et 
al. 2002, Barrantes & Lobo 2005, 
Joyce 2006). Here we provide 
information on distribution, 
colonisation and breeding of 
17 species recently recorded 
in Costa Rica (including the 
country's territorial waters) 
for the first time (Fig. 1). We 
also provide new information 
for nine other species with 
few previous records for the 
country. Most data included 
here were obtained in 1997- 
2009, and photographs will 
be archived at the Union de 
Ornitologos de Costa Rica, 
San Jose. We also include data 
provided by other observers, 
whose full names are given in 
the Acknowledgements. 




Figure. 1. Map showing Costa Rica's provinces and borders. 



Luis Sandoval et al. 



238 



Bull. B.O.C. 2010 130(4) 



Species accounts 

GREEN- WINGED TEAL Anas crecca 

The first and only previous record was in 1962 (Stiles & Skutch 1989). Five new records are 
as follows. An adult male was at Finca Las Concavas, Cartago (09°50 , N / 83°53'W; 1,300 m) 
in late December 1999-early March 2000 (CS, JES & RG). It was with Blue-winged Teals 
Anas discors and Black-bellied Whistling Ducks Dendrocygna antumnalis. A male was in 
Palo Verde National Park, Guanacaste (10°20'N, 85°21'W; 25 m) on 12-16 February 2000 
(JZ). Two males were at Lagunas Catfish Farms, near Comunidad, Guanacaste (10°32 / N, 
85°37'W; 40 m) on 15-29 February 2008 (JZ & CJ) with many other ducks. A female was seen 
there on 16 March 2008 (JH). A female was with six A. discors on a small pond at Cenizas de 
Perez Zeledon, San Jose (09°18'N, 83°42'W; 750 m) on 1 March 2008 (JZ). 

GREATER SHEARWATER Puffinus gravis 

Although the bones of a shearwater found in Tortuguero, Limon, were considered to belong 
to a Greater Shearwater (Carr 1979), their identification has been questioned, and there are 
no confirmed Costa Rican records (Stiles & Skutch 1989, Obando et al. 2007a). On 22 June 
2007 an exhausted male was found on the beach at Tortuguero, Limon (10°33'N, 83°30'W); 
it died the same day (Museo de Zoologia, Universidad de Costa Rica; UCR 4156). To our 
knowledge, the closest records to Costa Rica are from Venezuela, where the species has been 
seen offshore in June and August (Hilty 2003), Trinidad & Tobago (Hayes & White 1999), 
and Quintana Roo, Mexico (Ash & Watson 1980). The date of the Costa Rican specimen 
coincides with the species' northbound migration (Harrison 1985), which in the Caribbean 
Basin seems to peak in early to mid June through the Lesser Antilles (Buckley et al. 2009). 

AMERICAN WHITE PELICAN Pelecanus erythrorhynchos 

Accidental in Costa Rica, with just two previous reports (Stiles & Skutch 1989, Garrigues & 
Dean 2007). A single was at the mouth of the rio Parismina, Limon (10°18'N, 83°21'W; 1 m) 
on 5 January-19 February 1999 (JES). It was observed with Brown Pelicans '?, occidentalis 
on a riverbank. A few days later, one was at Parque Vargas, in downtown Limon (09°59'N, 
83°01'W; 2 m), close to the port (JES). We suspect that the same individual was involved in 
these two records, given their geographical proximity. 

STRIATED HERON Butorides striata 

The two previous records for Costa Rica involve a specimen taken in April 1923 at Canas, 
Guanacaste (Stiles & Skutch 1989) and a sight record from Alajuela in 2005 (Obando et al. 
2007b). The third record, and the first from the Pacific coast, was an adult photographed at 
the border of a rice field near mangrove at Esterillos, Parrita, Puntarenas (09°31'N, 84°28'W), 
on 2 March 2008 (WC). 

SAVANNA HAWK Buteogallus rheridionalis 

We report the first records for Costa Rica. The first was observed on 15 April 2008, 5 km 
south of Zancudo, Puntarenas (08°29'N, 83°06'W; 5 m), perched on a fence at the edge of a 
rice field being ploughed (JOD). Subsequently, two adults and an immature were nearby, 
at La Cuesta, Puntarenas (08°28'N, 82°52'W; 60 m), on 24 February 2009 (SE) and 5 March 
2009 (JZ), also in a rice field being ploughed. Common in open country west of Colon, 
Panama (CS pers. obs.), the species was expected in Costa Rica (Stiles & Skutch 1989) given 
its preference for open habitats, which are now widespread in the Pacific lowlands (Joyce 
2006). 



Luis Sandoval et al. 



239 



Bull. B.O.C. 2010 130(4) 



PEARL KITE Gampsonyx swainsonii 

The first report in Costa Rica was on 30 November 1996 at La Trocha de Perez Zeledon, 
San Jose (09°21'N, 83°40'W; 650 m). Most subsequent observations are from the south of 
the country, especially in the Pacific lowlands to 1,200 m. We report the first breeding 
records and the first sightings on the Caribbean coast. Breeding has been noted mainly in 
the southern Pacific lowlands, where at least four nests have been found at two localities. 
The first was at Talari Mountain Lodge, Perez Zeledon, San Jose (09°25'N, 83°40'W; 840 m), 
early in 2000 (PW). Another was at Bajo Coto, Buenos Aires, Puntarenas (08°57'N, 83°04'W; 
313 m) in February 2005; it contained two chicks of unknown age (EB). In 2006, presumably 
the same pair built a nest c.50 m away; on 17 March it contained three fully feathered 
chicks. Another nest was observed on 19 March 2006 in Talari (CS), but its stage could 
not be determined. All nests were of sticks and small branches, were placed in partially 
leafless trees 18-20 m up in the canopy, and were similar to those described elsewhere 
(Thiollay 1994). All nests in Costa Rica have been on the Pacific slope during the dry season 
(December- April). The species has presumably dispersed north from Panama as far as 
Rincon de la Vieja and Palo Verde in Guanacaste. Since 2006, there have been three records 
on the Caribbean coast: singles near Sixaola, Limon, near the Panama border (09°33'N, 
82°53'W; 50 m) on 4 January 2008 (LS), on the coast c.30 km south of Puerto Limon (09°47'N, 
82°54'W; 2 m) on 1 December 2007 (FPM), and between Estero Negro and Puerto Viejo, 
Limon (09°47'N, 82°53'W; 2 m) on 31 January 2009 (DM). 

CLAPPER RAIL Rallus longirostris 

One observed in a mangrove by JES, on 16 June 1997, near the confluence of the rfos 
Bebedero and Tempisque, at the head of the Gulf of Nicoya, Guanacaste (10°15'N, 84°14'W; 
21 m) was the first record for Costa Rica. Despite the lack of subsequent reports, Garrigues 
& Dean (2007) suggested that the species is resident in mangrove on the Gulf of Nicoya. 
The species' status and distribution in the tropics is poorly understood, and given the lack 
of further records, and the dispersal ability of rails, we cannot eliminate the possibility that 
this bird was a wandering individual. 

SOUTHERN LAPWING Vanellus chilensis 

Since the first record for Costa Rica, in 1993, along the rio Sarapiqm (Sanchez et al. 1998), the 
species has increased throughout the country. On the Pacific slope it has reached north as 
far as Palo Verde National Park and its environs (Trama et al. 2006), and on the Caribbean 
slope as far north as Arenal (CS). Two were in the Central Valley, at Valle del Sol, San Jose 
(09°56'N, 54°12'W), on 2 October 2007 (LB), increasing its elevational range in the country 
to 850 m. Nesting has been observed at two sites at Los Lagos, Arenal (10°29'N, 84°43'W; 
300 m), in consecutive years. The species continues to expand its range, mainly in humid 
lowland pastures (JZ). 

LONG-BILLED CURLEW Numenhis americanus 

Three recent observations of this rare migrant (Stiles & Skutch 1989, Garrigues & Dean 
2007). Singles were at Playa Azul, Garabito, Puntarenas (09°78'N, 84°64'W) on 26 February 
2005 (DM), in a fallow rice field at Pelon de La Bajura, Guanacaste (10°26'N, 85°25'W; 20 m) 
on 19 November 2005 (JZ), and at Salinas Santos, Colorado de Abangares (10°10'N, 85°06'W; 
5 m) on 10 September 2008 (FPM). 



Luis Sandoval et al. 



240 



Bull. B.O.C. 2010 130(4) 



LARGE-BILLED TERN Phaetusa simplex 

The first report was on 15 March 2003 at the no Tortuguero, Limon (Obando et al. 2007a,b, 
Garrigues & Dean 2007), while the second record involved one at Matina, Limon (10°06 , N, 
83°irW; 2 m) on 13 June 2007 (DL), c.58 km south of the first. P. simplex inhabits freshwater 
habitats and is common throughout South America as far north as the Colombia / Panama 
border (Ridgely & Gwynne 1989). Vagrancy even further north is known, as there are two 
specimen records from Cuba, both from the north coast, one on an unknown date and the 
other taken on 28 May 1910 (Garrido & Kirkconnell 2000). 

WHITE-CROWNED PIGEON Patagioenas leucocephala 

Just one previous record, involving one seen in flight, on the Caribbean coast, at the 
mouth of the rio Tortuguero, Limon, in March 1987 (Stiles & Skutch 1989). Garrigues & 
Dean (2007) mentioned subsequent records, but without dates or locations. JES observed 
one on 8 February 2005, also in Tortuguero (10°33'N, 83°30'W), feeding on Miconia sp. 
(Melastomataceae) fruits at the edge of a canal in mature secondary forest with Yolillo 
palms Raphia taedigera (Arecaceae). Further records from Costa Rica were considered likely, 
given that the species apparently ranges to mainland areas from its island breeding grounds 
in search of food (Stiles & Skutch 1989). 

BROWN-THROATED PARAKEET Aratinga pertinax 

First recorded in 1996 near the Panama border in the southern Pacific (Sanchez et al. 
1998). Since then, its range has expanded through the disturbed lowlands west to La 
Gamba-Golfito (83°10'N, 08°43'W; 80 m) (Garrigues & Dean 2007). Further range expansion 
is evidenced by a flock at Palmar Sur (08°55'N, 83°27 , W; 14 m) on 13 January 2006 (LS), 
the westernmost report in Costa Rica. The highest-elevation report involved a small flock 
at Sabalito de Coto Brus, Puntarenas (08°49'N, 82°55 , W; 920 m) on 24 August 2002 (JZ). 
Although we are unaware of any breeding records, we expect that this parakeet nests in 
the country, because the population is resident and is quite common in the Pacific lowlands 
near the Panama border. 

GREATER ANI Crotophaga major 

First reported in Costa Rica in 2003-04 at Tortuguero (10°33'N, 83°30'W) (Garrigues & 
Dean 2007), during 2005 and January 2010 a single was observed (DL) on several occasions 
in forest edge vegetation along freshwater channels in Tortuguero, Limon, to Cuatro 
Esquinas Island (10°32'N, 83°30'W). The habitat is similar to that occupied by the species 
elsewhere (Hilty 2003). There is one previous record even further north, two birds collected 
in Tamaulipas, Mexico, in 1960 (Olson 1978). 

NORTHERN POTOO Nyctibius jamaicensis 

Considered uncommon in the Pacific dry forest (Garrigues & Dean 2007), although there 
are few data on the species' range and habitat preferences in Costa Rica (Barrantes ct al. 
2002, Obando et al. 2007a). There is a previous report of one at Santa Rosa National Park 
Guanacaste (10°50'N, 85°37'W; 50 m), in April 2006 (Obando et al. 2007a). The easternmost 
record in Costa Rica involves a single observed at Punta Morales, Puntarenas (10°04'N, 
84°57'W; 5 m), on 16 November 2008 (LS & EB), feeding on insects attracted to a light at 
the edge of a mangrove. Approximately one hour later, the bird was heard singing. On 2 
December 2008, JES & JF observed a pair at the same locality. Our observations in north-west 
Costa Rica, and the Santa Rosa record; were in deciduous forest and adjacent mangrove. 



Luis Sandoval et al. 



241 



Bull. B.O.C. 2010 130(4) 



OCELLATED POORWILL Nyctiphrynus ocellatus 

Previously recorded only at Brasilia de Upala, Alajuela (Stiles & Skutch 1989), the species' 
current status in Costa Rica is considered uncertain (Garrigues & Dean 2007). On 13 February 
2007 one was heard calling at Finca Las Crucitas, San Carlos, Alajuela (10°52'N, 84°19'W; 56 
m), 86 km east of the first record (CS). The bird vocalised continually from 19.00 to 20.30 h 
next to a patch of partially logged forest, with tall trees (c.35 m) and a dense understorey, in 
an area where gold mining has reduced the forest to remnant patches. The night was clear 
with no moon. Next night, one was heard in the same area, at c. 18.30 h, but it only called 
twice'. The species' range in Central America is poorly known. For example, in northern and 
central Nicaragua it is rare and inhabits montane forest at 800-1,000 m (Martinez-Sanchez 
2007), whilst in Honduras there is an isolated population (Anderson 2000) and in Panama 
there is just unconfirmed record from the Canal Zone (AOU 1998). 

MOUSE-COLOURED TYRANNULET Phaeomyias murina 

First recorded in Costa Rica in 1996, when one was mist-netted at La Trocha de Perez 
Zeledon, San Jose (Sanchez et al. 1998). The northernmost observation on the Pacific coast 
was at Carara National Park, Puntarenas (09°46'N, 84°36'W; 34 m) on 13 December 2008 
(LS). The first report on the Caribbean coast involved one at Comadre-Fila Carbon, Limon 
(09°42'N, 82°49'W; 20 m) on 22 January 2009 (DM). Direct evidence for breeding is lacking, 
but it presumably breeds in the San Vito Valley, where the species is apparently resident 
and increasing (JZ). 

RUSTY-MARGINED FLYCATCHER Myiozetetes cayanensis 

The first report was at La Gamba, Golfito, Puntarenas, on 7 April 2004 (MD; Garrigues 
2004), while the second was at Tiskita Lodge, Pavones, Puntarenas (08°21'N, 83°08'W; 5 
m), on 2 March 2005 (CS), perched beside an airstrip in second growth. On 26 March 2006, 
RG found a nest at La Gamba, Golfito, Puntarenas (83°10'N, 08°43'W, 80 m). The nest was 
typical of the genus, being a roofed structure constructed of grass fibres (Skutch 1976, Stiles 
& Skutch 1989). It was in a shrub, 1 m above a freshwater canal. The entrance was possibly 
at the bottom, as the nest did not appear to have a side entrance, and the nest tree was 3 
m from a dirt road, in a pasture. The birds perched c.30 cm from the nest. The date and 
location above water are consistent with Dyrcz's (2002) observations on Barro Colorado 
Island in Panama. 

TROPICAL MOCKINGBIRD Mimus gilvus 

The first report for Costa Rica was at Siquirres, Limon, in 2000 (JES). M. gilvus is now a 
resident breeder, with nesting recorded in several areas on both slopes (e.g. in downtown 
Limon (09°59'N, 83°01'W; 5 m), Siquirres (10°05'N, 83°30'W; 90 m) and La Fortuna de Arenal 
(10°28'N, 84°39'W; 250 m). Several have been observed in the Central Valley, including 
at Cartago, where two were seen in July-August 2004 (CS) visiting a feeder, consuming 
bananas. Also in this area, another adult was feeding a juvenile at Las Concavas (09°50'N, 
83°53'W) on 29 October 2008 (JES, LS, DM). A report in El Rodeo-Coronado, San Jose 
(09°58'N, 84°00'W; 1,434 m), on 14 November 2006 (EB), and another in Oratorio-Oreamuno, 
Cartago (09°53'N, 83°49'W; 1,700 m), on 11 April 2009 (DM), are the highest-elevation 
records in Costa Rica. In Panama, the species has expanded its range since the 1930s 
(Ridgely & Gwynne 1989). To the north, the population has also been expanding rapidly 
south through Nicaragua (JZ pers. obs.). Thus, mockingbirds appear to be expanding their 
ranges from both the north and south in Central America. In addition, numbers in Costa 



Luis Sandoval et al. 



242 



Bull. B.O.C. 2010 130(4) 



Rica have increased since their arrival. We predict that it will become common in residential 
and open areas of Costa Rica, as has occurred elsewhere (Cody 2005). 

NASHVILLE WARBLER Vermivora ruficapitta 

Recorded sporadically in the last 20 years (Stiles & Skutch 1989, Garrigues & Dean 2007), 
with two recent observations. The first was at Chomes, Puntarenas (10°02 , N, 84°54'W; 5 m) 
on 21 September 2006 (LS, EB), where two birds foraged in a mangrove next to salt ponds. 
One was at Tirimbina Forest Reserve, Sarapiqm (10°23'N, 84°08 , W; 187 m) on 13 and 22 
February 2007 (JZ). 

GOLDEN-CHEEKED WARBLER Dendroica chrysoparia 

The first records in Costa Rica are as follows. A female in non-breeding plumage was in 
a shade-coffee plantation at Cerro Pata de Gallo, Palmares, Alajuela (10°02'N, 84°28'W; 
1,450 m), on 2 September 2002 (JZ). Single females were observed in Coronado, San Jose 
(09°58'N, 84°00'W), at 1,434-1,800 m, on 9 and 16 September 2003 (EB). The first was a lone 
bird foraging in a pine (Pinus sp.) in a garden and the second was accompanying a mixed- 
species flock in an area of pastures, living fences, second-growth alders Almis acuminata 
and remnants of natural vegetation. These are the southernmost reports for this globally 
threatened species, whose wintering grounds extend from the highlands of Chiapas, 
Mexico, to northern Nicaragua (AOU 1998). 

CHIPPING SPARROW Spizella passerina 

Previously known in Costa Rica from observations in San Pedro, San Jose, in September 
1977 (Stiles & Skutch 1989) and at Cahuita, Limon, in November 2001 (Garrigues & Dean 
2007). Two additional observations are as follows. One was at Coronado, San Jose, on 20 
October 2001 (EB); it fed on a dirt road with three Rufous-collared Sparrows Zonotrichia 
capensis. One in breeding plumage was at Savegre, Cerro de la Muerte (09°33'N, 83°48'W; 
2,320 m), in November 2008 (I A); it was perched 2 m high in a bush at the edge of secondary 
forest. 

LARK SPARROW Chondestes grammacus 

First observed in Costa Rica in the early 1990s at Carara National Park, Puntarenas, where 
the species was seen in December (CG), at a border between forest and extensive grassland. 
No further records until 2005, since when three observations have been made, all by JZ. 
The first was at Cenizas de Perez Zeledon, San Jose, on 5 March 2005, perched atop a citrus 
tree within a new, mixed-species, reforestation plot (Terminalia amazonia, Corribretaceae, 
and Tabebuia sp., Bignoniaceae). Another was at Chomes, Puntarenas (10°02'N, 84°54'W; 5 
m) on 22 November 2006. The last was a single at La Angostura de Perez Zeledon, San Jose 
(09°17'N, 83°4rW; 750 m), on 29 March 2007, perched briefly in the top of a 10-m Tabebuia 
rosea tree between a recently harvested sugarcane field and a shade-coffee plantation. 

LINCOLN'S SPARROW Melospiza lincolnii 

A very rare migrant (Stiles & Skutch 1989, Garrigues & Dean 2007) for which three recent 
observations are available, all of singles: in a garden with isolated trees and bushes in 
Manzanillo, Limon (09°37'N, 82°39'W; 5 m), on 15 October 2005 (EB); near La Virgen del 
Socorro, Heredia (10°16'N, 84°10'W; 750 m), on 21 February 2006 (CS), foraging in a pasture 
next to secondary forest with tour Yellow-faced Grassquits Tiari< oliraccus; and at Moravia 
de Chirripo, Turrialba (09°49'N, 83°26'W; 1,120 m), on 29 March 2008 (LS, GF). 



Luis Sandoval et al. 



243 



Bull. B.O.C. 2010 130(4) 



SHINY COWBIRD Mololhrus bonariensis 

First observed in Costa Rica at Hone Creek, Talamanca, Limon, on 26 April 2004 (Martinez 
& Carman 2004). We report several observations from the Caribbean slope, and also 
present evidence of breeding. On 5 October 2005, DM observed three immature males (with 
contrasting rufous-brown flight feathers) near Hone Creek. On 16 June 2007, two males and 
two females were at Tuba Creek, Talamanca (DM). On 21 January 2007, also in Talamanca, 
DM saw six males foraging with Bronzed Cowbirds M. aeneus in pasture at Carbon I, Limon 
(09°40'N, 82°49'W). During March and May 2008 several were present in the Turrialba area. 
On 9 March, EC observed at least six at the Centro Agronomico Tropical de Investigacion y 
Ensenanza (09°53'N, 83°39'W; 600 m), and on 29 March and 27 April, LS, EB & GF observed 
several males and females foraging with Bronzed Cowbirds at Moravia de Chirripo, which 
at 1,130 m is the highest elevation in Costa Rica to date. In May 2009, EB and the staff of La 
Selva Biological Station (Sarapiqui, Heredia, 10°25'N, 84°00'W; 35 m) observed a fledgling 
being fed by a pair of Band-backed Wrens Campylorhynchus zonatus, the first breeding 
record for the country. 

CRESTED OROPENDOLA Psarocolius decumanus 

The first observation in Costa Rica was in 1999, when it was found in the upper Coto Brus 
Valley (Garrigues & Dean 2007). Since then the species has apparently spread. In 2000, the 
first colony was found at San Bosco de Sabalito, Puntarenas (08°53'N, 82°55'W; 950 m), and 
later that year ten more colonies were found in the Coto Brus Valley, at Ciudad Neily and 
Coto Colorado (JZ). Subsequently, colonies have become commoner in Sabalito, Puntarenas. 
A colony with three nests was found in February 2006, between Rio Claro and Palmar Sur, 
Puntarenas (08°43'N, 83°09'W; 80 m), in an isolated tree next to the Pan-American Highway 
(LS). Further, several individuals have been observed away from the Coto Brus Valley. The 
highest record is on Cerro Pitier, La Amistad International Park (09°01 , N, 83°02'W; 1,300 
m), on 18 March 2006 (LS). The westernmost record is at Bajo Coto, Puntarenas (08°57'N, 
83°04'W; 313 m), where a male was seen in a small Erythrina (Papilionaceae) tree, on 17 
March 2006 (LS). On 15 February 2007, LS saw one flying over the rio Tigre on the Osa 
Peninsula (08°31'N, 83°24'W; 130 m). The establishment of new colonies and sightings of 
singles or small groups further west signal ongoing range expansion. 

TRICOLOURED MUNIA Lonchura malacca 

The first observation was at La Guinea, Guanacaste, in May 1999, where a population 
became established (Garrigues & Dean 2007). Significant range expansion has followed. On 
16-23 February 2005, LS observed a group of c.500 adults and young in Pitaya, Miramar, 
Puntarenas (10°00'N, 84°48'W; 5 m). At the same location, on 15 January and 16 February 
2006, LS observed a group of c.50, both adults and young, feeding in a rice field surrounded 
by sugarcane plantations. On 21 September 2006, at Chomes, Puntarenas, LS & EB observed 
two adults at the edge of mangrove. On 2 September 2008, JZ saw two adults in a rice field 
near Palmar Sur, Puntarenas (08°56'N, 83°27'W; 15 m), c.250 km from La Guinea. The species 
is associated with rice fields in Costa Rica, as it is elsewhere (Funes & Herrera 2005). Rice is 
grown extensively on the Pacific coast, presumably explaining the species' expansion. 

Discussion 

The species reported here can be subdivided into five groups according to geography 
and / or habitat: (1) coastal and pelagic species (one), (2) species that have expanded north 
from Panama (11), (3) North American vagrants (nine), (4) rediscovered species in the 
country (two), and (5) miscellaneous (four). 



Luis Sandoval et al. 



244 



Bull. B.O.C. 2010 130(4) 



Coastal and pelagic species. — Ornithological observations in oceanic waters of Costa 
Rica are infrequent, making new records, such as that presented here, to be expected. 
Interestingly, two new species reported in Costa Rica, Greater Shearwater (see above) 
and Cory's Shearwater Calonectris diomedea (Solano-Ugalde & Herrera 2005), are from the 
Caribbean coast, which coastline is much shorter than the Pacific. The high diversity of 
seabirds in the eastern Pacific (Ballance et al. 2006) could still produce new records for Costa 
Rica. There has been a recent increase in efforts to search for pelagic species in this region, 
which has produced new records for Costa Rica such as Black-vented Shearwater Puffinus 
opisthomelas (B. Sullivan pers. comm.), Christmas Shearwater P. nativitatis (Brinkley 2008) 
and Manx Shearwater P. puffinus (Garrigues & Dean 2007). 

Species from Panama. — Several recent additions to the Costa Rican avifauna are of 
species presumably spreading north from Panama, especially those that inhabit open or 
semi-open habitats, e.g. Brown-throated Parakeet, Rusty-margined Flycatcher and Crested 
Oropendola. Open habitats have increased in Costa Rica during the last 50 years, including 
on the southern Pacific slope near the Panama border (Barrantes & Lobo 2005, Joyce 2006). 

North American vagrants. — Most observations of North American vagrants involve 
single individuals, which have presumably overshot their normal winter range, or reflect 
deteriorating conditions in wintering habitats further north. 

Rediscovered species. — Both species are nocturnal and could have been overlooked 
previously. Northern Potoo is probably uncommon in dry forest and adjoining mangrove. 
Previous Costa Rican records of Ocellated Poorwill are from poorly surveyed areas (along 
the central border with Nicaragua), where more field work is needed. 

Miscellaneous. — The three species (Phaetusa simplex, Crotophaga major and Patagioenas 
leucocephala) concerned were all seen on the Caribbean slope. These accidental records may 
all represent vagrants. Tricoloured Munia was introduced as a pet in Costa Rica (LS pers. 
obs.), and apparently some were released or escaped around Filadelffa, Guanacaste, where 
the first observation was made, although it has since increased its range along the Pacific 
coast. 

Acknowledgements 

We thank Issac Araya (IA), Lance Barnett (LB), Ernesto Carman (EC), Walter Coto (WC), Matt Denton (MD), 
Steven Easley (SE), Johan Fernandez (JF), Gustavo Flores (GF), Richard Garrigues (RG), Charlie Gomez (CG), 
Jason Horn (JH), Francisco Paco Madrigal (FPM) and Brian Sullivan (BS) for sharing their observations. J. V. 
Remsen, B. Young and G. M. Kirwan kindly reviewed and commented on the manuscript. 

References: 

Acevedo-Gutierrez, A. 1994. First record of occurrence and nesting of three bird species at Isla del Coco, 

Costa Rica. Rev. Biol. Trop. 42: 762. 
American Ornithologists' Union (AOU). 1998. Check-list of North American birds. Seventh edn. American 

Ornithologists' Union, Washington DC. 
Anderson, D. L. 2000. Notes on the breeding, distribution, and taxonomy of the Ocellated Poorwill 

(Nyctiphrynus occllatus) in Honduras. Orn. Ncotrop. 1 1: 233-238. 
Ash, J. S. & Watson, G. E. 1980. Great Shearwater Puffinus gravis new to Mexico. Bull. Brit. Orn. CI LOO: 

194-195. 

Ballance, L. T., Pitman, R. L. & Fiedler, P. C. 2006. Oceanographic influences on seabirds and cetaceans of the 

eastern tropical Pacific: a review. Prog. Occtinogr. 69: 360-390. 
Barrantes, G. & Lobo, ). 2005. Protection de areas silvestres en el bosque Uuvioso del Pacifico humedo de 

Costa Rica. Pp. 241-252 in Lobo, J. & Bolahos, F. (eds.) Historia natural de Colfito. Costa Rica. Inbio, 

Heredia. 

Barrantes, G., Chaves-Campos, ). & Sanchez, J. F. 2002. I ista oticial de las ax es de Costa Rica: comentarios 

sobre su estado de conservation. Zeledonia (Bol. Bsp.) I: 1-30. 
Brinkley, E. 2008. The changing seasons: out on a limb. N. Amer. Birds 62: 362-369. 

Buckley, P. A., Massiah, E. B., Hutt, M. B., Buckley, F. G. & Hutt, H. F. 2009. The birds of Barbados: an 
annotated checklist. BOU Checklist No. 24. British Ornithologists' Union <Sc British Ornithologists' Club, 
Peterborough. 



Luis Sandoval et al. 



245 



Bull. B.O.C. 2010 130(4) 



Carr, G. L. 1979. Greater Shearwater in Costa Rica. Condor 81: 323. 

Cody, M. L. 2005. Family Mimidae (mockingbirds and thrashers). Pp 448-495 in del Hoyo, J., Elliott, A. & 
Christie, D. A. (eds.) Handbook of the birds of the world, vol. 10. Lynx Edicions. Barcelona. 

Dyrcz, A. 2002. Breeding ecology of the Social (Myiozetetes similis) and Rusty-margined (M. cayanensis) 
flycatchers at Barro Colorado Island, Republic of Panama. Orn. Neotrop. 13: 143-151. 

Funes, C. & Herrera, N. 2005. Primer registro del Capuchino de Cabeza Negra (Lonchura malacca, Estrildidae) 
en El Salvador. Boh Soc. Antioqueha Orn. 15: 37^1. 

Garrido, O. H. & Kirkconnell, A. 2000. Field guide to the birds of Cuba. Cornell Univ. Press, Ithaca, NY. 

Garrigues, R. 2004. The Gone Birding Newsletter 5. www.angelfire.com/bc/gonebirding/newsl7.html. 

Garrigues, R. & Dean, R. 2007. The birds of Costa Rica, afield guide. Christopher Helm, London. 

Harris,on, P. 1983. Seabirds: an identification guide. Houghton Mifflin, Boston. 

Hayes, F. E. & White, G. 1999. First report of the Trinidad and Tobago Rare Bird Committee. /. Trinidad & 

Tobago Field Nat. CI. 1999-2000: 39-45. 
Hilty, S. L. 2003. Birds of Venezuela. Princeton Univ. Press. 

Joyce, A. 2006. Land use change in Costa Rica as influenced by social, economic, political, and environmental factors: 

1966-2006. LIL S.A., San Jose. 
Martinez, D. & Carman, E. 2004. Primer registro de Molothrus bonariensis, Icteridae (Chamon Parasito) en 

Costa Rica. Zeledonia 8(1): 36-37. 
Martinez-Sanchez, J. C. 2007. Lista patron de las aves de Nicaragua con informacion de nuevos registros, distribucion 

y localidades donde observar aves. Alianza para las aves silvestres, Managua. 
Obando-Calderon, G., Sandoval, L., Chaves-Campos, J., Villareal-Orias, J. & Alfaro-Cervantes, W. 2007a. 

Lista oficial de aves de Costa Rica 2006. Zeledonia (Numero Esp.) 11: 1-76. 
Obando-Calderon, G., Sandoval, L., Chaves-Campos, J. & Villareal-Orias, J. 2007b. Actualizacion de la lista 

oficial de las aves de Costa Rica 2007. Zeledonia 11(2): 26-34. 
Obando-Calderon, G., L., Chaves-Campos, J., Garrigues, R., Monge, G., Montoya, M., Ramirez, O., Sandoval, 

L. & Villareal-Orias, J. 2008. Lista oficial de las aves de Costa Rica, actualizacion 2008. Zeledonia 12(2): 

27-35. 

Olson, S. 1978. Greater Ani (Crotophaga major) in Mexico. Auk 95: 766-767. 

Ridgely, R. S. & Gwynne, J. 1989. A guide to the birds of Panama. Second edn. Princeton Univ. Press. 
Roxero-Bixby, L., Maldonado-Ulloa, T. & Bonilla-Carrion, R. 2002. Bosque y poblacion en la peninsula de 

Osa, Costa Rica. Rev. Biol. Trop. 50: 585-598. 
Sanchez, J. E., Naoki, K. & Zook, J. 1998. New information about Costa Rican birds. Orn. Neotrop. 9: 99-102. 
Sandoval, L. 2004. Amplitud de ambito en la distribucion de dos especies de Soterreis (Troglodytidae: Aves), 

en Costa Rica. Brenesia 62: 99-100. 
Sandoval, L. & Ellis, J. 2006. Primer registro de Sturnella militaris (Icteridae: Aves) en el Valle Central de Costa 

Rica. Brenesia 65: 81. 
Skutch, A. 1976. Parent birds and their young. Univ. of Texas Press, Austin. 

Solano-Ugalde, A. & Herrera, P. 2005. Segundo registro de la Pardela Cenicienta Calonectris diomedea 
(Procellariidae: Aves) en las costas caribenas de Centroamerica. Zeledonia 9(1): 57-59. 

Stiles, F. G. & Skutch, A. 1989. A guide to the birds of Costa Rica. Cornell Univ. Press, Ithaca, NY. 

Thiollay, J. M. 1994. Family Accipitridae (hawks and eagles). Pp. 52-205 in del Hoyo, J., Elliott, A. & Sargatal, 
J. (eds.) Handbook of the birds of the world, vol. 2. Lynx Edicions. Barcelona 

Trama, F., Solfs-R., M. & Gonzalez-Jimenez, E. 2006. Vanellus chilensis (Aves: Charadriidae): una nueva 
especie registrada para el humedal Ramsar Palo Verde, Costa Rica. Brenesia 61: 127-128. 

Addresses: Luis Sandoval & Esteban Biamonte, Escuela de Biologfa, Universidad de Costa Rica, San Pedro, 
Montes de Oca, Costa Rica, e-mail: biosandoval@hotmail.com. Cesar Sanchez, Department of Biological 
Sciences & Museum of Natural Science, Louisiana State University, Baton Rouge, LA 70803, USA. Jim R. 
Zook, Apartado 182-4200, Naranjo de Alajuela, Costa Rica. Julio E. Sanchez, Asociacion de Ornitologos 
Unidos de Costa Rica, Apartado 11695-1000, San Jose, Costa Rica. Daniel Martinez, Kekoldi Wak ka 
koneke, Talamanca, Limon, Costa Rica. Daryl Loth, Tortuguero, Limon, Costa Rica. Jerry O'Donahoe, 
P.O. Box 172, Post Mills, VT 05058, USA. 



© British Ornithologists' Club 2010 



Colin Rvall 



246 



Bull. B.O.C. 2010 130(4) 



Further records and updates of range extension in 
House Crow Corvus splendens 

by Colin Ryall 

Received 7 December 2009 

Summary. — Over the last century, House Crows Corvus splendens have spread, 
primarily ship-assisted, to establish populations in 21 countries outside their 
native range, the Indian subcontinent. This spread is adversely impacting both 
humans and avifauna in the areas colonised. This paper is the fourth update on 
this global invasion. Though long established at many ports around the Indian 
Ocean, and making regular appearances in ones and twos on ships arriving in 
Australia, the species is now increasingly turning up in the Atlantic region, both 
on the east coast of the USA, in the Caribbean, and on European coasts; a breeding 
population has been established in Hoek van Holland since 1994. Thev are also 
extending their range in South-East Asia. Some extralimital colonies are spreading 
along neighbouring coastlines and overland into the interior, though their progress 
appears to be obstructed by arid depopulated zones such as the interior of Arabia 
and the Horn of Africa. 

Though native to India, Pakistan, the Maldives and Sri Lanka, and Mvanmar and 
western Yunnan, House Crow Corvus splendens has proved to be an invasive alien species, 
and is spreading progressively around the world. The hrst step was the deliberate release 
of House Crows in the late 1800s to Aden, Klang and Zanzibar, though subsequent spread 
has been ship-assisted. Their invasion west and south, to the Arabian Peninsula, Red Sea, 
East and southern Africa, Mauritius and the Seychelles, has been on ships originating from 
major ports in the Indian subcontinent, such as Mumbai and Colombo, but also from Aden, 
Suez and Zanzibar, which now possess large populations. They have also spread east 
throughout Malaysia and Singapore since its introduction in Klang. 

Extralimital colonies usually become established from just 2-3 founder individuals 
which have arrived at a port, and over the course of 2-3 decades they achieve pest status 
as the population grows. Their adverse impacts include predation / harassment of native 
avifauna and livestock, food / crop theft, noise nuisance, fouling of human settlements and 
water tanks, and they are potential carriers of human and other animal diseases. 

This paper is the fourth in a series that has reported the progressive global spread of the 
House Crow and provided further information on their status at sites where the species has 
become established (Ryall 1994, 1995, 2002). The present update draws on published records, 
information provided in correspondence, including in response to requests for information 
in journals, data sent to the House Crow Monitor website (www.housecrow.com), and a 
questionnaire by authorities in countries with introduced House Crow populations, issued 
by CR and Guntram Meier in 2007-08. Contributors' initials are given in the text and their 
names are presented under Contributors. 

Europe 

Netherlands. — The breeding population established in Hoek van Holland from a 
founding pair in 1994 has grown, reaching at least 1 1 in 2003 (Ryall 2003) and 28 by 
January 2008 (GO). Ottens & Ryall (2003) published a detailed review of occurrence in the 



Colin Rvall 



247 



Bull. B.O.C. 2010 130(4) 



Netherlands up to 2002, including several reports of individuals many kilometres from the 
founder colony. Though some of these are attributable to birds from the Hoek van Holland, 
more distant records, e.g. from Kollummerland, Schiermonnikoog and Den Hoorn, 
probably represent additional ship-assisted arrivals. In 2004, a single House Crow was seen 
in central Rotterdam, another flew past at Bergambacht, c.20 km east of Rotterdam, and a 
third was at Noordwijkerhout, on the coast west of Leiden (www.birding.holland.com), 
perhaps suggesting spread from the founder population. In 2004 a satellite population was 
reported in Park Ockenburg, Den Haag, 17 km north of Hoek van Holland (Langley 2004), 
though the lack of recent reports (GO) suggests that this colony did not succeed. 

Belgium. — On 21 May 2004, two House Crows were observed at the village of 
Wachtebeke, East Flanders (GO). Their closeness to several international ports, including 
Terneuzen (20 km distant), Vlissingen (38 km) and Oostende (60 km) suggests they arrived 
by ship, as the colony at Hoek van Holland is 100 km distant. 

Poland. — A bird identified as a House Crow was photographed by MF on 29 April 2002 
trying to take Black-headed Gull Lams ridibundus eggs at a fish pond at Palczowice, near 
Oswi^cim, c.40 km west of Krakow. WS states that the record has been listed in Poland 
under Schedule E — 'species from captivity, as well as unintentionally introduced, which 
have not established self-supporting populations (unnatural occurrence)'. The bird was not 
recorded again and was assumed to be an escapee, though firm evidence was lacking (WS). 
Certainly, the fact that the location is c.500 km from the nearest coastline at Gdansk makes 
it extremely unlikely that this bird arrived by ship. 

Hungary. — A single was reported by FF in a car park in Budapest on 4 May 2002. It was 
suggested by FF that this and the Polish bird were the same bird. However, as pointed out 
by Ottens & Ryall (2003), this would have necessitated the bird flying a mean 50 km for six 
consecutive days, in a straight line, over mountainous terrain. Such behaviour seems quite 
out of character for a House Crow. An alternative explanation is that it was a misidentified 
hybrid Carrion Crow C. c. corone x Hooded Crow C. c. comix. 

Spain. — PH saw a single House Crow perched on a roof calling, at the seaside village 
of Parada, Cabo Fisterra, on 6 March 2004, which is close to a major shipping route to 
European ports. This constitutes the second report for the country. 

Middle East 

Israel. — In addition to the long-established population in Eilat, now numbering c.600, 
up to ten were seen regularly at Yotvata, 40 km to the north (OH), but according to the 
Yotvata Farm Office thev are no longer present. Each winter, a further 200 were reported 
to move to Eilat from neighbouring Aqaba in Jordan and from Taba, across the border in 
Egypt (OH). OH suggested they might have been attracted by a greater availability of food 
there, in the form of crops, livestock barns and human refuse, but the movement no longer 
appears to be occurring. House Crows are frequently seen in Arava, north of Eilat (Roll 
et al. 2008), probably encouraged by refuse tipping in the surrounding desert. They are 
considered a pest in Israel, particularly due to the species' tendency to attack people eating 
in the open or passing close to nest sites, and control measures are being taken. 

Socotra (Yemen). — A small population, peaking at 28 birds, established on Socotra 
in 1996 (Ryall 2002). Control measures took the form of trapping and a bounty system 
under which local children brought nests with young to the Socotra Conservation and 
Development Programme (Pitches 2009), which helped reduce the population to 13 centred 
on Hadibu. These were all shot by a marksman in May 2009 (OA-S). This is the second 
successful eradication of a breeding population, the first being in Seychelles in 1994 (Ryall 



Colin Ryall 



248 



Bull. B.O.C. 2010 130(4) 



2002). Constant surveillance will be required to prevent them recolonising this biodiversity- 
rich island, given the regular shipping traffic from House Crow-infested Aden. 

Kuwait. — A nesting pair was reported by Gregory (2004) on Kubbar Island, Kuwait's 
most important seabird colony. In view of the House Crow's status as a serious nest raider, 
control measures were planned. Gregory also mentioned reported breeding in the port of 
Shuwaikh, on the south side of Kuwait Bay. Despite the continued proliferation of House 
Crows in coastal towns and settlements throughout much of the Arabian Peninsula, the 
population in Kuwait remains small with, as of mid 2008, the highest recorded number 
being 18 (MP). 

Afghanistan. — House Crow has been referred to as a vagrant to Afghanistan, e.g. Sayer 
& van der Zon (1981) reported one at Khowst, in eastern Afghanistan, in 1964, but evidence 
of residency was lacking. However, in 2002, the species was reported as uncommon at 
Torkham, Jalalabad, east of Kabul (Kullberg 2002). 

Africa 

Morocco. — A single adult seen in Tangier harbour on 25 December 2002, the first for 
Morocco, has been accepted by the Moroccan Rare Birds Committee (Bergier et al. 2005). 

Egypt. — Established in Suez since the 1920s and thence along the Red Sea coast at 
least as far south as Quseir (Ryall 1994). The population in Suez is now large and Demey 
(2008) reported 3,811 leaving a single roost in July 2007. They were first reported in Sinai 
by Goodman & Meininger (1989), but are now established in several coastal towns there, 
including El Tur in the west (Robel 1996), Sharm El Sheikh in the south and Dahab on the 
Gulf of Aqaba (SBD). According to OH they are also present in Taba, further north on the 
latter coast near the border with Israel. Balmer & Murdoch (2009) reported a single House 
Crow just south of Sehel Island, Aswan, on 25 March 2009, which was wholly unexpected 
given that the main population around Suez is c.700 km to the north and the nearest 
populations, on the Red Sea coast, are c.200 km across desert. 

Eritrea. — Present in Massawa since 1968 (Ash & Atkins 2009), but the species was not 
present there or elsewhere on the coast or the Dahlak Archipelago in 1962 (CM) and it was 
well established there and in Assab by the 1980s (Ryall 1994). YY has recently provided 
population estimates from these localities of 2,500-3,000 and 6,000-7,000, respectively. He 
also reported the birds as now present in small numbers in Tio and other small ports and on 
some offshore islands. House Crow roosts now number hundreds and thev most probably 
breed on the island of Sheikh Said, 1.3 km off Massawa (EA). 

Djibouti. — House Crows were first reported in Djibouti City in 1958 (Ryall 1994) 
and were very common by 1978, to the extent that several control campaigns have been 
attempted since. Ryall (2002) reported colonisation of coastal tow ns to the north and south. 
HR reports further spread to all coastal villages south to the border with Somalia, as well 
as the villages around Djibouti City, up to 26 km inland. Since at least 1998, the birds have 
reached Musha and Maskali islands, c.14 km off Djibouti port. These are important nesting 
sites for 15 bird species and a potential Ramsar site, and HR has observed heavy predation 
of chicks by House Crows during the breeding season (June-August) as well as of turtle 
hatchlings. 

Somalia. — The Eritrea, Djibouti and Somali populations are now inter-linked and 
represent a serious pest problem (Redman ct al. 2009). From the burgeoning population 
in the port of Berbera (Ryall 2002), they have spread to the city of Hargeysa (AJ), >100 km 
inland and, according to JM, have been present in the port of Bosasso since the late 1990s, 
which population is thought to have originated from Djibouti. AJ reports that they have 
now colonised almost all Somali coastal towns from Berbera west to the Djibouti border. 



Colin Ryall 



249 



Bull. B.O.C. 2010 130(4) 



Of greater conservation concern is the occurrence of House Crows on the Saada Din 
archipelago off the north coast, close to the border with Djibouti, where the species is now 
frequent on the island of Jasiira Ceebaad (AJ). These islands are an important breeding area 
for terns, gulls and shorebirds, which could be seriously impacted by House Crows. 

Kenya. — The species remains restricted to the coastal strip in Kenya, with a range similar 
to that described in the late 1980s (Ryall 1992b), from Msambweni in the south to Mambrui, 
40 km north of Malindi, though the populations in those settlements within this range have 
grown substantially. However, House Crows have recently been reported on the island of 
Lamu in the extreme north (CJ), presumably having arrived by boat. Very large populations 
exist at the main human population centres around Mombasa and Malindi-Watamu. Inland, 
they remain restricted to c.50 km from Mombasa along the Nairobi Road. The increase is 
despite control programmes that operated from 1994 to 2005/6 (CJ) in Malindi-Watamu 
and Mombasa, which achieved major reductions in numbers at both locations, but the 
impetus eventually faltered due to a lack of access to the avicide, Starlicide. 

Tanzania. — House Crows were first released on Zanzibar in the 1890s and by the 
1970s had established in Dar es Salaam and Tanga on the mainland (Ryall 1994), where 
large populations are now driving the spread overland to other parts of the country. From 
Tanga, on the north coast, they have spread to Muheza, along the road to Segera (PN) and 
are in danger of reaching there and Korogwe, and thence to villages such as Kinole and 
Tegetero in the biodiversity rich Uluguru Mountains (CW). The first House Crow has been 
reported recently in Mtwara, c.300 km south of Dar es Salaam and close to the border with 
Mozambique (NB). 

A large population now exists in Morogoro, having spread inland from the enormous 
population in Dar es Salaam (NB), from whence they have reached Mikumi (CW). Efforts 
continue to reduce the population in Dar es Salaam, where it is regarded as a serious 
pest and threat to native avifauna (NB). In April 2007, K. Berendse (in Wolstencroft 2007) 
reported seeing four at Dodoma airport, but these appear to have perished along with 
large numbers of Pied Crows Corvus albus during the periodic crow eradication exercise the 
authorities undertake there. 

House Crow has a varied history on Pemba Island. On the basis of an unpublished 
communication from J. G. Williams in 1962, Long (1981) reported House Crows as present 
on Pemba, but Pakenham (1979) and subsequent visitors did not record them there. 
However, in mid 2007, AH reported C. splendens as common at Wete port, in the north of 
the island, roosting in the mangroves. Apparently they had been there for at least three 
years and have increased and spread inland to other settlements, where they are reported to 
take chicks of domestic fowl. AH (in Wolstencroft 2007) also reported a small but growing 
population at Chake-Chake, in the centre of Pemba, which might have come from Wesha 
port. J. Bishop (in Wolstencroft 2007) found them common at Unguja. These birds probably 
arrived by ship from either Zanzibar, c.50 km distant, or Tanga, c.60 km away, and present 
a serious threat to the island's endemics, e.g. Pemba Green Pigeon Treron pembaensis, Pemba 
Sunbird Cinnyris pembae and Pemba White-eye Zosterops vaughani. Fortunately, measures 
are being taken to eradicate the population. House Crows are also long established and 
numerous on the small island of Chumbe, off western Zanzibar (FL). 

Mozambique. — House Crows have spread further since my previous reports (Ryall 1994, 
2002) and were seen in Beira and Nacala in 2006 (CB). 

Indian Ocean Islands 

Seychelles. — Since the eradication of the breeding population in 1994 (Ryall 2002), a 
number of single individuals have been reported, most probably new ship-assisted arrivals 



Colin Ryall 



250 



Bull. B.O.C. 2010 130(4) 



(Skerrett et ah 2001). As of February 2008, the last House Crow on Mane had been shot by 
a police marksman (NS). 

Chagos Islands (British Indian Ocean Territory). — A single was seen some vears ago and 
by late November 2008 two were present (GM). In view of the large amount of US military 
ship traffic from Bahrain, Aden and Singapore to Diego Garcia, the main island, there is a 
high risk of further occurrences of ship-assisted House Crows in the archipelago. 

Mauritius. — The long-established population continues to be centred in Port Louis, and 
Feare & Mungroo (1990) described the species' spread to surrounding settlements. They 
are also seen occasionally over forest in the south-west of the island (R. J. Safford in Lever 
2005). 

Reunion. — According to Cheke & Hume (2008), two House Crows were seen together in 
2004 in the north of the island at the capital and main port, St-Denis, and were assumed to 
have 'hitched' a ride on a ship from Mauritius. Both were eventually shot by officers from 
the Forestry Department (Cheke 2008; ML) and no further House Crows have been seen on 
the island subsequently (AC). 

Rodrigues. — Two were seen at Port Mathurin in mid 1995 (MMr) and it was reported 
that the local authorities, being aware of their pest status on Mauritius, intended to shoot 
them. 

Andaman Islands. — The species' history on this archipelago is particularly interesting. 
As described in Ryall (1994) a deliberate introduction attempted in the 1860s, to clear refuse, 
failed. However, small numbers were reported in the main port, Port Blair, in 1988 (Pittie 
1988). As of 2007, the population has expanded substantially and House Crows gather in 
large numbers at fish landing centres near the town. MC reports that House Crows are 
present in most urban centres in the Andamans now and they have also spread to larger 
settlements further north in the archipelago, at Rangat and Maya Bandarup to Diglipur 
on North Andaman. They are also present further south, at Hud Bav on Little Andaman 
(MC). 

East Asia and Australia 

Malaysia. — Wells (2007) provided a detailed account of the origins, status and overland 
spread of the House Crow from its introduction in Klang in the late 1800s to other parts of 
the peninsula. They colonised George Town, Pinang Island, and bv 1953 had established in 
Butterworth on the opposite mainland. They had spread to Kulim bv 1983, to the Merbok 
estuary by 1991, with small groups in Alor Setar bv the late 1990s and on Langkawi Island by 
1995. Their spread had reached Kuala Lumpur by the 1960s and the Negeri Sembilan coast 
and Melaka in 1972, where it is now abundant, and to Tanjung Karang and Kajang town bv 
1983. They reached Johor Baru from Singapore in the early 1960s and thence along the coast 
to Kota Tinggi by 1998. In the north they have also recently spread into Thailand. 

There are also a few reports from Malaysian Borneo. In Sabah, a single House Crow- 
was observed by an expedition of the Western Foundation of Vertebrate Zoology at an 
abattoir in Papar on the west coast in 1983 (Sheldon et al. 2001). In addition, SH reported 
seeing a single on three occasions in July 1997 and two on 7 August 1999 in the capital, Kota 
Kinabalu. Whether these birds originated from self-introduction, deliberate introduction 
or escape from captivity is unknown, though the first is most probable, given that the 
widespread population in Peninsular Malaysia would facilitate ship-assisted introduction. 
According to Mann (2008), these birds were erroneously reported as Slender-billed Crow C. 
erica in Smythies (1999). A local birdwatcher, AS, reports there having been several around 
Kota Kinabalu for 'several years'. A detailed survey of the city bv CR in June 2006 revealed 



Colin Ryall 



251 



Bull. B.O.C. 2010 130(4) 



only four birds — a breeding pair, a subadult and a juvenile being fed, all of which roosted 
in an avenue of trees close to the fish market. 

Thailand. — Peters (1962) suggested that the race C. s. insolens in south-west Thailand 
might have been introduced, presumably from neighbouring Myanmar, but Lekagul & 
Cronin (1974) described it as a rare resident. Whether native or not, the House Crows which 
have recently colonised Phuket (see below) appear to be C. s. protegatns (CR) of Sri Lanka 
and south-west India, but also introduced into Malaysia and Singapore, rather than the 
darker C. s. insolens of neighbouring Myanmar. This suggests that the Phuket birds originate 
from the northward spread in Malaysia (Wells 2007) or, possibly, from ship-assisted 
introduction via Colombo. A House Crow was seen in Krabi on 5 June 2001 (BCST 2001), at 
least three at the Phuket recycling centre on 26 April 2003 (BCST 2003) and three in Muang 
District, Phuket on 5 October 2004, where a small population is now established around the 
municipal rubbish tip (BCST 2004). In October 2007, covering the waste had reduced the 
numbers at the recycling centre to one (phuketbirder.blogspot.com/2007_10_01_archive. 
html). In 2006, the resident population of House Crows in Phuket, seen usually around the 
city dump, numbered c.15 (BCST 2006). Two others were at Darn Sadao, Hat Yai (Songkhla), 
on the east coast, on 5 November 2004 (BCST 2005). 

Singapore. — Peh & Sodhi (2002) observed that, prior to the 1980s, House Crows had been 
mainly coastal in distribution, in docklands, rivers and canals, coastal parks and on offshore 
islands, but in recent years had become common in urban areas. Wee (1999) attributed the 
recent increase to the development of new housing estates. Wells (2007) reported a record 
from the island of Senang in Singapore. However, numbers have now reached at least 
20,000 occupying 25 roosts in tall trees, such that they have achieved pest proportions (SKL) 
and the authorities are undertaking a control programme. Numbers are swollen by birds 
arriving from neighbouring Malaysia (Wells 2007, which see for more detail). Brook et al. 
(2003) estimated the population at 130,000 birds. 

Hong Kong. — Twelve House Crows were recorded in ones and twos between the 
mid 1970s and 1998 (Leven & Corlett 2004). Viney et al. (1996) noted their presence in the 
territory but regarded them as escaped captives. The population had clearly grown as flocks 
of 10-20 were seen regularly in the area (Fung 2000). Nevertheless, Carey et al. (2001) did 
not consider the species to be established in Hong Kong. M. Kilburn (pers. comm.) reported 
observing them regularly around the port area since late 1998. By 2004, a population of c.100 
was present in urban Kowloon, centred on the container port and associated cargo-handling 
facilities (Leven & Corlett 2004), with roosts in large trees in various small city parks. The 
latter authors expressed concern about the threat that this rapidly growing population 
could eventually pose to other wildlife, such as the nearby egretry, particularly as the birds 
were probably already too numerous to easily eradicate. The population was estimated 
at 200-250 in 2003 (Lee & Choi 2005). According to Lee & Chow (2007), the population 
numbered 210 centred mainly on Stonecutters Island, Sham Shui Po Park, Tai Hang Tung, 
Yau Yat Tsuen, Kowloon Tsai Park, Tung Chau Street Park, and Lai On and Lai Kok Estates. 
They pointed out that the control programme implemented since 2004 had dispatched 830 
crows, thereby stemming the hitherto rapid population growth. 

Taiwan. — VY reported that several single House Crows were seen on the island of 
Kinmen, west of Taiwan, near the Chinese mainland, since the first record in 1980 (Ryall 
2002), but that the last record was of a single in southern Taiwan. 

Australia. — In Western Australia, two House Crows were seen on Rottnest Island, off 
Perth, in 2006 (MM). The following year another two were seen on the Angel Platform, an 
offshore gas rig, and another travelled by boat the 140 km from the rig to Cape Lambert, 
near Port Samson in northern Western Australia (Pownall 2009), and another was present 



Colin Ryall 



252 



Bull. B.O.C. 2010 130(4) 



at nearby Karratha in 2010 (MM). The birds were thought to have ridden on the rig when it 
was towed from Malaysia (MM). The former birds were shot in mid-December 2008 (LW) 
but, to date, the Karratha bird has evaded destruction (MM). In eastern Australia, a single 
House Crow was seen over several months from March 2008 at Dee Why in north-east 
Sydney (LW), but the local authority intended to shoot it. 

The Americas 

USA. — A pair was discovered at Nokomis, near Sarasota, Florida in late 2001. They bred 
in 2003 when a nest with three young was photographed (Pranty 2004), one of the birds 
later being electrocuted when it hit a power line. No House Crows were located during a 
visit to the site in early 2009 (BP), suggesting that the remaining birds had relocated or died 
out. In May 2008, a single House Crow was seen over eight days in coastal woodland near 
Johnson's Bayou at Hackberry Ridge, Louisiana (Anon. 2008) and it was suggested that due 
to its tameness and signs of feather wear the bird had been caged in the recent past. The 
coastal location suggests a ship-assisted arrival. The bird disappeared thereafter. 

Cuba. — A single House Crow was seen by AP on 26 March 2008 at Cayo Guillermo 
on the north coast (Kirwan et ah 2008). The bird remained all day around an open-air cafe 
feeding on scraps, but was not seen again subsequently (AP). As this is close to a major 
shipping route the bird was probably ship-assisted. 

Discussion 

House Crows have now colonised ports and coastal towns in 21 countries outside 
their native range and, in addition, have arrived ship-assisted in a further 16 countries, but 
without having established breeding populations. The spread continues unabated and is, 
in fact, accelerating, occurrences extending increasingly far from the species' native range, 
in part due to the large introduced populations in Aden and Suez, which act as secondary 
foci for spread, along with an increase in the amount and speed of modern international 
shipping. Indeed, an observed increase in the rate of invasions of a range of other species 
has been attributed to the expansion of global trade (Jenkins 1996, Ruiz & Carlton 2003), 
much of it maritime. 

Despite House Crows having been self-introducing around the Indian Ocean and 
Australia for around 100 years, it was only in 1971 that the first was reported in the 
Americas, in New Jersey (Ryall 1995), but since then there have been 4-5 reports in the USA 
and others in Chile, Barbados (Ryall 2002) and Cuba (this paper). 

The spread of populations around the Indian Ocean rim has, with only a few 
exceptions, been restricted to coastal areas where human populations are concentrated. In 
fact, in the Middle East, the Horn of Africa and Kenya, the species' overland spread has 
been limited by arid and unpopulated hinterlands. However, Tanzania lacks such a barrier, 
which suggests that their spread west overland, now c.250 km from their point of arrival 
in the country, will continue and provide a conduit for the species to spread to Rwanda, 
Uganda and beyond. The sterling efforts being made to eradicate House Crows from Dal- 
es Salaam and ultimately elsewhere in Tanzania (NB) could yet prevent the species from 
invading the interior of Africa. In South Africa, too, effective control measures have halted 
the expansion of populations in Durban and Cape Town, thereby reducing the risk of 
House Crows reaching ports on the west coast of Africa, as well as stemming their spread 
to the interior of the country. 

In South-East Asia, the House Crow's colonisation of the Thai-Malay Peninsula and 
surrounding islands, described in detail by Wells (2007), will doubtless be followed by 



Colin Ryall 



253 



Bull. B.O.C. 2010 130(4) 



invasion of Laos and Vietnam. In addition, they are well established in Hong Kong and 
increasing in Borneo. Even in Europe the inaction of the authorities in the Netherlands 
to eliminate the colony in Hoek van Holland — an easy task when two arrived in 1994 — is 
permitting the House Crow population to increase rapidly and there are already signs of 
the birds spreading. 

The poverty, overcrowding and accumulation of human refuse that accompany rapid 
human population growth around cities in the developing world greatly facilitate the 
proliferation of House Crows. The predictable adverse effects, including a decline in native 
avifauna, killing of young livestock and poultry, crop raiding and food theft, and potential 
spread of human disease (Ryall 1992a,b), will exacerbate the plight of communities who 
already have very little. Nevertheless, it is possible to reverse the trend. Two introduced 
populations of House Crows, albeit small ones on islands, have been eradicated, on 
Seychelles and Socotra, and control programmes in South Africa have met with great 
success. Others would also have succeeded had they received greater support from 
international agencies. 

Contributors 

Thanks are due to the following observers who supplied records and information concerning House Crows: 
AC = Anthony Cheke, AJ = Abdi Jama, AH = Alawi Hija, AP = Alan Pearson, AS = Andrew Siani, BP = Bill 
Pranty, CB = Carlos Bento, CJ = Colin Jackson, CM = Clive Mann, CR = Colin Ryall, CW = Colin Watkins, E A 
= Ermias Azeria, FF = Felix Felger, FL = Frida Lanshammar, GB = Gary Broussard, GM = Guntram Meier, GO 
= Gert Ottens, HR = Houssein Rayaleh, JM = John Miskell, LW = Leana Wrobel, MC = Manesh Chandi, MF 
= Marcin Faber, ML = Matthieu Lecorre, MM = Marion Massam, MMr = Mike Maunder, MP = Mike Pope, 
NB = Neil Baker, NS = Nirmal Shah, OA-S = Omar A. Al-Saghier, OH = Ohad Hatzofe, PH = Petri Hottola, 
PN = Paul Nnyiti, SH = Simon Harrap, SBD = Sherif Baha El Din, SKL = Sim Kim Lian, VY = Victor Yu, WS 
= Wojciech Solarz, and YY = Yacob Yohannes. 

References: 

Anon. 2008. Arkansas & Louisiana. N. Amer. Birds 62: 427. 

Ash, J. & Atkins, J. 2009. Birds of Ethiopia and Eritrea. Christopher Helm, London. 

Balmer, D. & Murdoch, D. (compilers) 2009. Around the region. Sandgrouse 31: 208-222. 

BCST. 2001. Recent reports: May-July 2001. Bird Conserv. Soc. Thailand Bull. 18(8): 12-14. 

BCST. 2003. Recent reports: March-May 2003. Bird Conserv. Soc. Thailand Bull. 20(6): 17-20. 

BCST. 2004. Recent reports: September-October 2004. Bird Conserv. Soc. Thailand Bull. 21(11): 17-20. 

BCST. 2005. Recent reports: September to December 2004. Bird Conserv. Soc. Thailand Bull. 22(1): 15-18. 

BCST. 2006. Recent reports: November-December 2005. Bird Conserv. Soc. Thailand Bull. 23(1): 14-18. 

Bergier, P., Franchimont, J., Thevenot, M. & the Moroccan Rare Birds Committee. 2005. Rare birds in 

Morocco: report of the Moroccan Rare Birds Committee (2001-2003). Bull. Afr. Bird CI. 12: 106-118. 
Brook, B. W., Sodhi, N. S., Soh, M. C. K. & Lim, H. C. 2003. Abundance and projected control of invasive 

house crows in Singapore. /. Wildlife Manage. 67: 808-817. 
Carey, G. J., Chalmers, M. L., Diskin, D. A., Kennerley, P. R., Leader, P. J., Leven, M. R., Lewthwaite, R. W., 

Melville, D. S., Turnbull, M. & Young, L. 2001. The avifauna of Hong Kong. Hong Kong Bird Watching 

Society, Hong Kong. 

Cheke, A. 2008. Seafaring behaviour in House Crows Corvus splendens — a precursor to ship-assisted 

dispersal? Phelsuma 16: 65-68. 
Cheke, A. & Hume, J. 2008. Eost land of the Dodo. T. & A. D. Poyser, London. 
Davison, G. W. H. 1979. Kuala Lumpur and her crows. Malayan Natur. (January): 23-25. 
Demey, R. 2008. Recent reports. Bull Afr. Bird CI. 15: 263-277. 

Feare, C. J. & Mungroo, Y. 1990. The status and management of the House Crow Corvus splendens (Vieillot) 

in Mauritius. Biol. Conserv. 51: 63-70. 
Goodman, S. M. & Meininger, P. L. (eds.) 1989. The birds of Egypt. Oxford Univ. Press. 
Gregory, G. 2004. Breeding birds in Kuwait. Phoenix 20: 21-23. 

Jenkins, P. T. 1996. Free trade and exotic species introduction. Conserv. Biol. 10: 300-302. 

Kirwan, G. M., Calderon, D., Minns, J. & Roesler, I. 2008. Neotropical notebook: Cuba. Cotinga 30: 92. 

Kullberg, A. 2002. Afghanistan 2002. www.camacdonald.com/birding/meafghanistan(AnssiTripReport). 

htm (accessed 28 June 2008). 
Langley, G. 2004. Second nature. Birdwatch 148: 31-34. 



Colin Rvall 



254 



Bull. B.O.C. 2010 130(4) 



Lee, W. H. & Choi, I. C. 2005. House Crow Corvus splendens — notes on their population and control in Hong 

Kong. Hong Kong Biodiver. 8: 10-11. 
Lee, W. H. & Chow, G. K. L. 2007. An update on the population control of House Crow Corvus splendens in 

Hong Kong. Hong Kong Biodiver. 15: 11-15. 
Lekagul, B. & Cronin, E. W. 1974. Bird guide ofTiiailand. Kurusapa Ladprao Press, Bangkok. 
Leven, M. R. & Corlett, R. T. 2004. Invasive birds in Hong Kong. Orn. Sci. 3: 43-55. 
Lever, C. 2005. Naturalised birds of the world. T. & A. D. Poyser, London. 
Long, J. L. 1981. Introduced birds of the world. David & Charles, London. 

Madge, S. & Burn, H. 1999. Crows and jays: a guide to crows, jays and magpies of the world. Christopher Helm, 
London. 

Mann, C. F. 2008. The birds of Borneo. BOU Checklist No. 23. British Ornithologists' Union & British 

Ornithologists' Club, Peterborough. 
Ottens, G. & Ryall, C. 2003. House Crows in the Netherlands and Europe. Dutch Birding 25: 312-319. 
Pakenham, R. H. W. 1979. The birds of Zanzibar & Pemba: an annotated checklist. BOU Checklist No. 2. British 

Ornithologists' Union, London. 
Peh, K. S. H. & Sodhi, N. S. 2002. Characteristics of nocturnal roosts of House Crows in Singapore. /. Wildl. 

Manage. 66: 1128-1133. 

Peters, J. L. 1962. Check-list of birds of the world, vol. 15. Mus. Comp. Zool., Cambridge, MA. 

Pitches, A. 2009. News & Comment: Children eradicate the House Crow from Socotra. Brit. Birds 102: 477. 

Pittie, A. 1988. The occurrence of the house crow (Corvus splendens) in Port Blair, South Andaman Island. / 

Bombay Nat. Hist. Soc. 85: 430. 
Pownall, A. 2009. Invasion of crows sparks alert. The West Australian 3 February 2009 (www.thewest.com. 

au). 

Pranty, B. 2004. Florida's exotic avifauna: a preliminary checklist. Birding 36(4): 362-372. 

Redman, N., Stevenson, T. & Fanshawe, J. 2009. Birds, of the Horn of Africa: Ethiopia, Eritrea, Djibouti, Somalia 

and Socotra. Christopher Helm, London. 
Robel, D. 1996. Some ornithological winter observations from southern Sinai. Zool. Middle East 12: 25-28. 
Roll, U., Dayan, T. & Simberloff, D. 2008. Non-indigenous terrestrial vertebrates in Israel and adjacent areas. 

Biol. Invasions 10: 659-672. 

Ruiz, G. M. & Carlton, J. T. 2003. Invasion vectors: a conceptual framework for management. Pp. 459-504 
in Ruiz, G. M. & Carlton, J. T. 2003. Invasive species: vectors and management strategies. Island Press, 
Washington DC. 

Ryall, C. 1992a. Predation and harassment of native bird species by the Indian House Crow Corvus splendens 

in Mombasa, Kenya. Scopus 16: 1-8. 
Ryall, C. 1992b. The pest status of the Indian House Crow Corvus splendms in Mombasa and a survey of its 

expansion of range in coastal Kenya. Pp. 303-310 in Bennun, L. (ed.) Proc. VII Pan-Afr. Orn. Congr. Nairobi, 

Aug-Sept 1988. PAOC, Nairobi. 
Ryall, C. 1994. Recent extensions of range in the House Crow Corvus splendens. Bull. Brit. Orn. CI. 114: 

90-100. 

Rvall, C. 1995. Additional records of range extension in the House Crow Corvus splendens. Bull. Brit. Orn. CI. 
115: 185-187. 

Ryall, C. 2002. Further records of range extension in the House Crow Corvus splendens. Bull. Brit. Orn. CI. 
122: 231-240. 

Ryall, C. 2003. Notes on ecology and behaviour of House Crows at Hoek van Holland. Dutch Birding 25: 
167-172 

Sayer, J. A. & van der Zon, A. P. M. 1981. Checklist of the birds of Afghanistan. Unpubl. appendix to F AO 

Conservation Strategy report FO: DP/AFG/78/007. 
Sheldon, F. H., Moyle, R. G. & Kennard, J. 2001. Ornithological history, gazetteer and annotated checklist of 

Sabah, North Borneo. Orn. Monogr. 52: 1-285. 
Skerrett, A. P., Bullock, I. & Disley, T.^OOl. Birds of the Seychelles. Christopher Helm, London. 
Smythies, B. E. 1999. Birds of Borneo. Fourth edn. Natural Historv Publications, Kota Kinabalu. 
Viney, C, Phillipps, K. & Lam, C.Y. 1996. Birds of Hong Kong and south China. Govt. Publishing, Hong Kong. 
Wee, L. 1999. Their wings are being clipped. Strait Times 6 June 1999: 2. 
Wells, D. R. 2007. the birds of the Thai-Malay Peninsula, vol. 2. Christopher Helm, London. 
Wolstencroft, J. 2007. Birdman (blog). www.birds.intanzania.com/ fighting-the-house-crows (accessed 6 lulv 

2009). 

Address: Faculty of Science, Kingston University, Penrhvn Road, Kingston upon Thames, Surrey KT1 2EE, 
UK. 

© British Ornithologists' Club 2010 



Kevin J. Zimmer et al. 



255 



Bull. B.O.C. 2010 130(4) 



Documented records of White-cheeked Tody-Tyrant 
Poecilotriccus albifacies from Acre, Brazil 

by Kevin }. Zimmer, Andrew Whittaker, Edson Guilherme & 
Paulo Martuscelli 

Received 21 January 2010 

Summary. — We summarise the history and currently understood distribution of 
White-cheeked Tody-Tyrant Poecilotriccus albifacies and provide documentation 
regarding two records of the species from Acre, Brazil. These records, one of which 
refers to a male found and photographed by the authors, and the other of which 
involved a pair collected in 1998, are the first documented records for Brazil. In 
discussing these records, we examine the association between P. albifacies and 
bamboo-dominated habitats, and reassess the likely status of the species in Brazil. 

White-cheeked Tody-Tyrant Poecilotriccus albifacies is a distinctive, sexually dimorphic 
tyrannid with a localised distribution in upper Amazonia. Described as Todirostrum albifacies 
by E. R. Blake (1959) from a single specimen collected on the left bank of the Boca del no 
Colorado, dpto. Madre de Dios, Peru, it remained essentially unknown until rediscovered 
at Explorer's Inn (Tambopata Reserve), dpto. Madre de Dios, Peru, on 19 August 1979, 
by T. A. Parker (Parker 1982). Parker (1982) provided the first published observations on 
the natural history and vocalisations of P. albifacies, and also reported on unpublished 
specimens collected by J. W. Fitzpatrick and M. B. Robbins. Parker (1982: 488) noted that 
P. albifacies seemed to be 'entirely restricted to Guadua bamboo', a habitat association that 
has subsequently been documented by many researchers (e.g. Kratter 1997, Fitzpatrick et 
al. 2004). 

In the intervening years, P. albifacies has been found at several additional localities, but 
until recently, it was considered endemic to the Southeast Peruvian Lowlands Endemic 
Bird Area (EBA), with all published records being from southern dpto. Madre de Dios, 
and north-eastern dpto. Cusco, in south-east Peru (Fitzpatrick et al. 2004). Tobias & 
Seddon (2007) reported the first confirmed record from Bolivia, a pair, the male of which 
was photographed and sound-recorded, in Guadua bamboo at Extrema, dpto. Pando, in 
November 2004. Tobias & Seddon (2007) noted that Extrema was c.20 km from the nearest 
known Peruvian locality for P. albifacies, and therefore, the species' presence in Bolivia 
was not unexpected. However, they also noted that a three-day search of similar habitat 
across a wider area in the Extrema region failed to yield additional records of P. albifacies, 
nor did more intensive field work by other researchers (Alverson et al. 2000) at three sites 
(some with extensive bamboo) slightly further downstream along the rios Tahuamanu and 
Muyumanu in dpto. Pando. 

In this paper, we report on two records of P. albifacies from Brazil, one quite recent, and 
the other, an unpublished and seemingly overlooked record from more than a decade ago. 
Collectively, these two records provide the first substantiated evidence of the occurrence of 
P. albifacies in Brazil. 

Results 

On 3 September 2009 EG was escorting KJZ and AW at the Parque Zoobotanico (09°57'S, 
67°57'W; 250 m), a field station managed by the Universidade Federal do Acre (UFAC), 



Kevin J. Zimmer et al. 



256 



Bull. B.O.C. 2010 130(4) 




Figures 1-3. Male White-cheeked Tody-Tyrant Poecilotriccus albifacies, UFAC Parque Zoobotanico, Rio 
Branco, Acre, Brazil, 3 September 200 c ) (Ke\ in J. Zimmer) 

Figure 4. Male (left; MZUSP 80226) and female (right; MZUSP 80227) White-cheeked Tody-Tyrants 
Poecilotriccus albifacies, collected in the FLONA de Macaua, Acre, Brazil, in March 1998 by Paulo Martuscelli, 
and deposited at the Museu de Zoologia da Universidade de Sao Paulo (MZUSP), Sao Paulo, Brazil (Kevin 
|. Zimmer) 



Kevin J. Zimmer et al. 



257 



Bull. B.O.C. 2010 130(4) 



within the suburban limits of Rio Branco, the capital of the state of Acre. This site comprises 
c.100 ha of humid lowland forest with extensive Guadua bamboo (Guilherme 2001, Tobias 
et al. 2008). While tape-recording a Bamboo Antshrike Cymbilaimus sanctamanae in one such 
stand of Guadua in mid-morning, we heard a different vocalisation coming from the canopy 
of the bamboo. The vocalisation, which was delivered at well-spaced intervals of up to 15 
seconds, was a series of 7-10 emphatic, pip or pup notes (with a distinctive, 'popping' quality) 
that accelerated after an initial pause between the first and second notes. KJZ recognised the 
voice, from previous field experience in Peru, as being that of Poecilotriccus albifacies. AW 
& KJZ immediately began tape-recording the bird, which went silent after a few minutes. 
After a few seconds of playback, AW spotted a small bird c.15 m above ground in a vine 
tangle in the central portion of an emergent tree, and visually confirmed that it was a male 
White-cheeked Tody-Tyrant. Additional playback stimulated the bird to drop much lower, 
into the bamboo understorey, where all three of us obtained identifiable photographs (Figs. 
1-3). The bird responded to playback by giving additional songs similar or identical to those 
given spontaneously. It also gave a low-amplitude series of run-together grating notes as 
apparent agonistic calls. The bird behaved in a highly territorial manner, and remained in 
the general vicinity, alternating bouts of vocalising with periods of foraging for the next few 
hours. During this time, it foraged everywhere from 1.5-12.0 m above the ground, mostly 
within crowns of the bamboo, but also in the more open understorey of the bamboo, as 
well as in vine tangles along trunks and interior portions of major limbs of emergent trees. 
Virtually all foraging manoeuvres observed were short, darting, upward sally-gleans to the 
undersides of foliage (mostly bamboo leaves), stems, or vines. At no time did we see or hear 
a second bird. KJZ and AW re- visited the site again on the mornings of 5 and 13 September 
and did not hear or see P. albifacies, although they did not employ audio playback again. As 
of January 2010, EG had not relocated P. albifacies at the Parque Zoobotanico. 

Discussion 

Our record from UFAC is only the second for Brazil. The first Brazilian record was 
a presumably mated pair that was mist-netted and collected by PM in March 1998, in 
Ombrophylous Forest dominated by arborescent bamboo in the Floresta Nacional do 
Macaua, near the rio Macaua, in the Sena Madureira district of central Acre (09°52'S, 
69°23'W). The specimens, a male (MZUSP 80226) and female (MZUSP 80227), are held at 
the Museu de Zoologia da Universidade de Sao Paulo, Sao Paulo (MZUSP). KJZ & AW 
examined and photographed (Fig. 4) these specimens in August 2008. We have no further 
information regarding this record, nor do we know if other researchers have visited this site 
with the focus of re-finding P. albifacies. Because no details regarding the FLONA Macaua 
specimens had yet been published, the Comite Brasileiro de Registros Ornitologicos 
(CBRO), in their official Lista das aves do Brasil (versao 15/10/2008), relegated P. albifacies 
to their Secondary List of Brazilian birds (J. F. Pacheco pers. comm.). According to CBRO 
criteria, species on the Secondary List are considered to be of 'probable occurrence in Brazil, 
provided with specific records published for the country, but whose documental evidence 
is not known or available.' In this case, the occurrence of P. albifacies in Brazil was published 
in Sigrist (2009), but that source did not indicate if the basis for inclusion was a sight record 
or a specimen record. The two records of P. albifacies documented herein, should now move 
that species to the Primary List of Brazilian birds. 

The strong association between many species of south-west Amazonian birds and 
bamboos of the genus Guadua has been discussed and documented by many workers 
(e.g. Parker 1982, Pierpont & Fitzpatrick 1983, Terborgh et al. 1984, Fitzpatrick & Willard 
1990, Kratter 1997). Most of this work has been focused in Peru, although more recently, 



Kevin J. Zimmer et al. 



258 



Bull. B.O.C. 2010 130(4) 



researchers have documented the occurrence of a similar, but slightly less diverse 
community of 'bamboo birds' in Bolivia (Parker & Remsen 1987, Alverson et al 2000, Tobias 
& Seddon 2007, Tobias et al 2008) and Brazil (Parker et al 1997, Zimmer et al 1997, Whittaker 
& Oren 1999). In Brazil, much of the early focus on bamboo-inhabiting bird communities 
was directed at south-east Amazonia, in Rondonia, northern Mato Grosso, and southern 
Para, where the distribution of Gnadua is patchier and less extensive than in south-west 
Amazonia (Parker et al 1997). Investigations directed at these bamboo communities 
produced numerous significant range extensions for bamboo specialist birds previously 
thought to be restricted to western Amazonia (Parker et al 1997, Zimmer et al. 1997, Aleixo 
et al 2000). Interestingly, P. albifacies is replaced at some of these eastern Amazonian sites by 
its presumed sister species, Black-and-white Tody-Tyrant P. capitalis, which occurs in both 
bamboo and non-bamboo habitats (Parker et al 1997). 

EG, A. Aleixo and M. P. D. Santos have undertaken recent research focused on bamboo- 
inhabiting birds at several sites in Acre (Guilherme 2001, Tobias et al 2008, Guilherme 
& Santos 2009), including the UFAC Parque Zoobotanico, where EG has conducted 
an ongoing, long-term survey initiated in 1998 (Guilherme 2001). These surveys have 
documented a diverse bamboo avifauna in Acre that includes almost all of the 29 species 
identified by Stotz et al (1996: 419) as being indicator species of bamboo stands in the 
Southern Amazonia zoogeographic region; 17 of the 19 species classified by Kratter (1997) 
as being 'bamboo specialists' along the no Tambopata in dpto. Madre de Dfos, Peru; 
and, the recently described Rufous Twistwing Cnipodectes superrufus (Tobias et al. 2008, 
Guilherme & Santos 2009). 

The inability of these surveys, and earlier ones (1991, 1992 and 1994-95) by AW along 
the upper rio Jurua, to find P. albifacies, despite their focus on bamboo habitats and the 
relative abundance of those habitats in the state of Acre, suggests that P. albifacies is a 
genuinely rare and patchily distributed member of Brazil's bamboo avifauna, and not 
just overlooked. Similarly, Tobias & Seddon (2007) suggested that the species ranges only 
marginally into Bolivia. Even within the centre of its distribution in south-east Peru, P. 
albifacies is considered 'uncommon and very local' (Fitzpatrick et al 2004). This is in stark 
contrast to most bamboo specialists, which, at least locally, tend to occur in higher densities 
than most forest species in Amazonia (pers. obs.). A parallel situation might be found in 
the case of the Rufous Twistwing, w hich has a wide, but seemingly patchy distribution 
in south-west Amazonia (in Peru, Bolivia and Brazil), and which is generally scarce and 
difficult to relocate at some known sites (Tobias et al. 2008). It too, is replaced to the north 
and east in Amazonia by a more widespread sister species (Brownish Twistwing Cnipodectes 
subbrunneiis) that is not restricted to bamboo habitats. 

This said, P. albifacies is, perhaps, more likelv to be overlooked than most bamboo 
specialists. It is a small flycatcher that spends most of its time in the densely foliaged upper 
layers of bamboo stands and vine tangles, and its vocalisations, although distinctive once 
learned, are not particularly loud, and are somewhat similar to those of the more common 
and widespread Flammulated Pygmy Tyrant Hemitriccus flammulatus. Surveys that rely 
heavily on mist-netting as a sampling technique will likelv miss or under-sample P. albifacies 
even when it is present. 

Our record of P. albifacies, along w ith the recent discovery of Rufous Twistwing at 
multiple sites in Acre (Tobias et al. 2008, Guilherme & Santos 2009), underscores the need 
for further investigation and conservation of the diverse bamboo avifauna of Acre, Brazil. 

Acknowledgements 

We are grateful to the Universidade Federal do Acre and to the staff of the Parque Zoobotanico for 
supporting the work of EG, and tor allowing KJZ & AW access to their forest reserves. We also wish to thank 



Kevin J. Zimmer et al. 



259 



Bull. B.O.C. 2010 130(4) 



Luis Fabio Silveira, Vitor de Q. Piacentini, Marco Antonio Rego, Marina Somenzari, and the rest of the staff 
at the MZUSP in Sao Paulo for their continued assistance in facilitating examination of pertinent specimens 
from that excellent collection. KJZ & AW particularly thank Barbara & Earl Doolin for providing critical 
support that made our work in Acre possible. 

References: 

Aleixo, A., Whitney, B. M. & Oren, D. C. 2000. Range extensions of birds in southeastern Amazonia. Wilson 
Bull. Ill: 137-142. 

Alverson, W. S., Moskovits, D. K. & Shopland, J. M. (eds.) 2000. Bolivia: Pando, Rio Tahuamanu. Rapid 

Biological Inventories Rep. 1. Field Mus. Nat. Hist., Chicago. 
Blake, E. R. 1959. A new species of Todirostrum from Peru. Nat. Hist. Misc. 171: 1-2. 

Comite Brasileiro de Registros Ornitologicos. 2008. Listas da aves do Brasil. Versao 15/10/2008. http:// 
www.cbro.org.br 

Fitzpatrick, J. W. & Willard, D. E. 1990. Cercomacra maiiu, a new species of antbird from southwestern 
Amazonia. Auk 107: 239-245. 

Fitzpatrick, J. W., Bates, J. M., Bostwick, K. S v Caballero, I. C, Clock, B. M., Farnsworth, A., Hosner, P. A., 
Joseph, L., Langham, G. M., Lebbin, D. J., Mobley, J. A., Robbins, M. B., Scholes, E., Tello, J. G., Walther, 
B. A. & Zimmer, K. J. 2004. Family Tyrannidae (tyrant-flycatchers). Pp. 170-462 in del Hoyo, J., Elliott, 
A. & Christie, D. A. (eds.) Handbook of the birds of the world, vol. 10. Lynx Edicions, Barcelona. 

Guilherme, E. 2001. Communidade de aves do campus e Parque Zoobotanico da Universidade Federal do 
Acre, Brasil. Tangara 1: 57-73. 

Guilherme, E. & Santos, M. P. D. 2009. Birds associated with bamboo forests in eastern Acre, Brazil. Bull. Brit. 
Om. CI. 129: 229-240. 

Kratter, A. W. 1997. Bamboo specialization by Amazonian birds. Biotropica 29: 100-110. 

Lane, D. F., Servat, G. P., Valqui, T. H. & Lambert, F. 2007. A distinctive new species of tyrant-flycatcher 

(Passeriformes: Tyrannidae: Cnipodectes) from south-western Peru. Auk 124: 762-772. 
Parker, T. A. 1982. Observations of some unusual rainforest and marsh birds in southeastern Peru. Wilson 

Bull. 94: 477-493. 

Parker, T. A. & Remsen, J. V. 1987. Fifty-two Amazonian bird species new to Bolivia. Bull. Brit. Orn. CI. 107: 
94-107. 

Parker, T. A., Stotz, D. F. & Fitzpatrick, J. W. 1997. Notes on avian bamboo specialists in southwestern 
Amazonian Brazil. Pp. 543-547 in Remsen, J. V. (ed.) Studies in Neotropical ornithology honoring Ted Parker. 
Orn. Monogr. 48. 

Pierpont, N. & Fitzpatrick, J. W. 1983. Specific status and behavior of Cymbilaimus sanctamariae, the Bamboo 

Antshrike, from southwestern Amazonia. Auk 100: 645-652. 
Sigrist, T. 2009. Avifauna brasileira: guia de campo. Vinhedo: Avis Brasilis. 

Stotz, D. F., Fitzpatrick, J. W., Parker, T. A. & Moskovits, D. K. 1996. Neotropical birds: ecology and conservation. 
Univ. of Chicago Press. 

Stotz, D. F., Lanyon, S. M., Schulenberg, T. S., Willard, D. E., Peterson, A. T. & Fitzpatrick, J. W. 1997. An 

avifaunal survey of two tropical forest localities on the middle Rio Jiparana, Rondonia, Brazil. Pp. 

763-781 in Remsen, J. V. (ed.) Studies in Neotropical ornithology honoring Ted Parker. Orn. Monogr. 48. 
Terborgh, J. W., Fitzpatrick, J. W. and Emmons, L. 1984. Annotated checklist of bird and mammal species of 

Cocha Cashu Biological Station, Manu National Park, Peru. Tieldiana, Zool. 21. 
Tobias, J. A. & Seddon, N. 2007. Nine bird species new to Bolivia and notes on other significant records. Bull. 

Brit. Orn. CI. 127: 49-84. 

Tobias, J. A., Lebbin, D. J., Aleixo, A., Andersen, M. J., Guilherme, E., Hosner, P. A. & Seddon, N. 2008. 
Distribution, behavior, and conservation status of the Rufous Twistwing {Cnipodectes superrufus). Wilson 
J. Orn. 120: 38-49. 

Whittaker, A. & Oren, D. C. 1999. Important ornithological records from the rio Jurua, western Amazonia, 
including twelve additions to the Brazilian avifauna. Bull. Brit. Orn. CI. 119: 235-260. 

Zimmer, K. J., Parker, T. A., Isler, M. L. & Isler, P. R. 1997. Survey of a southern Amazonian avifauna: the Alta 
Floresta region, Mato Grosso, Brazil. Pp. 887-918 in Remsen, J. V. (ed.) Studies in Neotropical omithologij 
honoring Ted Parker. Orn. Monogr. 48. 

Addresses: K. J. Zimmer, Los Angeles County Museum of Natural History, 900 Exposition Boulevard, Los 
Angeles, CA 90007, USA. A. Whittaker, Museu Paraense Ernflio Goeldi, CP 399, Belem, Para, Brazil. 
E. Guilherme, Universidade Federal do Acre, Centro de Ciencias Biologicas e da Natureza — CCBN, 
Laboratorio de Paleontologia, BR-364, Km 04, Campus, CEP 69915-900, Rio Branco, AC, Brazil. Paulo 
Martuscelli, Rua Gravata 387, Quinta da Boa Vista, 07600-000 Mairipora, Sao Paulo, Brazil. 



© British Ornithologists' Club 2010 



Thiago V. V. Costa et al. 



260 



Bull. B.O.C. 2010 130(4) 



Discovery of White-winged Potoo Nyctibius leucopterus in 
Espirito Santo, Brazil, with remarks on its distribution and 
conservation in the Atlantic Forest 

by Thiago V. V. Costa, Christian B. Andretti, Thiago O. Laranjeiras & 

Gustavo A. B. Rosa 

Received 26 February 2010 

Summary. — White-winged Potoo Nyctibius leucopterus is known from very few 
localities in the Atlantic Forest, but is supposed to occur throughout suitable 
habitats in Amazonia. Known solely from specimens until the late 1980s, there 
are still very few data on its natural history and distribution. Here we report a 
striking new record of N. leucopterus in the Atlantic Forest, at Sooretama Biological 
Reserve, Espirito Santo, the fourth locality in this biome, the first for south-east 
Brazil and the southernmost ever. Sooretama, together with the adjacent Linhares 
Natural Reserve, is the largest fragment of lowland Atlantic Forest. Knowledge of 
its vocal repertoire and habitat preferences evidently enhance our ability to locate 
the species, and nutrient-poor, sandier soils are apparently critical to its occurrence 
in the Atlantic Forest. Should the Amazonian population be described as a separate 
taxon, as has been suggested in the literature, the Atlantic Forest form will be 
restricted to fragments in Bahia and Espirito Santo, and thus highly threatened. 

White-winged Potoo Nyctibius leucopterus is one of the most enigmatic and poorlv 
known of all Neotropical birds. It was described by Maximilian A. Philipp, Prince Wied- 
Neuwied (Wied 1821) from a female collected near Vitoria da Conquista, southern Bahia, 
Brazil. Until recently, the species was known solely from the holotype and another unsexed 
specimen with no specific locality data (Cohn-Haft 1993, Cleere 1998, Whitney et al. 2003). 
Two additional historical specimens have recently come to light, supposedly collected in 
Bahia but without a precise locality (Cleere 2005). Four other old specimens attributed to 
this species, including a syntype listed by Greenway (1978) and collected in Bahia by Wied, 
have been re-identified as Common Potoo N. griseus (Cohn-Haft 1993, Cleere 2005). 

Following its description, N. leucopterus went unrecorded for almost two centuries, 
until the late 1980s, when Cohn-Haft (1993) discovered it north of Manaus, in Amazonian 
Brazil, c. 2,500 km from the type locality in the Atlantic Forest. Cohn-Haft (1993) suggested 
that the Amazonian population may represent an undescribed taxon, based on its notably 
smaller body size. In addition, he presented much information on behaviour, diet and voice 
(Cohn-Haft 1993, 1999). Following this, and with knowledge of its voice, N. leucopterus has 
been found at many localities in Amazonian Brazil, as well as in Peru, Guyana, Surinam 
and French Guiana (Peres & Whittaker 1991, Parker et al 1993, Borges et al 2002, Alvarez & 
Whitney 2003, Claessens el al 2005, Whittaker et al 2008), and is presumed to be widespread 
in terra firme forest. In contrast, the Atlantic Forest population remained unknown in life 
until, in 1999, Whitney et al (2003) rediscovered the topotypical population of N. leucopterus, 
( .200 km from the type locality, at Una Biological Reserve in southern coastal Bahia. Its 
voice proved quite similar to Amazonian birds. More recently, N. leucopterus was found at 
the privately owned Estacao Veracel, also in Bahia and c.100 km south of Una (Carvalho et 
al. 2009). These localities appear to be the only sites in the Atlantic Forest. 



Thiago V. V. Costa et al. 



261 



Bull. B.O.C. 2010 130(4) 



Here we report the discovery of N. lencopterus in Espfrito Santo state, Brazil, the first 
record for south-east Brazil, the fourth locality for the species in the Atlantic Forest and a 
range extension of c.320 km south. 

Study site and Methods 

On 4 July 2009, during field work at Sooretama Biological Reserve (hereafter Sooretama), 
in eastern Espfrito Santo (19°03 , S, 40°08'W; Figs. 1-2), one of our aims was to search for 
N. leucoptenis. Sooretama comprises c. 24,000 ha of lowland Atlantic Forest, and with the 
adjacent 21,800-ha Linhares Natural Reserve, owned by the Companhia Vale, forms one 
of the largest remnants of tropical forest in lowland eastern Brazil (Parker & Goerck 1997), 
and the largest fragment north of Rio de Janeiro state. It consists of a diverse lowland forest, 
known as Floresta de Tabuleiro (Rizzini 1987, Peixoto & Gentry 1990), associated with sandy 
soils originated from Tertiary deposits that are deep, acidic and of low fertility (IBDF 1982). 
Comprising many different formations, in most areas tall forests grow on drier soil with 
the canopy reaching 40 m, a second arboreal layer and a relatively sparse understorey, 
and mussimunga forest, which consists of lower stature trees and herbaceous vegetation on 
sandier and humid soils. The reserve is surrounded by Eucalyptus spp., coffee and papaya 
plantations, and some private reserves (Marsden et al. 2005). 

The Sooretama-Linhares complex is critical for bird conservation in the Atlantic Forest 
(Marsden et al. 2005), having been designated an Important Bird Area (IBA) by BirdLife 
International (Bencke et al. 2006). Its known avifauna comprises c.300 species, including 




Figure 1. Map showing the Atlantic Forest biome (shaded; left) and Brazilian states of Minas Gerais (MG), 
Bahia (BA) and Espfrito Santo (ES), with recent and historical records of White-winged Potoo Nyctibius 
leucoptenis in the Atlantic Forest (right). The diamond marks the type locality at Vitoria da Conquista, Bahia, 
circles other recent records and the star our record at Sooretama Biological Reserve, Espfrito Santo. 



Thiago V. V. Costa et al. 

large raptors such as Black-and-white 
Hawk-Eagle Spizaetus melanoleucus, 
Harpy Eagle Harpia harpyja and 
Crested Eagle Morphmis guianensis, 
psittacids like Blue-winged Macaw 
Primolius maracana, Red-browed 
Parrot Amazona rhodocorytha and 
Blue-throated Parakeet Pyrrhura 
cruentata, Banded Cotinga maculata 
and White-winged Cotingas Xipholena 
atropurpurea, and the largest known 
population of Red-billed Curassow 
Crax blumenbachii (Parker & Goerck Figure 2 . Quirinao trail Sooretama Biological Reserve (19°03'S, 
1997, Bencke et al. 2006). Furthermore, 40°08'W), Espmto Santo, Brazil (Thiago V. V. Costa) 
like other fragments in southern Bahia 
and central-northern Espfrito Santo, 

it harbours many principally Amazonian taxa, such as White-fronted Nunbird Monasa 
morphoeus, Ringed Woodpecker Celeus torquatus and Cinereous Antshrike Thamnomanes 
caesius, suggesting that this region was formerly connected to the Amazonian forest (Willis 
1992). 

Field work was carried out using binoculars, digital recorders (Sony PCM-D50 and 
Sound Device) and Sennheiser ME66 microphones, and an iPod and Altec Lansing IM237 
speaker for playback. Recordings of N. leucopterus used in playback are those presented by 
Naka et al. (2008). 

Results 

Survey work was undertaken within Sooretama, mainly along the Quirinao trail, 
from before dusk until 22.00 h. As the moon rose we periodically whistled and performed 
playback of the song of N. leucopterus. Around 19.00 h, with the full moon at c.45°, we heard 
the species' typical call notes (with which we are very familiar in Amazonia), c.50 m distant. 
We were unable to record the calls but persisted to imitate the song. After c.15 minutes 
without response, a potoo-like bird flew silently over us in the canopy, which was c .25 
m tall with some scattered emergents. Approximately 20 minutes after the first response, 
and following constant imitation, a bird answered again, and this times its call notes were 
sound-recorded: a bweep, given both perched or in flight (Fig. 3), much like that of nominate 
Short-tailed Nigh thaw k Lurocalis semitorquatus, but slightly different in frequency and 
length (pers. obs.). Thereafter, the N. leucopterus called repeatedly, including a fast series of 
call notes, also given by Amazonian birds (pers. obs.). After c.15 minutes, it gave the typical 
song, a long, descending whistle, feeeooooo, after which the bird moved away and was silent 
for c.lO minutes, before singing spontaneously c.20 m away. The song was heard just twice 
and could not be sound-recorded. 

Remarks 

Both the song and call notes match those of the Amazonian population presented by 
Cohn-Haft ( 1 993) and Claessens ei al. (2005), and the topotypical form in Bahia (Whitney 
et al. 2003), which appears slightly different in pitch and length. Whitney et al. (2003) 
mentioned that songs recorded at Una show considerable variation between recordings, 
and are longer than those of Amazonian birds presented by Cohn-Haft (1993). However, 




Thiago V. V. Costa et al. 



263 



Bull. B.O.C. 2010 130(4) 



e 4 



0.5 



1,0 



15 



10 



25 



3.0 



40 



45 



Tune (seconds) 



Figure 3. Sonogram of the call notes of White-winged Potoo Nyctibius leucopterus, recorded at Sooretama 
Biological Reserve, Esprrito Santo, Brazil, on 4 July 2009, by Thiago V. V. Costa. The recording was made 
using a Sony PCM-D50 digital recorder and Sennheiser ME66 microphone, and the sonogram created using 
Adobe Audition 3.0 and Photoshop 7.0. 



these comparisons are based on a small sample and the variation could represent an artefact 
of playback stimulation. Unfortunately, we were unable to compare song length of the 
Sooretama bird with others, and further recordings are needed to verify the extent of any 
variation between the two populations. 

According to Whitney et al. (2003), several attempts to locate White-winged Potoo in 
southern Bahia and northern Esprrito Santo in the 1990s, also using playback or by imitating 
the Amazonian birds were unsuccessful. These authors do not mention if Sooretama or 
Linhares were visited during their field work, but A. Whittaker (pers. comm.) has made 
annual visits (in September-October) since 2002 to Linhares, and G. M. Kirwan (in litt. 
2010) made annual visits to both Sooretama and Linhares in 1998-2007; both regularly used 
playback or imitated N. leucopterus during nocturnal excursions without success. We were 
unable to visit other parts of Sooretama, or Linhares, to determine if N. leucopterus occurs 
throughout the entire fragment. However, given that the remnant is continuous, with a 
homogeneous soil type and appearance to the vegetation, we suppose that the species could 
occur throughout the complex. If future field work confirms its presence in Linhares, then 
these reserves will probably support the largest population of N. leucopterus in the Atlantic 
Forest. The complex totals c.50,000 ha, i.e. approximately twice the size of other fragments 
that support the species in Bahia (see Bencke et al. 2006). Furthermore, it lies very close to 
other forest fragments in the municipalities of Aracruz, Jaguare and Vila Valerio, including 
Comboios Biological Reserve, Goytacazes National Forest and many unprotected areas, 
together nearly 170,000 ha (Projeto Corredores Ecologicos 2006). 

Our confirmed record adds a new species to the well-known avifauna of Espfrito Santo 
(Simon 2009), and brings to four the number of Nyctibius in the study area, including Long- 
tailed N. aethereus, Great N. grandis and Common Potoos N. griseus (http:/ / www.vale.com/ 
hot_sites/ linhares/ fauna_aves.htm). The last two were also recorded by us. This appears 
to be the highest number of Nyctibius species occurring syntopically in the Atlantic Forest, 
a phenomenon observed only in suitable parts of Amazonia, where the same four species 
occur alongside the Amazonian endemic Rufous Potoo N. bracteatus (Cohn-Haft et al. 1997, 
Borges et al. 2002, Pelletier et al. 2005). 

The vocalisation of N. leucopterus is clearly the best means to locate the species, like 
other nightbirds. In addition to its nocturnal and canopy-dwelling habits, that this species 
went unrecorded for >150 years can be explained by the frequency of its song. Like all 
potoos, it is vocal mostly on moonlight nights, especially at full moon and a few days before 
(Cohn-Haft 1999; pers. obs.). Particularly in Amazonia, the species apparently seems to 



Thiago V. V. Costa et al. 



264 



Bull. B.O.C. 2010 130(4) 



be vocal year-round (Claessens et al. 2005). However, it sings very erratically and in some 
situations does not respond to playback for unknown reasons (O. Claessens, T. Deville & A. 
Renaudier pers. comm.). On the other hand, N. leucopterus occasionally responds to playback 
even in full daylight (Deville et al. 2009). Such unpredictable vocal activity contributes to 
the species going unrecorded. One complication is that the year-round vocal activity 
observed in Amazonia may not be replicated in the Atlantic Forest, as the more obvious 
climatic seasons may also lead to definite singing seasons, making the species even harder 
to detect. During our field work at Sooretama, N. leucopterus appeared less aggressive in 
response to imitations compared to around Manaus (pers. obs.), and also gave call notes 
more frequently than the song. Despite the warm, clear night, our observation was made in 
midwinter, when the species might be expected to be less active and not breeding. Thus, the 
periodicity of singing in the Atlantic Forest requires further assessment. 

Concerning habitat preferences, Amazonian birds occur in the canopy of undisturbed 
lowland terra firme growing on deeply weathered clays and in seasonally flooded forest in 
black-water drainages (Cohn-Haft 1999, Alvarez & Whitney 2003). Whitney et al. (2003) also 
suggested that the species occurs in white-sand forest, although in the Guianan Shield the 
species is known only from tall terra firme. However, in the Atlantic Forest nutrient-poor, 
sandier soils appear important to N. leucopterus, as observed at Una Biological Reserve 
(Whitney et al. 2003) and Sooretama, which forests are structurally very similar. Although 
principally found in primary forest, it is also known from forest fragments, edges and 
clearings near Manaus and at Saint-Eugene, French Guiana (pers. obs.; Cohn-Haft 1993, 
Claessens et al. 2005). If we can extrapolate from this, the species may also be less dependent 
on vast, uninterrupted primary forest in eastern Brazil, as observed in Bahia (e.g. RPPN 
Estacao Veracel). 

The geographical spread of records in the Atlantic Forest (Fig. 1) suggests that the 
species was formerly more widespread in central-northern Espfrito Santo and central- 
southern Bahia than today. However, following the drastic removal of native lowland 
forest, nowadays any remaining populations of N. leucopterus are confined to a few remnant 
fragments. Our record in Sooretama makes the species' occurrence elsewhere in Espfrito 
Santo fairly possible. Furthermore, its occurrence in suitable habitat in adjacent Minas 
Gerais also appears plausible. Specific searches for N. leucopterus in the Atlantic Forest 
should concentrate on sandy soil forests, even in small remnants, and knowledge of its 
vocal repertoire and behaviour is crucial to the species' discovery. More effort is needed to 
better understand the species' ecology, behaviour and habitat preferences. Following the 
future description of the Amazonian bird as a new taxon, the Atlantic Forest population will 
be endemic to Bahia and Espfrito Santo, and thus highly threatened. 

Acknowledgements 

We are very grateful to the staff of Sooretama, particularly Eliton Lima and Marcel Moreno of ICMBio, for 
kindly permitting our study. The valuable suggestions and corrections of Jose Fernando Pacheco, Xigel 
Cleere, Guy Kirwan, Luis Fabio Silveira, Andrew Whittaker, Olivier Claessens, Cesar Cestari and Maycon 
Conceives greatly improved the manuscript. Whittaker, Claessens, Tanguy Deville and Alex Renaudier 
also shared information and unpublished observations of N. leucopterus in Brazil and French Guiana. This 
article represents publication no. 18 in the Amazonian Ornithology Technical Series of the INPA Zoological 
Collections Program. 

References: 

Alvarez, J. & Whitney, B. M. 2003. New distributional records of birds from white-sand forest of the 
northern Peruvian Amazon, with implications for biogeography of northern South America. Condor 
105: 552-566. 

Bencke, G. A., Mauricio, G. N., Develev, P. F. & Goerck, J. M. 2006. Areas importantes para conservagao das aves 
no Brasil Parte I — Estados do domfnio da Mata Atl&ntica. SAVE Brasil, Sao Paulo. 



Thiago V. V. Costa et al. 



265 



Bull. B.O.C. 2010 130(4) 



Borges, S. H., Cohn-Haft, M., Carvalhaes, A. M. P., Henriques, L. M., Pacheco, J. F. & Whittaker, A. 2002. 
Birds of Jau National Park, Brazilian Amazon: species checklist, biogeography and conservation. Orn. 
Neotrop. 12: 109-140. 

Carvalho, G. D. M., Benfica, C. D. R. & Zorzin, G. 2009. Expansao do limite meridional da ocorrencia de 

Nyctibius leucopterus. Anais XVIII Congr. Bras. Orn., Aracruz, ES. 
Claessens, O., Pelletier, V. & Ingels, J. 2005. First records of White-winged Potoo Nyctibius leucopterus for 

French Guiana. Alauda 73: 61-68. 
Cleere, N. 1998. Nightjars: a guide to the nightjars and related nightbirds. Pica Press, Robertsbridge. 
Cleere, N. 2005. Previously overlooked museum specimens of White-winged Potoo Nyctibius leucopterus 

Wied, 1821. Bull Brit. Orn. CI. 125: 157-160. 
Cohn-Haft, M. 1993. Rediscovery of the White-winged Potoo (Nyctibius leucopterus). Auk 110: 391-394. 
Cohn-Haft, M. 1999. Family Nyctibiidae (potoos). Pp. 288-301 in del Hoyo, J., Elliott, A. & Sargatal, J. (eds.)